Drosophila_melanogaster Locus Eip75B
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Eip75B
Drosophila_melanogaster
Eip75B
3L
snoRNA:Me28S-A30
57521..57621
108241
AAGCAGTGAATATATATTACAATTAAATTCATTTATAAACAAACAAAGATTAAACCTTA
TACACACGTAAATACGATCATTAAATATATATATTCTTATACACGATACGATTTTAATCA
ATCAATACATCAATCAATTCAGCAAACAATCGAGCGATATACTTCAATTTGCAAAAAAGT
AAGTGTTAAATATAAAATTCTTAATCAATTAAAGATAATGTAATCCTTATTAATCCTTAT
TATTTTGAAAGTAATCACATTCTTTAAGGAGCTATACAAAATATGTGATTTTCGATGTAA
TTTTAATAGGATTAATCCCTTTCAGCTACTTCAAAGAAATACCTACAAACATACTCAGAC
GCTGCTGTGGATCAGGCGTAGCATAAATCAGCAAACAATAAGCCATCAAGTATTATTAGC
AACTAAAACGAACTCAGACTCGGAATCAGCCTCAGAAATCTCAGCTCGAGATCATCAAAC
TTAACTCAACTTAACGCAACTCAGTCGAACTCATCTCATCGTCAACAGAAGAAGCCTCAA
CCAGAATACAACAGATACACGTATATATTTAGACATATGGTAATGATCAAGCAACTGTGG
GCAGGTATAGGAACAACGCTAAGCTAAACGTAAGGACTAAGGACAACAACAAATTCTCTA
GATTACAATAGAATACAGAAGAAGAGGACAACTTTTTCATGCAACTTTGAAGGCTGACAA
AACAAATTTTTGATAATCCAAAAGCAGAAGCGAACAAATTACTAAAAAACCACAAACAGC
AACAAAACACGCGTTAAGAAGAAGAGACTGATTTTAAAATAAAAGAGCTAGGCAGCGGAA
AGGATAAAAGGCAGCAGAAGTGAGGCAAAAGTGATTAAGGATCAAATCCAATTAAAAAGA
AAACAAACAAACGCAACTTTCCATACAACATATTTAGAATATATATCTAAGAAACATTGA
TATTTTTGAGCGATTATCCCTTCTTTGATATATCATGTTGAAGAAACTCAAATGCATGGA
GGCGGTCCAGGCAGCAGCGGCTGCAACATCATCCGGAGGATCTTCAGGCAGTGTTCCGGG
TTCCGGTTCCGGATCTGCATCGAAACTGATCAAGACCGAGCCCATTGACTTTGAGATGCT
GCATCTGGAGGAGAACGAACGGCAGCAGGATATCGAGCGGGAGCCGAGCAGCAGCAATAG
CAACAGCAATAGCAACAGTTTGACCCCCCAGCGATACACACACGTGCAGGTGCAGACCGT
GCCACCACGCCAACCCACAGGTCTGACCACGCCCGGTGGCACCCAGAAGGTCATTCTGAC
TCCTCGCGTAGAGTACGTGCAACAGCGAGCCACCAGTTCCACAGGTGGTGGGATGAAGCA
CGTATACAGCCAACAGCAGGGCACTGCTGCATCGCGATCCGCTCCACCCGAGACCACGGC
CCTACTGACCACCACTTCGGGCACACCACAGATTATCATCACTCGAACCCTACCCTCCAA
TCAGCACCTGTCGCGCCGTCATTCGGCCAGTCCCTCCGCCCTGCACCACTACCAGCAGCA
GCAGCCGCAGCGTCAGCAATCGCCGCCACCGCTGCACCACCAACAGCAGCAGCAGCAGCA
GCATGTCCGCGTGATCCGCGATGGCCGGCTGTACGATGAAGCCACGGTAGTGGTGGCTGC
CCGTCGGCATTCGGTGTCGCCACCACCACTGCACCACCACTCCAGATCGGCGCCCGTGTC
TCCGGTGATCGCCAGGCGCGGTGGTGCTGCCGCATATATGGATCAGCAATATCAGCAACG
GCAGACGCCACCGCTGGCACCACCGCCGCCGCCTCCACCACCGCCGCCACCACCACCGCC
ACCCCAACAGCAGCAGCAACAGTACATCTCCACTGGTGTTCCACCACCCACGGCAGCGGC
TCGGAAGTTTGTGGTTAGCACCAGCACGCGACACGTTAATGTGATCGCCTCCAATCACTT
TCAACAACAGCAGCAGCAGCACCAAGCACAGCAGCATCAGCAGCAGCATCAGCAGCATCA
GCAACATCAGCAGCATGTGATCGCCAGCGTTAGTTCTAGCAGCAGCTCATCGGCCATTGG
ATCAGGCGGCTCTTCTTCTTCGCACATCTTTCGCACGCCCGTGGTTTCCAGCAGCAGCAG
CAGCAATATGCACCATCAGCAGCAACAGCAACAGCAGCAATCGAGCCTGGGCAACTCGGT
GATGCGGCCACCTCCGCCGCCGCCTCCGCCCAAGGTCAAACACGCCTCCAGCTCCAGCAG
CGGCAACTCGAGCAGCAGCAACACCAACAACAGCAGCAGCAGCAGCAACGGCGAGGAGCC
GTCTAGCTCGATTCCTGATCTAGGTAAGTCGCCTCCGTTCCAAGACAAGTCACTCGGACT
GTTAAACTAGCCACCCGTTGACCCTGACGGCACTTGTCGATCGCTTTATGGTCGGATAAA
ACGGCCGGCAGGTTCCTACAGTTCCTAATACGAAAAAACACAAATACAGGCACACTAAAC
TACACAAGCAGTTTTTGTTTTTATTTGCTTAAGATTAATCGAAATTGCAACACCAAATGA
GAAAGTATACTTATCAATACCACGGATACCGGACAAAATAACTTGTGTTTAGTGTCAGAT
TAAGGGTTTTGTCTATCAGTGGTAGTTATCACTAAATAATAGCTAAATGTAATTCAATAG
GAAATATCAGTTACAACATAATTAATATCTCTGACATCTGTAGCTTAGTGTAAAAGTGGG
ACGGACAAGCTTAGCATGTAGGAAATTAAATATGAGTCAGACAGCAGTTAATATGGCTTT
ATTTGTACAGTTAGTCGCTGCACATGTTACCTTTGCTTATACATATATATATTTACGGAA
TATATAGTACTAACGGTATTGCTGATACCATCAAAAGGTCAAAACAAATATGAGTAATTT
GACTTTCTTCAACGAGCAAAAACATCTAGAATAGAATAATGAAGCACGTTTCAAAACCGG
AATGCAATATTGGTATTGGGTCAATAGTGTTTTCTGTGGGGACTGCGTTTGATAACCTTT
AATGGATGTGAAAGTCTGTTGAAGAATTCTTTTTAGCGTATTGTGATTACACATTTCAGT
TTCAAATCCACAAACTCACTCATTGGATTACCTCATAATTCAGGATTGCCTTTTCGGAAT
GATATATTCGTGTATACATATACGAATCCAATCCAAACCAGTGCTGCGCCTCAAATTTTT
ATTTAATTATCAATTTAAATTGAAATTGTTTTCGGAGGTTGGTCAATAATCCCACCCGCC
CCCTGTCATTCTCGACACACTTTTCAGCATTGCCAAGGTTGCGAGATATATGCTATATGT
ATATTCCTATACATATCTGTGTTAATTTTTTGTGTGTATTCAGCAATAGCCTCTCTCGCT
CTCTCACCTTGAACTTCAACTGAAATAAACTTGCCGCTCTGTCTGCTTCTCTGCCTTCCT
CTGACGCGATGTCTGAGTTTTGTTGGTATCGTATCTGAATCTGAAATGGCACTATATCTA
TATCTATATATATACATATATGGGTGAAATTGCGTAGAAATGGAAGATATGCAAAATCTG
CATTGTTTGATTTCGTTTGCTTTTATGAATTACTCGGCATCTTAGCAATTTGCAATGCGG
ATTTTACTTAACCGCTTCCGTTTTTCAGGTTTTTGCAGTCTAGACAAGATATTCACAATT
AATTGCCTAAAATACAAACAAAGGCTTATTTAATTTCTATTCAAATTTGTAATGCTTTAG
CAAATTGCAGACCGCTGTTTTTATTTAGCAATTAAACATTCCTTCAAATAAGCCATTTTG
TAAAATCCCAAATAAGAAGACTTTACTCGTTGAGTTTTTGTAAGAAACTGATTTTATTTG
GAAATATCTTCGGTTTAAATAGGTGACATGAGAATCGCATCTTAAAGTAAATGGCCTACG
CAGAGGCCTACGTAAATAGTCCCCGCCTTATCGAGGTCCCACGCTCGGGCACATCTGCCT
ATCTTGAGCGGCGAGGACCTTATCTGTGGTCTCCCACTAAGGGACTATTTTAGGAGGCGG
GGAACGATCTCAAGTGACTGACTCATGTAGTGTGCACTTAAATTACATGTTTTTGAGCAA
TGCACCCATGTCGCCTTAGATAACAAAATCCTAAATATAATTTATCGCTCTCGATTCATT
TACATAAGATATGAACGGAGCCCAAAATTGTAAGTCTTTAAATATATTCGTGTTCATGTG
TGAACATTCTGCCAAAGGGCCAGCAAAGCTGAGATGTACATTAGTATATTAGTTGCATTT
ATAACAGTAGTGGACTGTATTTATTTGATATATGTTCATTTATTTTGCAACTAAGATTTC
AATGGGCCTAGTTTTTCTGGCTTTTAATTTTATTGGATTACAATTATGGTTTATATTATT
TTTAATTCAACAATTTGTACTTAATTAACTTATTTTAAACATTTTGCTTTTTCTATGTAG
AAGTACATTTTCTATTAGTGGACTGTATATTTTTATTTGTTATATTATTTTATTGTTTAT
TTACTATTAATATTTATAGTACTGGCAACGGACCTGCAAAGGTTATTGCTTGCATTCTTT
GTTGCACAGCACATTTCCGTATGAAATATATTATTAATACTATCATTAGTATTAAAGCAA
TAATTAATCCAGCATGTCCGGAAATATGATGGAAATGTAAATCTTTCAATTTTTGATGGT
TCTCTTTCATAAATTTAATTTCATTATTCAATCGTTCAAATTCCTCAGTATGATTTAATA
TTGATAGTTTCAGCGGATCCCAAATAATCTTCGGCACTCCACTAACTTCTCCTATATAAG
GTGTTGATAATAATTCTTCACTTTCGGACTGAATGTTATGGTGGGCAACTAGAATTTTAT
CGTCGGTTCTTGCCGTACAATATGGCGCAATGCTTAAAACTCCTTGCTGAGGCAAATCAA
ACAATTCAATTTGAGAGCCAGTACATTGCAGACGGACTTTTGAATTCGCAGGAACCTTAA
ACAACCAACTACTTTTCTTTTCTAACTCTACCCAGTAACTTTTAGAGTCGACTACTGTTT
TATAGATGCAGTTCGCCGCTTTATCTGGCTTTAGAGGCTGAATCTCACATGCATTATCAT
TCGCTGAATTCCAGGGCCAACTTCCTTTGCATATTCTCTTATTTAGTTGCCATTTCTGAC
ATTGATTTAATGTGGCTTCCGTCATTATGTGATAGGAATCTATCTCAAAATTATAAATTA
AATATTCGGACGTTGTATGCACCATTATTATCCGATCTTCATTTCGAATTGGCACCGGAA
TAAGCCTGAACAATTTGGATGGATGCCTGCTAAACAGAGGCACTTTTGCACTAATGATCA
ATTTATCGTCGATGAATAAACCCCTGGCTGTTAACAGTGTATACACCTCCTTAAGTTCCG
TACCTGACCGTTTTCCTGGAATTACTAGGTTCTCTGAAAGACTCTGCTGAATTTTGGCAA
TTTCTTTTTTAAGCTGATTTGGCCTGAGAATATTTGTATTTAGCCTACCGTGATTAATAT
CAATCAACAGGCTTATAATGCCTGCTTGAATTTTTTCGCCTTCTTCAATCAATGAGTGTA
GCTGTTTCGTAATCATAAAGAATTTTATTGATTCCTTATAAACATAATAATTTTCTTTAA
GAACTTCTGTCATGTTCTCAATTCTTATTTGCATACTTCTAAAATTGGAGTTAACATCTT
CTGTTGTTCTCTTTAATAGATTAGAAGTTGAATCAACCACAGATGTTTGTTTTTGAATTA
GTTTATCAAGGTTGTTCTGGTTATCTAACAAATTCTTCATATTTTCTTCTAATTGCTCTC
TATCATCTTCATCCATTATACCAAATAAAATATGATACAAGGAACCCATAAATTCGAAAG
GAGCACGCTTGCTTCTAGATCTAGACTGCATCATAAACAATTTATTGTTTTCTTCAAGTT
CCGATAACTGACTTTGCATATTATCTAAGACTAGACTACATTGCTCTTCAAAGCTATGAA
GTCTTTCGCAAACTTTCCTCATACTTTGTATAAGCGCATTACCCTTTGTTAACATTTTAA
AATATGGATCCATTTTATAATAGATAACCAAATTCCAAGAAGTACTCACAATCTCAACAT
CTCCTAGCGGGTCTAGATATATTGCTGAGGTTTTATTTATTTTGTCTATAGAATATCTTG
GTGCTATATCTTTAGGTAATGCGCTAGAAACTTGACAACTTAACACAAACAACAACATTG
CCATAATGATTCCGATCTTGGACATTCCCGATGTCGCTCTAGTCCGTCTTTTTGGCTCTT
GGTCAGCCTCATTTTTGTCAACAGACTTTATTCCTTCCAAGGGACAAATTTTAGTAATGG
GTCTAGTGATATATCCTTCCTGCATCTTTACTTTAGCCACTCGGACCTTATCATCATTCC
CCTTATGCACCTTTTCCACCTTTCCTAAAGGCCATCTTGCAGGATGACAATTCTCATCCT
TTAATAAAACTATTTGCCCTTCTTCTATATTAGGAATTTCCTTTTTCCATTTATTCCTTT
GCTGGAGCGTATGCAAATATTCACTTTTCCACTTAACCCAGAAATCTTTCTTTATTTTTT
GGATAAGTCTCCACCTATCCAAATTTCCGATTTTTTCATCTTCCATTGGTTCGACTATTT
CTAAAGGTGGTCTTCCAATTAAAAAATGACCTGGTGTTAAAACTTCTTGTTGGTCCTTCT
CACTAACTATAGTGTATAATGGCCTTGAATTTAAGCATGCTTCTATTTGACATAAAAGAG
TTGACATTTCTTCATAAGTCAAAATAGTGTCGCCGATTATACGCTTTAAATGGTATTTCA
TTGACTTAACTCCAGCTTCCCAAATACCTCCGAAGTGAGGTCCTGCCGGGGGAATAAAAT
GCCAATCAATCCTGTCCTTTTCAAGCTGCGCTGCAATCGTTATATTTTCTTGTATTGCAT
TAAATAACTCTTGATCTAATTTTCTTGCAGCTCCTACAAAATTTGTTCCGTTGTCTGAAT
AGATATTGGAACATTTTCCCCGTCTAGCAATAAATCTTCTGAGTGCTGCTAAAAATGCGT
CTGAAGTTAGATCGCTTACCATTTCTAAGTGTATGGCTTTGGTGGCCATGCAAACGAATA
CAGCAACGTATCCTTTAAATGTTTTTTGGCCACGATTTTTTGAACATTTAACATAATAAG
GACCTGCGTAATCTATTCCAGTATTAAGAAACGGGAATGTCATCGTCACTCTATATTTTG
GCAAGTTACCCATTATTTGCTGAGCTGTATTTTGTTTATACCTTGCACACGTTACACATT
CTCTTAAATACTTTTTCAACGAATTTTTCAACCCGAAAATCCAATACTTTCTTTGGATAT
AGTTTCGCATTAGGTTTATCCCTCCATGCAATGTTTCCTTATGAGCATTTTTTATTAATA
AGCTTGTTAGGTGGCATTTTTCTAAAATGATTGGATGTTTAACATTAAATTCTGCATTGG
AATTTTGCAATCTTCCTCCAACTCTTAGAACCCCATCCTTGTCCAAAAATGGATTCAATG
ACAATATTTTATTATTTGTCTTGATTTCCTTTTTGATTTTAAGGCACTTTATCTCTTGCC
TAAACTGGTATTCTTGTTGTTTCTTAATAACAACTGTTTCCGCTATTCTTATCTCCTTTA
CTGAAATAATTGATGAATAGGCTTTATTTCTTGTTTTCATCTGCACGAATCTATTTATGT
ATGCTATTATACGTATAAGTTTTTCTATACTGGAATACCTTTCTATTAATTCGTAAATAG
GATCATCTATTTTGTCATTTAATACCGTATTTATTAAGACAGGTTCTTCTACAGACTGCT
GCCGAGGCCAAAGTTCTTTTGGGTCTGCTAGCCATTTCGGACCTTTCCACCAAAAATCAC
AGTTGATCAACTGGTTAGAATCCACTCCCCTGGATGCTAAATCTGCTGGATTATCCTCTG
ACTTAACATGATTCCATTCAGTATTTTTTAATTTCCGAATGTCATCCGTTCTTCTTTTTA
TAAATTTGATCTTACTTTGACCACTGTTAATCCATGCTAAGGTAATCGTGGAATCACTCC
AAGCATAGATCTCCATTATATTGTCAATTGATCCTTTTAGTCTTTGGATTAATTCACTAA
GCAGGTGAGCTGCACACAGCTCGAGTTTGGGAATTGTCTTCCTATTTTTTATAGGGTTGA
CTCTACTTTTGCTAGCTATTATATTAACATGAGGTCCTACTTTAGCATAGACTACTGCAG
CATATGCTTTTTCGGAGGCGTCCGCAAATCCGTGAATCTGAATGACTGAAGAACTGTTTG
AATTAATCCACCTTGGGATTCGAATATTCTCTAACAATAATAAATTTTCTTTATATTTTT
CCCAATAATTTTTATCTTCTATGGATAATTCCTGATCCCATTCACTTTTATTTATCCAAA
GTTTTTGAATAAAAAGTTTTCCTGAAACCGTGACTGGTGCCAACCATCCTAACGGATCAA
ATATTTTTGCTAGCGTTGATAACACAACGCGCTTATTTATATTTTTTGATTCATCATTAC
AATTTACGCTGAACTTAAATAAATCCTTTTGAGGTTCCCATTTTAGTCCTAAAGTTTTAA
CACATTCATTTTCGATAATATTGAGAACCTTATTGTCCCCTGTGTCCTCCACAGTGGTTA
ATATTTTGGAATTGTTGGAAATCCATTTCCTTAAGTTGAATCCAACTTTCTGCAATTCAT
GGGGAATTAATGTTATTAATTTATTAGCTTCTTCTACCGAATCAGCTCCAGTCATTAGGT
CATCCATATAGAAATCATTCCTAATTATTGCACTAATAACTTGGTTTTTACATTTATCTG
CAATATCTACCAGAACCCTGGTAGCCAAATATGGTGCAGATGCAGTTCCGTAAGTGACTG
TGGTTAATTTATATGTTTTAATTTTTTCTTTTGGAGAATTTCTCCATAAAATATATTGAT
ATTTTTGATCATTATTATCTATTTTAATTTGTCGGTACATCTTTTCAATGTCTGCCGAAA
CAACAAATTCCCATTTTCTCCATTTAATAATAATGTCAAAAATATCTTTTTGAACTCGTG
GCCCAACCCACATTATGTCGTTCAAACTTTTGTTATTCGTAGTTTTTGCTGAAGCATCAA
AAACTACTCTCAATTTGGTCGTAAGGCTTGAATCTCTAATCACTGCCTGGTGCGGTAAAA
AATATTTGCCTTCATCACTCACTTCAATCATGTGTCCTAAATCCATGTATTCATTCATGA
ATTTAGTGTAGTCAACCTTAAGTTTTTCATTTCTTTTTAGTTTTTTCTCCAGATTCATGT
AACGAGCTATCGCTTGTTTCTTTGAATCTCCTAAGGTGACATCCTCCTTGAATGGAATTG
ACACAATGTATCGCCCATCTGAATCTTTTTTTGTCGTTTTGATAAATTTATTTTCACAGA
TTTCAGACTCGATATCATCTTTTTCTTCTTCTTCCACTTCCCAGTAGCGATCTAACTCTT
TTATTTCTATTGTTGTGGCTACAATGGTTTCTTTTCCTTTGGATTTTTTACATCCAGAAA
CTATCCACCCGAAATCAGTTTTTTGCCCAAGGAGACCGTCTATTTTTATAACTCCATTTT
GCAGAATGTGAGTATATACGTCTGCTCCAATGATTAAATCAATGCGACCCGGTTTATTAA
AATCGGGGTCGGCTAATTTAAAGTTCTTCCATTTTTTCTGATCAACATTAATCGTGTTGA
CTGGAAGTGCCTTCATAAGTTTTGGGAGAATAATTGCTTCAATTTCTAAATTTTTCGGAG
AATTTCTTATCGAAATAACCGCTTTGTGCTTGGAGATGCACGTTCCTGTGGAAGATACTC
CACTTATTTCAGTATGAGACCGAAATTTTTTCAATTTTAGAATCTGTGCAGACTCTTCTG
AAATAATTGTGCTTTGAGAGCCACTATCAATCAATGCTCTTAATTGTTCAAAGCCTCCAT
ACCTCGACTTTACTTGAATCAAGGCCGTGGCCAACAAGGCTTGACCTGTTGTTCTACACG
TATTCACTTTTTCTGGATTATGACCTGCAAAGTGAAGTAACGTGTGGTGAGGTTTACGAC
AAGTCGAACAAAGCTGCTCGCTTATACATTTTTTACCAAACGGATGCCTCAGACATCTTA
GGCAAATCCCATTTTTTCTTACCCAGTCAGACCGTTCTGCTGGATTCATTATTTTAAATT
TATGGCATTGAATTAAATAATGCCCTGGTAGTTTGCAATATGCACAATTGTCACTATAAT
TTTTATTCTTGTTATTATTAATCATTTTCTTTACAGGTTTTACTTCCTGTGAGAATGATG
ATATAGAATTGAGCCTTTGCTCTAAAAAGTCCATGACATCAGAAAGTGCCTGTATTTCTT
TTGTCTTTTTAACATGGCTTTCATATAAATTGAGTGATTCTTTATTGAATTTCCGAAGAA
TTATGTGAGCGAAAATTGCATCCACATCTTCTGGTAATTGTGCCTTTAATTTTATAATAT
AAATTGACTCGTTAATCGTGTCAATAAATGTCTTTATTTGCTTATTGGATTCTAAATTTA
AATTTGGCATATCCATAAGCCTATTCATATGATCTGAGAATATGTTTCTTTTATTCTCAT
ATCGCTTGGTCAAAAACTCCCAAGTGGCTTCATAATTTTCTCCAGAGCCGAGCAGTAAAT
GAGTAACCACATTTCTGGCTTCTCCTTTTAATGCTGACTTTAGATAATTAAATTTGAGAG
AAGGACTGAGATCCTCTCTCACATGTATGAGCTCTGTAAAGAGTTCATTAAAAAGATCCC
ATTCTTTGGAATCACCAAAGAAGGTGGGAATCTGTATTTTAGGCAGGGTTGGTAACTCCT
CCGCCTTAACAACCGTCGACATTTCAGCTTTATTTATTGTGCCACTGAGTCGACTATTAA
TGGCTGTAAGAATATTTTGTTTGTCAAATTCAAGTTCGCTAATTTCTTCTTCGAATAGCG
AACTCTCAAAATGACTATTCACCTGTTCAATCAGGTTATCTATTTTATGCCATAAAAATT
CAATTTTATTTTTCCTTATTTTAAGGAAATCTGGACTACTGTCTATTAGTTTAGACGTAT
CTTCTAGATATACTCGAAATTGGCCAACATTATTACGAAATGCCTGCTCTACTTTTAAAG
CGTTGTTTTGTGCTATACCCTCTTTTTCAGGGTGACCACGCATTTCAAGGTTTAATGTAG
GGGGAGGGTTTGATTTAGGGACAGTGTTTGATTTAGGGAAAGTGTTTTCTACCGACTCGC
CCTTAATTTTTTCATTTTTATTTTTAATTTTTTCTAACACCATCATTATTAAATCATACT
GCTTCGCGTTAAAATATTCATGATCGACAACGCCGATCTTTAACAAATTGCTATGATTAG
CAATGAAACATTTTTGAAGCTCATTTAATTTTAGAATTTCTACATCTGTTAATGTTGGTT
TTACTTCCAACTTTCTAATTTCCAAAATAATTTCGGACTGCTTCTTAAGGAATTGAATAG
TCTTTTCTGACATCATTTTGAAAATTTTTTGTAATTTCTTAATATATATAGTACGTGTAT
ATGTATTTTATATGTATTTATATATATATGTGTGTTTGGATAAACAGAAAATTCTTGTTT
TGACTTAGCTGATGTCGTTGTTGTTGCTGCTGCTGTTGCTGCTGTTGTTGCTGCTGTTGC
TACTGCTGTTGCTGCTTCTGCTGCTGCTGTTGTTGCTGCTTCTGCTGCTGGTAGAGGCTC
CTTTGAATTTGACTTCCTTCTCTTCTTTAAGGCTCCGTCGATGTTTAAAGATGATTTTTT
TTTTTGCACGTTTTATTATTTTTGTAGTCCAGTCAGATTTTTTGTTTTTTAGCCATTTAT
TTCGGCATTTATGCTCTTTTGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGC
TATTAGAGCATTTATAAGGCACTGTTTTCAGGCACTTTTTAATTTCACAATTGCTGATGT
ATGGCCTCAAGCACGCCTTACCACAATTTATAATGGTACACAAAGCAACCTTTAGCTATA
GACTATAAGGTGCTTGTTTTAAAACATAAAAGATTCTTTTGTATCTTTTTGCTTTTTATA
TTTATACTCTGTTCCTTACCTTTGGTAGGGGGAAACAAGAGTCACTTATTTTTGCTACCT
TTAGCTGCAAGATTAACTTAGCAATGCTTAAAGGAGCTGGCCTTTCTCTGAGTCCCTTAC
CTTTGGTAGGGGGAAACTGCAGAGTCGATTAAAGGCTCGATTGACCAAATGTAAAATCCC
AAATAAGAAGACTTTACTCGTTGAGTTTTTGTAAGAAACTGATTTTATTTGGAAATATCT
TCGGTTTAAATAGGTGACATGAGAATCGCATCTTAAAGTAAATGGCCTACGCAGAGGCCT
ACGTAAATAGTCCCCGCCTTATCGAGGTCCCACGCTCGGGCACATCTGCCTATCTTGAGC
GGCGAGGACCTTATCTGTGGTCTCCCACTAAGGGACTATTTTAGGAGGCGGGGAACGATC
TCAAGTGACTGACTCATGTAGTGTGCACTTAAATTACATGTTTTTGAGCAATGCACCCAT
GTCGCCTTAGATAACAAAATCCTAAATATAATTTATCGCTCTCGATTCATTTACATAAGA
TATGAACGGAGCCCAAAATTGTAAGTCTTTAAATATATTCGTGTTCATGTGTGAACACAT
TTGTTAAACCTTTTTTTAAAAACTTTTGCCTTGTATGTAGTATTTACAAAAATGTTTGAA
TGGCATTTGTATGCAAATTCAACTTTAAATTAATATCTGTGATTGTCACCTAATTATAGT
CCATAAGAATTTTCGTTTTTTTTTTAACTTCAACAACTTGTTGGGATTTCCTTGTAGCAG
TGTTCGTTTTTGATATTTATGAGAATGCTGGGGTGCGATTGTTTCATAACTTATTCACTT
TCAGTTTTGTTTTGTTTCGCTTCCCCCAAAGCTTTAATTAATCAATTTGTTTATTTTTCC
ACATAAACGATGAAGCGTAGTACGATTATGTGGCCAGCGCTTTTTTGGTCAGGTTAAATC
ATATGTTTGAATCGGAATTTCCAGCTAAGCGAGGAACCTGTTCTTCGAATGCGAAAAATA
TACGAATGAAAGTGACAGTTGAGAATGTTTTTCGGGCTGAGAGCTCTTGGTATTCTAATG
ATTTCATTTGGCTGAGCTGTGATTTGTATTTTTTTTTTTTTTCTTGCACATGTCCAAGAT
ACGCTTACGTTATACAATATATACGAGCGTGTGTGCTTGTATGAAGAGTCGGACGAGCTG
ATTTCTTGGACTACGGCTTGTTGTTCTTGCCGTTCTCCTTTTGTTGCTTGGCTAATAAAT
AAACGAGTCGGCGAGCTGAGCAAATAAAAGTCAAGGCCAACCAGGCCGACTTGATAGATT
TGTTTGCCTTTTCCACGCCGAGCCATCGGTTTTGAAAATGATTGCCGAGTTACCGAGTTA
CTACTTTCCATCACTTAGTTTTCCCCATTTGCTGGACATGTCGGGTATGCTCGATTGTAG
GGCACTTCAGTTTTCAATGTCAATGCCAAAACCTTAAGCTCCACGCATCACACATATCAG
CAATGGGTCAACACTGCGGCCTTGTGTGTGTGTGTGTGTGTGTGTGCGAGAGTGTGTGTA
TGTAGAACACTCATAAACGTCCATATCCCTCATGGAATGTATTTTTATTCCATTGTTATC
ATTTTGCGCAAGTGACAGGCGCAATTGCCGCACATAAACATTCATGGGAAAGCGAAACTC
TAAGAGAGGAGAGTGGGGGGAATATCTGGAATTTATTACCTTTATATAATCTATTGCATT
ATCATAAAAATATACTTTAATTTAATTTAAACAGTTAAGGAAAATAAGTATTTTTTTAGA
TATTCATTATATATGTATAACACACATTTCCGACTGGATTTAGATTTTTTATTTTGCTCC
TAAAGGTGTTCGTTCTTACATGAGTTTGTTGCGTTGCACAACCATTTTCGTATTAAACGC
TCAACAAATAATTTTAATTTCCCAGGTCGAGGGATTACCGATCGTTTTCAAATGTGGCAA
AGATTACAAAACACATTAAACAACGCGATTAAGGGCGAATATAAAACTTAAACGAACTTA
TTTACATTTTCAACCCGAACAGATCAGTTAAGAAGCGCTAAAGTTAGCCAACTGTTGTGT
AAACGGTTTTATAAACTAGTATATAGTGTTATGCAAACAGTTATCCAAAGTGCCAGTTCA
AACATTGCGGTAAACCACCTCCTACTGACAACAAGTTCTACATCAACTTTTGAATAGCTG
CATTTGCTTGGCTAATGAATTTGGTTTGGCAAAATATTGCTACGATGTTGCTTTTTTATC
GATCTAATTTTCTGTCTTCGTTGTTTCCTTAACCCATTGAAACAGCTTATAAATATATAA
TAGCAGCTATGTTTTGATTATCAGTCATAATGATTGGCCTATATTATACTGAAGAGCAAA
CGCATTTGCCTATTTGGGTTCTAGCCAACTTTCAATTGAGTCATTAGCAGTGTTTTTGAC
TTATTTTTCCGGTTTGCCTGGGCAAGTCTCTCAGTCATCCGACGACCTTGTCAGTGAAAT
TGCGCTCTACATTACATAACACCCATAAAGAGCAAAATTAAATGTTGATTTTTGCTCGGA
AACAGCATTTATATTATTTAATAGAATAAAAGGCAAACGCGTAATTTGTTAAGGTTTAGT
TGTACCATGTGCCATTGAATAAATATATAGATTATGGCCTATATTAACCGATCAATGATC
GCCGCAGAAAATCGGGAGGCATCGCGAATGTATTCCGCTTGGGGGGAGGCGATGGGTCGA
GGGCTTTCGACCTTCAGGTTATACAAACTAGTAATAAATCTACGTACTTGTTACTAATTT
CCCTTCAATGCATAGTGTGTAATGTGCAATGTGTTCCATAACTGAATTAAACACATTGAT
TGGAAGTATAAGCGTAATGATCAATTGCAACCACAATGTAATGAAAAATGCGCGTTGATC
AAGGTATTATGACATTAGACAATTAAAATATTACAGATTTTTAATTAGTTATTGCATTTT
ATTTTAAATTATTGTTTTTACTATTAGAATCTTATCTTATATTAAGTAAGATTTAATAAT
TATTCTCAGTTAAAGTATATTTTCTAATGAGTACTTATGTACTAAGTATTCATTAATAGC
CCCATTCCCCTATTCAGAATGAAATTCCATTTCAATGGCCCTGAATTACGATCAGTGATT
TTCGCATAATTATTCCAGCACTGATTGATTTATAACTGTTGTACTAACTGAACTATGCTT
AGTTCAACTGTAATTCAATTGTAAATGAGCAAAACATTGACACAAAGTCACGCCAAGTCC
AGTCTGGTTATGGCGATTTTTCAGTTACTTAACCAAACACGAAAAAAAAAAAACAGTTAA
CAAAAGTATCTGGCGGATAAAAAATGCCTCACGAAGCACAACAAAACCTGTTCTAATAGC
AAAAAAAAAAATCGAAACAAAACAACATTAACGAAATCCAAATGCAAATAACACCAAATA
TAATATATAATGTGCAATTGTATAAAAATGCGAATTACAAGTGGGCGAGCGTAATAAAAA
TGTTAGAAAAAAGCACAAGGTCATTGAGAAGCGGAAGAGAAAAACAAAAGGCAAAAAGCA
GAAAGCAAAAGGCAATAGCAATAGAAACAAAACCCAGGCGAACACAAAAAAAAACAAAAA
AATGTGACACACTGAAAGCGAGAACACAATAATTATACAAACAAATATTTATGTATGTAT
GTATGCACGGGTTGGTTTGTCGGGGTTTCTAGGCGGCGGGGAGGGTGTTGTGTGCCTGGC
AAGTGCAGGCGTATAACGTGAATCTAAAACATTTCCTGAACGAGCGAGCGAGACGGCGGT
AACAATTAGCGAAAAGTGAATTTGATTACAGTTGCAACGGGGCGTATGAGTGACGTACTT
GAGTGCCGCCTGCGATCGAGCTATCGCCGTCTCCCTTCCGCGCCCTTGCCCACACCGTTA
CAATCGCATTGAAACTGAGGCTGCGTAACGGTATCGCACTAGGCCAAGTTACAAGGTCTC
GTCGGTAATCCCACACCCAAGCGGTATGTCCTCACAGCGATATTTCCATGATTGCCAACT
GGCATTGCATTCTCCTATTCGAGTTATATTATTATTATTTATAACTAACAGATGTGAAGT
GCATTCTCGTTTCATAACACGGCTAGGAAACCCTTTTATTTATATTAGGATAATTTATAT
TTCACTTGATACGGGACAAGTGTTTTAAATTTGTTTGCTGATAAATTTCGAATTGCATTG
CAAATTTTAGTCCATTCGTTTCGTAGTCACTTCGAATTTCCACGTTTTCCATATACTGCT
GACTAGGTTTTACAAAGTACAACTGAATCGGGAAATTAAGAAAATAGAAATTAGAACACG
AAGTACAGTAGTATTCCAATGAATCGACTATCAGATACCCGTTACTCTTTTCAGTTAATT
TTGTTCAGTAACGGGTATGAATAGTGACAAAAAAATATTTTGCACTTACATGATGTAAAC
ATATTGCAGACAATATGATATTTCTTTTCTAAGACCAATAAAAATATTTATTAAGATTTA
TAGAGCACTCAATGTAGATCACGACACGTATTCCTTTTCCATGCAGCATAATTTTACCGC
GTATATCTAATTAAAAAATACAAATTATTTAAAAATATAAAATCTTCCTTAAATGACTTA
CATGCTGTGTTCTTAATTTTTGTGCGGACTCTTTCAAAATGGTATAAAAGAAGTATTAGC
CTTGTTTTGTGCACAGTGAATGTCGAATCTGCCCCGTTATTAAAGTTCTTTCTTACTGAA
TAATTTCACCACAAAATCGAGTAGCAGTACAAGGAATATTTAAACAAATAGTGTAACTGT
ACGGCAAGCAATAGCTTAAATCTTTTCCAAAATTTTATAATATATTTCAATAATCCTGCT
GTCAATTTTAATCCCTTCCAGTCCACTGCTCTTGCTTAGATCCAATTAATTTAATTAAAG
TTCTCTTTAAGATATCTGCATAATTTCACTGTGGCGGCAATGTGCACAACTAAATCGAGA
AATATATGTAAATAATGCAGTTGCAGCTAGTGCATATAAATTTAATACTTACTTAAAGGA
AATACATAAAGGATGTTATATATTGGAAAGAAATAGCTTATGATCTTGCCAGCGAAGAAG
ACCCCCTTTGAGTTCTGATATAAAAAAAGAAAAACAAGTTATTAAGCTTATTAGATGGCC
AAATGCGAATTATCAGGAGCTTTGCTTACCAGGTGGATTCCAACAGCTAGTAAAGTTCCA
GCAATGACGTACGAAAGGGCAAAAATCACATCCATCGAGTAAAGGATGCGGAAAGTTGAG
GGAGACATGTCAGCACCATGCATATGCAAATAAAAATCCACGACTGTAATAGAGCTTTTC
AAAAGTATTACATTGTGAATCGAAAAAATGAGCATGAAGAGACCGCATGAAATGCAGAAA
GCGGCATAGAAAATTGAGCAGCACCGAACTGGTTGTTCCTCACACGATTTACACATTGTT
AAATTTTTCAAAATATTTTATAATTATTAGAGCAATAACACGGTGAATTTTTTGTAAGGA
AACAAAATTTTGAGCGACTGACTTGTGTTAGTACAAAAACTGTAATGAAATAATATTCGT
AGACGACTGCGACGTGCGAATTTTTGGAAACTTTCGGCAGCCTACTTTGTTTAACACAGT
AGATCACCAAAAAGTAAAAGACTTTAATATCCTATTTAAAAGTTAAAATCTTTAGATCAA
TTTGTGTAGATAAAAAGAAATTTCGCACTTAACATATAGCTATGTCATTAAGAAAGTGCA
GTATTCTTATCAACGAAGGCTTGTAAAGCTGACTAAATGAATATTTCTTTAAATTTACAC
CAACTAATTATTTTGTGCTGTTCACGATGAGAGATGCCTTCATTTTATAAAAGAATGAAT
CACAGGATCTAAGTGCACACTCATCCCTTTAACAAATCACCTCTAATTTTAAGCAATACC
TTTTGATTCCTTTTTTACTCACTCGAACCACACCATCACAGCAGATTTTCATTTAGCGAA
CCGCATCTTTAAAGGTCCATAAAATGTAGATCAACATCACTGGGCACGTGGATAAACAAT
TTTGTCGGTCTTTTTCTAAGCGTACCTAGTAGGTACTACCTACATACACCTTTTAAAACT
TGCTGAAAATACATTCCCTTCAAATAAGCCCATCTTTAAGTGATTCAGTTCAGCATATGT
ATGTAACGCCGAAAAAACAAATGACCTAAAAAACACTTCCTATATCTGTTGCTCGCTTTT
TATTAAATTTAAAGCTAAATTATACATTATCCTGAATAAGTGTATACCGATATACATAAT
TAAAAAAAATAATTAAAAAATTTCCATTTTTCCATTTATTTTTCGATTATTCCCGAGGTA
GCCATGTAAAATAATGCTCAGACTTGCATTACACAGAACACTGCTTTGAGGATACTTTAG
TGCATATATACTTTCATATGGTCACAATTCTCTCCTTTACAGTGCTGCAAAGCTTCTTAA
TGAAATTAGTGTACAATTATATAAAAGAATGAATGACGTCAAGACACGAGCTTGAAATCG
TGGTAATGCGAAGAGTTCTTTGAAAATATTTATTTTAATACAGTTTTCACTTATTTTGGT
ATATAGTTTCACAAAAAATTTTCCTCGGAATGAAATTGGTTTGCTGCTATAATACAAATT
TTGAATTGCATTGCAAATTTCAGTCTATCCGATTCGTAGCCACTTTGAATTTTCACGATT
TCCTTATACTGCTGAATATTTTTACAAAGTAAAACTGAGTAGAGAAAACAAAACAGAAAT
TAGAACATGGAAAAAGAACTATAGTCGATTGAATCGACTATTTCTTATTCTCGTTACTGG
CATTTTTATATTTTATTACTTGTTTGAATTGATTGAAAGTATTTCTGATCAAGAATATTT
ATACTTTGCAGCGTCGTAATCGCAGCACAAATAATTAGCCTTGTAACGGGTATAAGTATT
TAACACTTACATGCCGTAGACAAATGATTACAGTATTAGATGGTAATAGGATATATGTAT
CTATTACAACACTCAAAAGCAAAGTCAATTTTGATCATCGGTCGGCACTGCGAATTACCG
AATAATTTTCTTGCTGTGCATTTTTTCCACGTATAACTAAATCAGGGGAGAATAAATTTA
TAAATGTTATACACTTATATAATTAAGCACTTACATTATGTTAACTATTGTAAAAGCTGA
AATGAGTCCACAATTATGTATATATATATACAAATGTATCCTTTGTTGCATCCTTGTGAC
AGTCAATTTTGTTATCGTCGAATTTATTAGGTTTGAGAATATCCAACTCTGCTCTAATCA
AAGTTTTCCTTTAGATATCTGCATAATTTTATCACACAGCCAATATGTATAACTATAAAA
AAAAAACAAGAAAAGAAAATTATATGAGTGTGTATTAGTATAAAGGTCAAATGTAAAAAT
ATGTTATACACTTACCTAATGGAAATACATAAACAATATTATATATGGGAAAGAAATAGC
TTAAGATCTTTCCAGCTTTAATAAATCCCTTTGTTTTCTTAAAAAAAAAAAGAAAAAACA
ATGGTGATTACTAAATAGTTCTAATATGAATTGGCTGAACGGTTGCTTACGCTTTTGATT
CCCCAAGCTAGCAAAACTCCTGCGAGGACATACGTAAAGGCAAAAATTAAATCCGAAGCG
TACAATATCAAAAGCTGTTTTTCCGTCAAATCAGTGCCATGTATGTGCAGAAACCAATCC
ATAATGGTAATAGACTCTTCTGATATAATTACATTGTGCAGCGAGAAGCTAAACATAAAG
AATCCTGCTCCCATGCAGAAAAATGCATAGAAAGTCGAGCAGCATGATGCTGGTTGTTCT
TCGCACGACTTACAACACATCGTGAAGCTGGTTTAAATATTTCTTAAAATTTTTTGAGGG
AAGAAAAAAAAACTGAAAATTTATGTTTTTGTGAACACGAATTTTGAACGACCGATTTGT
TGAAGTACTGTTAGAATAATAAAATGTATTGAACAAAATTTCGTAGACAACTGTGATGTG
ACAAATTCGTAGGCATTACATTCATATTTATTCGTAGGCATTGTACAAATAAATTAATTA
AATCAAATAATTATTGTCGCTAATATACAATGCATTCCATTGTTTTTCATTTATTTCAAA
TATTTCAAGCGTTGTTAAAATTTATTTAAATGATTTCCGAAAGCATCTTTTTAGATTCAG
ATAGTTTTGTGGCCGAGTGTGGATGCATTTTTTCTTTATACAATCTAAAAATCCAATTAT
TTTAGGGCCAGGTTTGTCTTATAAATCGGCATAATTTTATTGCACAAAAGCAATGTACAA
CTGTATACAGAAAAACTGACTATATTAATGTATTTATTCAAATTGCTTCATAGGATAAAC
GAACTTACCTGTTGTTACCACAAACATCCAGGTGTAAAGGGCAAAGAAGTAGCTTAACAC
TTTTCCAAATTTGAACACTGTCTTCGAGTTCTACATTAAAGTCAAGTTAAAGGTTTATAA
AAGTTTTTAAACTTATTTTACCGTTCTTATACCCAGCAGCATAAGTATCCCAGCCAAAAT
ATACATTATGGAAAAAAGCATAATAAAGGAAACATCAAGCCATGCATAGACTAATACTCT
CTTATACTTTAAACTTTTTGAAGAATAAATGTAGTTAGTTAAGTGCAATACAATTTGGAT
ATATTTGTCTATATCGATTATAAAATAAATCGAGTATCCAATTCCCAAGGTACCTATTAG
TATACACCATATAGAATAGAACTTCGCCCAGCTCGATGTTTGTATTTTTGCGCCGAATAG
ACACATGAGAAAATCATCAATATATTTTTGAGAGAACTTTATTCAAAAATATATCCCTAA
ACTTTTTATCTACTCTGAGATAATAGTCTTAGTGAATTTGATTGAGTTTTTTTTTTATTA
AGCCCCATACCTCTTGAATGTCATAGAGTTGAGACATACAGTCGAGTTGAGCTTTGAATA
GTTCTATATCAGGTATTTTTACAAGCTGCCTAACCTTGTTAATAATGGTTTCACTTTTAC
CGTTCAACTAATGGCCTCTCCATATTATTACATTGTCACGTGCCCCTTTCGTTGTGAATT
TTTCAGAGTCTGAGTCAGTTGGCGGCCAGTTGGTGGAAAGCTTTCAATTTCCTATAACAG
AATTTGATCTGAATCATCTTTGCGTGGTTAGAAGACAGTTTCTCTGACGTTAATCTGAGC
AGTCTTTCAAGGTAGCATATAGTTTGAGGTCAATTTTGTTTGGGTTTCCCAGAAAGCACT
ATTAGCGTGAATCATTATCATATCTCAAAAAAAAAAACACTTTCTGATGAAAAAAAAACT
CTTTTTTCGGTAATCAAAAACATTATTTGAAAGATTGATTACACTTAAAAGATTTTTAGT
ATATATTAGTAATATTAAAATAAGTAACTGTTGTACATCTTTTCGGTAAACTTTTGGTTC
CCCTCTGGGCATTTTCAGACACAATGACTAGCCATCTCCAATATTTATGCAAATATTTTC
ATATCCAGCCCATTAAAACCTCCAAATCCCTGGGGCGAGCAAGCAGTTGCCCTGAATTGC
ACATTTAGGTCATGAACCGGAAACGTCTTAATTACATGAAATAAGTGAAGCTCAAAGTCA
ATTTAAATGCACCACAAAAGTAAAAAAATCGCAGAGTGACCAAAAAAAGAAAAAAAACAA
AAGTGCAGAAAAAGGGGCGAAAAAAGGCGCAGACAGCAGAGTATTGCATACATAAAAAAC
TCGAATCAAGTTAAATAATTAAGCTGACCAGTAAAGCAGAACAACAGGAAGGGAACGAGG
GAGATAGCTAGACTAGTGAAAGAGAGAGAGAGAAAATCGGCTGACAAAGGAACGAAATCC
CAGCAAGCGAAAAGTGAATAAGGAATTTTTAATTTTTTTAAATTTAGAATTCCATATTAT
ATGAAGGTTTGTTTTTATAACAACCCATCAAGGATCAGTATTTATTTAGAAAACTTTATT
GAATAACGCATATCCCCACTGTTTAAAGAATAGGTATCTCGAGAACAAGAACTGAGCCAG
AAACGATAAATCGAAGACCTTGAACTTTGGTAACAACAAAGGCATGCAGAATAGTCCGAA
CGAAGAAGAAATGAGCCTGGAAAGATCAAAATCGAGATGGCGAAGGGGCAACATTACCAG
CATTAAATCAAGCAGACCAAACCAAAGGTCCAATGTAGGGCAGACAGAGAAGGACGGCAA
CAGAAAAAAAAGAGAGGGGAACAGCGAGGGACTCGTCTGGTTATTAGCAGGATCGGCAAA
GTATAAAAAACTGGTTGCAGACGAAGCTCATGAAGAAGTTTCTCAGGCAAGTGCCATTGA
CCTACAAGCAAATGTCGTTGGCTTCTTGTGGATCGCGAAGAACGCAAGCCAGAGGGAAAG
AGAAAGGTATACCGAGTGTAGAAAGAATCAGCACATGAGTGAGGAAAGGGAAAGAGGAAG
TGCACAGAGAACCTTAACATATTGCGAATCTAAAATTATTCTAATTAAATATTAAACATT
GTGTACAACTTGGTGTGAAAGATCTAAACAGGGATATATTTATAGTCGTACTAATAACCT
ATATTCACCTTTAGCATTTAGCATTATAGGATGTAAAGGATAGCTCTTTTCATATTTTTT
TCGTGACTTTCGTTTTATGGATAATTATAAAAAATCCTTTTTCTTACTGTGCAAAGGAAC
TTAGGTTTGGTAGGTGGGCTGGCCTTGATATTGTCAACGACATGACTTCACCCAAACAAA
AACAAAAACAACAACATCACCGACTGCAAAAATTTAAAAATAAAATACCAAAGGAGAGGG
ATGGCCCGAAGGGAATGGGAAAGGGAAAGGGAGGGATATATAGCGTCACGCTTGGGACTT
GGGGGCGCTATTTATACATTTTCCCTCCTGTGATCTGCTTTTTGTTTATACGCGCGCCTA
AAAACGTTCTCAGATTCTGCTGCTTAGCCCCTTCGATCGCTTCTGTTGCCCCAAAACTTC
CAACAACTAGCTGCGATTCGAATCGCGGCTGTACTCGAATCTGCAATCTGCATTCCCTTC
AATATGCTATTGCCATCCCGCTCCGACCTGAGAGATATAGCCCAAGTGCAGTGCCCTTGA
CTTAGGTCAATAACACGATTTGTTGTCGTTCTTCGGTTCTTTGGCTAGCTCTTAGCACTG
ACATTATCGATATGATGCACACTCTATAGGTTCTAACTGGGTTAAGAACAACATATGATT
TATGTGATTTATTGAATTAAGTTCCTTTATTCTTTTGAATCTATTAATTTGTATTAATTT
TGAATACGAAACCAAATTATCTGTGTGTCTAATCAATCAAACATGCTTAAGAAAACAAAG
GAAACCATTTTTATCGTAACCTTATTGTCAATTCTGTTACAGCGTTGCATTCAATTTTGT
TAGCAAAGCGAGTTAGTAAGAGTTATTGGCATTTTGAACAATTAAACTATAAACTATTTA
AAACAGTCAGCAGTTTAAATCGATTGTATTTCGATGAAAACCCCTCTCGAAATCCGCTGA
TATCCGGGCAGCTAGAACCTTATTAACCCAAACAAATACCGAAAGTACCCGCACACGTCG
CTGATTAAATGGCTCATCCTTGGACATGCCATTGCCACTTGACAGTGACCTTAGAACAGC
CGAACGAAGGCACCACCCCCCAGTGGCCATTACCACCCCCCATTTTCACACCCTGTGCCC
ACCCAAATGACACCCCCCGTGCGCCCTTCGTTGGACTGCAAATGCTGCTGCATAACCTTT
GCCTTGCATTTGGAGGCGATGCGCATGAACCTGACATTGAACGTGATGGCAATGAAATTT
TCCGAACTACTTCCGAGAGCGAAAGAGAGAGCAAGTGCAGCGCAGAAAGAGAGGACGAAT
AGTGGGCTTACCGGTAGAAAGGGAACTTAAAACATGCCCATCCCACCGCATCGCCCAGGT
GAATGGGGGCTGGCATTTTTGATGGCTTTCTACTATACATTGTTGCGTTGCTTTGCCGGG
TTCTCGATTCTAAATAGTTAGGGGCTGGGCTATAGGGGTTATAGCGTGGGCAAACCAACG
TTGTGGCGGAGGTCAGGTCAGGGCCAAAGCACTTGACATTTCTCCCCCTGCCACAAGATC
ATAAATATTACAGTTCCCTAGACTTTCCCCACATATATGGGTTAGTGTGTCACGCAAAAC
TTGAATGGGATATTTCTTATAAACAACATCGGATCGGTTCAATCCGAAACCAACAAGGTG
TCAATGAACCAGATGAGAAATCGAGCCATACGCAAAATGGAAGTAAATTGTACTGAATTG
ATTTCAACTCTATTTCTGATGAATTATGGAATACTTCTTCAGTTTTAATGGAAAAGCTAT
ACAAATGTGTTCTTTGTTTGGCTGGATTTTAATAAGAAATAGTATTATATTCATATATAC
AATTGATTTGCCAATACAAACCTTTATTATTGGTAACTTTGGTTTATCTAAAAAGTTCTC
TAAACGAGCCTAATTGATACATAATAGATTAGTTGAAGAATTTTCCTCTCTTAACTTATA
ATCAAATTTCACTAAACTGTGTAAACTGACACCAAAAATTTTGTTTTTCCTATGCAATTT
TGCTTAACTCATTTTCGGGGAAGTAAACACAAAACTAAATTACGGCTCTCACTCTCGTCC
TTTTCGCCTCTCAGTAAAAAGTATTTTTTTGTTTGTTTTTTTTAAATAGATTAATAACTT
CCTGGAAAAGTATTCCCATATAATTTTTAATTACAAAACAAAAAGATTTTATATTTATAA
TATAACATAACTAGCGTTAAATCTGGCTAATAGTTTATTTGTTAGGTGTCGTTAAATGTT
GTTAAAAAAGTTATATTTGATGTGGTGAAAACGTTTGGTCTTCCTATATTTCCGTGTATA
TTGTTTTTGCGACTGCTGAAATTGACAAGTCCTTGTTCGTGGTCAAGGCCGTGTTGTGGG
TTGTGTATGTGTATGTGCGTTTGTATGCGTGTGTGTGGTGGGGGTTCAATTACTTGTGTG
TGTGTGTGTAGACTGCAAGATGGCAATGAAATGTGCATGCGTTGACAGCTACAAAAACAG
CAACAACGGTCTGGGCGCGTGCTCTTCGGATTGTATAATGAACGCACAAGGACAAGGATA
AGGACAAAGGCGACAGGCTTTCACTCCTTGCATTCCACTAGTCTCCTTTCGTTCATTGGG
TGCGTGTTTTTTGTGTGATAAGCAATGTCAATGTCAACTTATAATTGCCATTTTGCTTCA
ATTACAACCACTTGAAGTAATAAACATTGATTTTTCCTCCGTGCATCCTGTGGATTTCCT
CTAGTATACGAGCCCAATTTTCACCGGCTTTTGACATTCAATCCGTCTCAGTTTGTTTGA
ATCTATATTTGGCTGTTTCATAATTTCTCCTTCTATCGTCGTATTCATTCTGGCGAAATT
TGGCTTGGGGGAAATATTCGATGAGAAGCCTTGGCTCACTTCCGTGCCTTGAGTAATTTC
CTTGGCATGTTGCCCACTGTGCTGCCAGAGTTGCCACCGCAAACTCACTCACTCACTCAA
TCATCAATTGTGCTCTGACGTAGCTCATAGGTTTGTATTGACCTCACCCACATTACTCTA
TTTCATATGTACATATACATAGACTTCCTCACTCGTCTGCTCTGTGACATTGAAAATAAA
TATTTTTGTGTCTGGGCACGGGGCATATCGAACGATTCGATGTCGGTTAGGTGACCGCCA
GTTTCCGCACTATGTATTCTAATATAATTGAGAGACTTTGGCGCAGGTGGGCAGGTGGGC
AGGTGGGATTACAGGTGCACGCTTAGGGGAAGCAAAATCTAAATAGAATCAAGTGCGAAT
TAAATATAAATAATTTATTGACAGCAGATTTAGCATGAGAATTGCTTTCTAATGGGGAAG
TGCAACGTGATGTTTTTTTCTCTGGTATCAAAAAGTTATCTTAATTTCAACAGTGAACGC
AGCCCAATGCGTTTTTTAAAGTTAATTTTTGTTAATTACTTACCCGATCTAAAATAGCAT
TTTATCGTGACTTAGAGGCATAATCAGAAATTATAATAATAACAAAACAGCCACTAAAAT
GCGATGGGAGAGCGAAAGATAGGGAACTATTGGATGGGAACTAGTGGGAGGAGGGAGGCT
GGCCTTGCCTGAGGTCTTGTGTAAGCGACTAAATGGGGACCTACGTAATGTGTGTCACTT
GCTCCACACTCTCACTCACACACACACACACACACACGCCGGCGAGAGAGAGGGAGGCAA
AAAGTAAAATGAAAATAAATTGTGATGGTCAAGGTCGTTGGCATGTGCGCTTTGCGCAAT
AAAAACACAAAAACCGGGCGCAGAAATGAGGAAAAATGTGCAAAACAAGCGGATAAAAGT
TGGGGAACTCTCGACGCGATGTCTGCAAATCTTAGAGGACCGAAACGAAGACAACCCACT
GACGCCCCATAAACTGACCCACATTTAATATTTACCATTAATCTTGTATTCTCTCTCCTT
TTCTTGCAGGTATGTACCAAAACGCCTTATGATGTCAAGTCCAATTAAATGTAAGTCCTT
CTCGGATGTCGGTTAATGCCACTCAAAGTCAATTAACTGGCAATTAAGCTAGGTCTTACC
TTTGCCGTCGGGCCCCCAGCCAATTACGCCTGGGCAAGGACCTACTGCCCATGTCCTGGC
AGCACCTTGGCAATTTTACTTTTCCACACTTTTCAGTTTGCATTCCGAGGGCAAAAGCTC
TCGCCTGCACTGAAGGTTACTTGCGATCAAGGGCAGCCCAATGTCGGATCCTTGGTAAAG
GATGGGGCTGCACTGCACGTGTAGAACATACAAGGGCAATCTGACACTGAAACCATATTC
TCTATATTAATATTATTCGAATATAAACATTATCATACCATTTCCTTAAATCTTTAGTAT
TTCAATTTGATTTTACGTTTCGCAATAGCATAATTTTAAAATATCGATTTTAAAATAAAT
CCTCTATTATTGGTCTCTATCCTTTCTTTTCCCACTAAAACAGCTGTTTGTTCAATGTTG
CCGCATCTGTTGCACTTCCTGGCGGCAACTTGTGGCTCTTCACCTGCAGAGAAGTGCAGA
AAGCTCTCTCCTCTCCGTCTAAATCTCTTTGACTGTCATCTCTCACTAATTGCAGGGTTG
CCTTTAGTTTGCAATATTTAATTTTAATAGTTGCAACTACGTATTCCACAGAGCTTTCGT
GCGCGAACTTTAGCTGCGAATGCAACCCAAGCGCATCAGCAAAGCTTCAGGTGCAGTTTC
GGACTTTTACGATTTTCTGTGTAAAAACTTTTGTCTAATGCAACTGGAAAATTGTATGAC
AAAGCTTTTCCTCGTTGCATTTTTCGCAGTTGTTGCGGTTCCACCATCTGGCAATAGATG
GCAGCAGGCATCCAGATGTGAAAAATACTTGCTATATCGATTTGGTTTAAAACAAATAAA
ATACTTATTGACCCAATATATAGCTTGAACATACATTACTTGTTTTACCCAATTATCTAA
AAGATTCGAGAAAATTGTTACTTATGAAATATTCATAGCACGATGTTTTTGTTAATGCTT
CCTTTTTCTCGCTTTTTTCCTTGGCATCTTTTAGAATTCAGGATGGAATGTTAACCTCAT
TTGCTTTGTTGTTAATCCAACATAATCCCAAACAAATAGCGCCTCATTCAAATGAATTCC
CAGCCACAATCGTTAAATACCAAAAGCGACCTTAACCTTGAGCAAGTTACACCATTAGTT
GTTGTTTATATTCGGCTTGGCTCCTAAACTTTTTTTACGTTTTTGCGGATGGCAACACAT
TTAATTAACCGTTTACCAGGCCGAAACAAAAATTGAAATATTTCTCGTTTTTCCTCGGGT
TTTTCCGTTTACTTATGGCTCCGAATGTTTCCTTACAGCCATTAGGTTCGGTTTTGGGTG
TTGGCAGGCGTGGTGGGCTGTTAGCCGAGTTGATTGCTACCACCGCCATAGAAGGGGGCC
TATAAATTTGCCACATAACTCTCACACGCATTAGCACTTTGTCAATGTGGCAGCTGGCCA
TCCCTGTCGCTCTTGCACCACCAAATCTCTTTCTCTTTCCTGGCTTTCTGAGCTTTCCTT
TTGCTTTTGTAGCTCTCCGGTCGGGCATGTGTCGAATTTCGTTGGTGGCCTTGACTTTTA
GTAACCTTTCGGTTAATTCTAGTGTTATTAATGGAGCAATTCGTGAAAATTGCTCGCTGT
GCGCTCTCTCTTTCTGCTCCAAATGGTTTTCTCTTTCATTATTGGAGCTCACTTTTCTTG
ACTTAATTGAATTTGTTGTTTGCATTGACAAGACTTTGAGCTGTTTGCTTACTTTAAAAT
TATGATAAATGATTTTATGCGGAAAACATTTTCGAGCGACAGGATACACACATTTTCTGT
TGGTCCACTGGCAAAGTAATACTGTAATACATTTACACTGTTAATAATAATATCCATATA
ATTATTTAAATGTGGCTTTACTTTATATGAATGGTATAATTTTCATATTATACCGACGTG
CATTGTCTTCATATAATTCTCCATTTCATTCCACTTCTACTGCTGCTGAGAGCAAATTCA
TGGTCAATGTGTCAAATCCCCTCAAGCGAAGTCGAAACTCCCTGCATAAGCCGCTTTGTT
TCCGTGAGCCGTCCACCCAAACCACCCACTACAAAAAATACCTCCCACTCACAGCCTCAA
GTTTAAGCCTATTGGGCTAGGCCTTTTCTCTTGGCGTGTGCTAAAAATAACCCATACGCC
CCTTTGGCCCACCAAGACCTTTTTTCTCTCACTTGTATTACATTCCTCTCCTCCTCTCTC
AAATGAAAGCATTTTGCTCCTGTTAGGAAATATTTGTAGGACTCTTAGTATTTTGGCTCT
GATGGAAAAGTTGGTTCCATGCTATGCCTAAGACAATGTTTCTTGGAACTTCTGTCCACG
TTTAAGAGGCCATGTATATTATTCAAAATGTGTATATTTTAAGTTGATATACATATATTT
GCATATCAATTCTTTCGCCAATTTTTGTCAAATTTTTCAATAGTCGTTCTAAATGCAAAT
AGACGGTTTGAATTACATTTATATTCCCATCAAATTCTTTTTGTAAATCCATACTAAAAT
TAATTAATTGTATAATATATATTATATATATATATATATTATATATATTAGTTCAACGCA
CTATTCGTTGTAAGATAGAAGTCCCTTGACTTTTTTATTGATTTGTTTAGTTCACAGATT
TGATTGATATTAGATCTTGGTATGCTGGTATCCTTGTGTGCGATATTTCCTGATTAAATT
TAATGCCGCTCTCAACTTTCCAGTTTCTGTAAACATCCCATCTCGCTCGCACAGTTGTGA
CCTAATGACCTAGCTGTGTACAAGCTTTTGTCGGCCTACTTTGCAAATGGAAGATACATA
AGCTCCCCCACTCTTTAGTCACCTACAACTTTCCACCCAACGACCACATTACACTTAAAT
TTTAAGGTGTCACATATGTTTTAGCTTATTGAAAACCAACAATATGACGCCCTTTTTTCG
GATGAACCCTCTGTGTTTATTAACTTCTTAAGTGTATTGGTATTTGTAAGGAACTTGTTT
ATTTTTCGCTGGCTCACCTAATGCGCATTAACTGCCGAAAAATACACACGAAAATAAGGA
ATATCATATTCGTATGTGTGCAAATGTTTGTGGACTGCCTCAATACTTCCTCGCAAAGCT
TTTCCGCATAATTTTCCCGCTTCCTTTTTGTAGAGCTTTCCCAATAAACACGGCAACAAA
TGTCGCACGCGCTGCGCCAACAACAAAAGCAACCACACTCGTGGAAACTGCTGATTAAAT
ATACACATAATATGAGAACACTGGCGTTAAAAATGTGCACACACCGATATACATAAAGCA
AACCAAAATTTTTACAGTAGATGCTCTAGAACCAGAAAATAAAAAACACGCCATTCATCA
AATATAGTATTACTTTGTAAAAGAATTTACATAGCAACCTGAATTTCAAATAAATGCAAA
AGTTCAAAGATCTCTAAGGGATATATTTTAAGCACATTATTAATAAAGTTAAAGTTTAAA
ATCTTTTTTAATTTAAACTGAATATCACGCTTAGATTCATTGGCTTAATATAATTTCTTA
AAACGTAATTGATACGCATCTGTCTTCGATTCGATTTTATTATTAATCAATTTATTATTC
GATTTTGAATTGATTTAACAAGAAATCATATCAAAATTTTTTCTAGTCATTCACTGTATA
TACCAGAATATTTATCAATTTACAAACATAGTGTATACATAAATATGAAAGAAACAGACG
CAGAGAAAAACAGCCGAAAAGCCCACCCGCAGTCGACGTCGACGTCAGCGTCGCTGTTGT
GTGTGTTGCTTTTGTTGTTTGCCGAGTAAATAGGTGAACGACCGTCGATAATACGCGACC
TTCAAAATAATCTGGGCCAAGTGCTGTCCCAGTGCGCGGTGGTACACATGTATGTGTGCC
TGTGTGTATCTGTGTGAGCGTTTGTATCTGAGAGTGCCGTACACTCACGCACTCTCTCTC
ACACTCTCGCCCACATCCACCCCCTTAGCTCATATTCTTTGCTCTTTCTCTCTTTGTGTT
TTTACGAGTGTGAACAACTTTTGTCGCCCGCTTTTGTTGTCTGCTGCTTGGAGAATCGAA
ACTATATTTATGCGTTTCCTATCACAGTTATTACAATGAATAGCAGCCCATATATTAGCT
TAAATCACAGTTATTTTTACGATGTGGATGCATTGTTTAAAGTATTTACAGAATTACATT
GGTAGGAATTTGAGTTAAAAATTCTATTTTAAAGATTGTTAAATCTATAAAAAAATTAAT
TTGCAAATGGTATATGTTATGTTATTATATATATGGTATTATATTTAAAAATGTATTTTT
CTGTTCTTATTATTTATTTAATAAACACTATCATAGCTTATATAGTACATTATTGAATTT
ATTGCAATATATCACAAATCCTGATAAGCAAAGAAGAACGGTTAGCTTTTTAGTCACCTC
AAAGCTTTTCTGAGCTTTTCACGCACTTTTGTGACGTTTTGAAGGGCCAAAGTCGTTGCA
CTTTATCCAGGACAATGACATGACACACACACACACACACAAGCGAAGCAGCACAAAATC
CTTACACACATTTTGAAAGCACCGTCGGCTGACCATTTGTAAAGCCATTTGAATTGCATT
GCAGGTATTTTCGGTTTTAATTAAAATTTTAAAATTGTCTTTCCTTCGTTTTTTGTCTTT
GTCATCGTTTAGTGGGTGCCGAGGGCTGGGCAAGGGGATTTTAGGTGATAAAACGGTGGG
TCACCATTTATCGGCGCCTTCTGTCCCATTTGCATGAAGTCGTATTGCTTTGGGGGTGAG
CACAGTTCATGTCCTTGGACGAATTTCCCCGAGAGTTGAATAGACACTGAAGGTTATGCG
CTCTATAAATGTATATGCATGACTAAGTGAGTTTCGTGAGAGGTTGAATGCATGGGAAAC
TACGTCAGCGGATCAAGCGACTTATGTGTGGTTGCGGTTAACTTTTTGAGTCCGGACAAG
GAAAGTTCTGAATGAAGGCAATTGTCCTGTCATAAATTCAGTGTATGATTTTGCACTCCT
AATAATATATGATCACTTGAAATCATAACACTTACATGTTGCCTTTTCAAAGTCTCCTAA
ACTAATTGGGCAAGCATAAACTTTTATATTTCATTAAAAGTTTCAATTTTCCTGCTTTGC
ATTGCACGGCTTGCAACCTTCCATTCTCTAACAAAAGTGCGTTTCTCCATTAAGTTGAGC
CCCTTCTCCTCACAATTCTCAGTTCTCAACGGTGTTGGCCTAATCGAATCAGCAGCAAAT
TGCTGGTGGGTTAAGTGCTTTTTATTTTCACACCGTTTGGCGCCTAACACGTTTAATGGA
GCACTAGCGGCAGCCAATCTACACAGATACAAATTTATATAATTTAAGCAATGCCTGCAT
TTTCAAAACCAATAAATGGGTTTCACAATTTATATTTTTCGATTGTTTTTAAAAAAAATC
AAACAAAAATCAATCAAAAATCTAAGGCCTTTGTATTTCATAGGTATGGAATATTTTACA
AAATATTTATAGCATACTTTTGGCATACTTATTTTAATTGTTTCCAAAACACAAGAGAAT
TCTACTAAATTGGATTGTTTAAAAATCTCCTAACGCAACTTCCATTAATTTAAAACTAAG
GTGTAAATTTAAAAGTCATTAGAATTGAACATTTGATTAAAAAGTGAGTACTTCCCTTGA
TGATAACTAAAATATGTTTAGATCTTTCTAATGAAATAATGCAAAGTAGTACCAAGCATT
AGCGCAGAGTTTATGCCAGCTTGAGCAGATTGTAGATAGATTGAACCGGTTACCTTCGAA
TATTTTTCTCAGTGCGCAGCAGCCCAAGTGGTTCAACCCACACCCAGATTCTGCTGCTGG
GCGCTGAGTGCAACGCGAAGTGACCCTGAACCCGTGCAACGACACAGAATCGCTGGCTGC
GGCTGCTGGCCGGGATTGTGCAACATGGCAGCCGAATCCAAATTGAGGGCAGACCCAGAG
GCACGGCCTCAGTGGGCGGATATAATGGCCCCCGGTCCGCTCCCTCGACTTACGTGTTTT
GCTTCGGTTGCAATGAAAAGTTCAAATGCGTTCGCTGACATTTTGCTACAGTTCCCAATG
CCACTCTTGGTTGGCTGAAAAGTCCAAGGAAGAACGGGGATTGCGGAAAACGGAGGTGGC
TTAGCTGTTGGCTAGGACAATCCCCATGTAGCTCAAGGATTCGGTCGCATTCGCGTTGCA
CAAGCCACAGACGTTTACTTACCTAACCCAAACATCGAGTCTCTGGTCTTCTATTTGTCT
TAAATGCAGCTTATGTTGCTAGTGTGCCTCATATATTTATTACATTCTATTGCTGCTCGT
TCTTGTTAAGCAATTTTAATCAACGATAGTTCAAATAACAATTAAATGCATACCAAGGCA
TTACGCTTTTATCAGATTCCAAGGATTTCCTCTATATTAAATATATATTTTTTTTATTGA
GTAATAATAAATTATAATTATATAGAGAAATTCTCTACATAGAATTTGGCCTATGAAAAT
GATAAAAACTTTTATTTTTTGTTTGTTTGCTGGCAAAAGCATAGTTAAAGTTTTATTTTT
AATTGGTGTCCCTTTGAAGGAGCAAGTTTTGTTTCAGGCATTTGTGCTGCGGCTCTCAGG
AAACTTTTTGAGTGGTTTCTGCTGTAGCCCTAGTTGCCTTTGTTGCCATTGTTGCTGTTA
TTGGTGTTATTGCTATTGCTACTGGCCAACGCCGAAGCCTTTCTCACGCCTCGTTTTTGG
CTCGTATCGCTGTTCGTCAGCCCGGCCTTGAATAATTCTTCTGTCATTGGCATTTTCACA
GTTCATTTAACTTTGGCCCGCTCTGCTTTTGCTGCTGCTTCTGCTTTTTTTGGGCCTTCG
TAAGGCAGGACTAGGTTTTTGGTGCTTCTGTTGCCAACCGGAGCGGTAATCAGACTTCGG
CCGAGGATTTTATCCGCTGCATTCCACAAATCGCTTGTTGGTTTTAGCGGCCACAATCTG
ATAGTTTCACATTTGGTTAAATGTTCGTCATCAGCCAATCACTTTTGTCTGGTCCGCCAA
TGGGTTTCAGCAGAAAGGGTTAGGTCATTTAATTTTATTGGAACTGAAATATACACAAAC
TTATGTAAAGAAAGATTTAACTTTTCTACTTGATTAAACTACTGATAATGTTTAAACTGA
ATTCTTTAAATACAAAATTCTATACAACAAATTCTATAGAAACGAATTTCGCTTACAATG
CACATAGGTCTAGTAAATAACACTTTGACTACAAAGGCAAATTTCTAAAAGAAAATGTAC
TAATTTCCTATACTTAAACTAAACCTGTACTTAAACTAGTGGCACTGAGATTCAAAACCA
GGCGCCAAAGCTTTCCCATCACTTATTGCAAGCAGTGCAAAGCTCCATGCAAGCAGTGCG
ACAAACTGTAGCCACATGGCCGGCCCCAAAAAAAAAGCAAAAAACAAAGCGAACAGCTGA
CTGAAACTTGCGATTTTCTGCTTCTGCATTTCGGCTTTGGCGCCCCGCGTTTGTTGTTTT
GCTTATTATTCTGCGTTCTTCGCTCGCTGCGCGAATACCGAATTCTGAACACTGAGACTG
TGCCCGGCGCTCAAAAATCTTTCCCAAACTTTTCGGCATTTCCACGTGAATTTGAACGGC
CAAAGCACAAATCAAAAACATATTTTTTGAGAATTACCCGAGTGTCATAAATAGAGAGAG
TGATAAGTCTTTCTAAATGTTTAATAATTAGAGAATGCATAAACAAATGGTGGCATTTAT
TAGATGAAAATGCATAAAGACTTGGCCAAAAATAAAACACGTAAAAAATCCTACATCATC
TCTACTCTGGTTGCTACCTTGTGATAAAACTGTGCACACAATTATTCCATAGGAAATTTA
ATCAAAGTTTTTTAAAGTTAAAGTTAAAAACAAGTTGATAGCCAAAACTAGAATAGTTAG
CTAAACGAATTGAACACTCACAAAGGTGCCATAAAAAGCCTTAAATAGATTAACAAGAAA
CAAAATAACTAGTACAAATCCTAGCAAATTTATAGATCAATCAAACAATTCCAATCAAAT
ATATTTAAATCAAACTAATTTGAAAGACTCGGTAATACCACATCTGAATAATTAAATACA
TCGAGCCAACGGTAATCAAACATAATGACAGTTGGCAGTCGGGAGGATCTCTTTGCCCAG
GCAAAACATATAGACGATACCGAACGTTTGATTGGACGAGTTTTAGCTGGTGAGTGAATG
AATCACCCTAAATGAAAGATATTGTATCTATATATTGATATATATGGCAATTGAGTGTAG
TTGATTTTCAAAGGTTTTTTTGTTTTCCAACTTTTTGGAAAAAAGATTTTCAATCTTACA
TACATTTTGAAAATCAAATATCAAATCTGTCATTATAGATTTAATATGTATAAGCAAAGA
ACATCTTTGTATCTTTTAAGCCATTCGTATTGGTATAAGAAATAATAGTTAAGCCTAACA
TAATAGCTAAGTTTAATTAATTAAAATGTCATAAAAAAGCGACATTTTGTGTGTCTAAAA
TCTCTTCCCACTTCATTCTCATCCACAAGCGGCAACGAATTTCCCAGTCTCGAAAAAAAA
AAAATGATTTCACTTTCTGTCTATCTTTCTATTGGCTCCATGTACTGCGAGTATTTTTGG
CGCTTCCTCGGCGGTCGTTGAACTCATTAACCTAAATTTTCATTTTGTGCAAAAACAAAA
AGCAAACACAACAATCTGAGTGAGGGGGGATAAGAGGCAGGTCCGTCATGACGATAGCAA
ATCGCATTTGCTGGCTGCCATTTTATTATCTTTGCCGAGGGGATATTTCTGCAAGTTTTG
GGCAATAAGAATTTTATTGGCATATTGGCTGGCCACATCATGAGCTGATTATTTTATGCA
TTTTCAAATTATGCATTAATCATAATGCCGCATAATTAAATTACATATTCATGTTTGGCA
TCAAAATGCGCAGAAGAGAGAAGAGAATTGATGAACGAATTAGCGTTTATGCGAGATGCT
TAGGATTATCGTAGAGTGTTTATAGGACAATACGTAAATAATTTTAAGTTCAATTTAAAG
AAGTGCAAAATTATAATTTTTATATTTTTTGTTTAAATTTAACAAAACAAGACTGTATAA
ATAATTTCCGTTTTCAATAATACAGAAAAAAAAAAAGTTTAAAATGCTCTATCCAAAAAT
TTGTAAATATATATATATATATATATATTTATTTCTTTATTTATTTTATATACGGAATGA
AATATGTGTTAACCATAATAACTTATATTGAATGCAGCTATAAGTTTTTAGTTCATTAAT
TTAGCTTATGTTGTATTTGCAAAACTCTTGCGCAATACCTCTAAAATCTCACGTTTATAC
CCTTAAAAGTGGGCTACATTTTGTATATAACTGCGATTGGTATTTGGTATTACCCAGCCT
GTTGTCGTAACGCTACATCTGTATGTTTCGTTAATGTTTCATCTTTTTTTAATATTCTAT
TATTTTCCTAAGTTTTCGTATTATTTAGTGCCATTTTGGAACTTTTTCTATTATCTCAAA
TTCCAAAGCATGAACGCTATACGTGAGGGAGCCTATTCCATGAGCACCAATCAAACTCAA
GCCGAAAGCAGCGCAAAAAACCCGAACGAATCCGATGGTGAACGAAAGTAAAAGCACACT
AGCTATATCAGCAATGTCTGTTGCTGTCGTTGATGTTGGAAAATCTAGGCCAGGGACTCG
TGCGGTCGTTGAACTTGGCCAAATGTGGGGACACATTGTGCCGTGGGGGGGGGATTGCGA
ACCATGAAAGCCATGAAAGTGAATTTCGCTTTCAATTGATAGCGCTCATGGAAAGCACAA
AGATTGCGGCTGCCACTTAGTTTTGAACCTCCTAAATGTTGCTTATTTTATTTGCAACTA
ACTGGTGCAAGTGAATGGCTACGGTTCTTACACAGCCACATGCACGTGCCACAAGTATTT
GGGGCATTTGTTGACATTTTGTGGCATTTATTCTGTTGAATTTATATTTTTTTTTCCGCT
CCTTTCGGTTGTCGGTTGCCAGTTGGAGATTTATGACTGACAATATTAGGTTTTTGCGTT
TGAACAAAACGCTTGGGTGACAATTTTTTGTTAATAAATGGGATTGTCTTATGACTTCTG
ATATTTGTAAAAATGTTGCAAGCAAAGCAAAGATTTTTGAGAATATTACTAAAGTAGTTG
GTAATTGGTTTCTTATATTTAAAACACAGTAAATATCAGTTACAAGTTAATCGGCTCAAA
CTATCTATGGCAATAACCTTCCTCATATCTCACAGTGGTATTGTTTGATTATTAAATTCT
AGGCTTTTCCGTTTTTAAAACTAGATTTTATTTATTTTTTTTGCAATTTGTCTAAGTTTT
GACTGGAGATTAGATAAGCGGGCCGACAGTTGCCGGCATAATAAAAGAACGTGCGATAGC
AACGCAGTTTATTCGCCCCATTTTTTAAACTGGCTCCGCTCTCCAAACTACATCAAACTA
TTCTAAACATTTATTTTTTAAGTTTTAAGTTTATTAATTTTTTTGCTAGTTCTTAATACA
TACTCTAATCAACTAATGTGGGGAAAACCCATAGGCATTTTCATTCTGTCCTCTCCGCTT
CACTTAGTACTCTCTCTCTCTCTCTCTCTCATTTCCTCCATGCCTCTCTCCGATTTTTCT
CTTATCGCACTCCCTCTCTCTATTATTTTGGTCTGGGGTTCTAGGCATTGTGGCTTTGGC
CTTGGAACTGCCGTGGCGTTCATTGACCTGCCTCAGCTCGGGTTTGTTTTTTCATTGCTG
CCCCTATCTGTAACTATGTTTTGTGTTAGTGTGTGCGTATGTGTGATTGTGGTGCGCGTG
TGTGTTTAGTTCTATTATCGCTACAGCCGATGTACGCGGCGATATGATGCCAGCCAAATG
ACCTAATAATTTTTTTTTGTTTTGCTTTATTTTTCACTCAGCTAACATTTGCGTTTGCTG
GGGGGATCACAGGGATGGTGAGGAGGGGTAGGTATGTCAAGGGCGTAAGGCGGGTCCAAT
TACTTTTTTTTTTTTGGGCACGATTCAATATGGTTTCATATGAGTTCGTTCGTAAACACT
GCGTATACTTGATGTTGTTTTTATGTATTCTACGATTCTCGAAAAATTGTTAAATAATTT
AAATTGTGTGAATATTTTTCTGAGAAATCACATTTGCTTGTCAGCTGCAGCAGATAGAAG
AACATTTGATGCTGACAGCTATGAGAGAGTGGGATATAAACTCGCATTACTCATACGCAA
CGTGGACACTACTAAGAGAGAGAGAGAGAGAGAGTGTATGTAAGCACCTCAATTCTCGCT
CTCCGGTAGCAGTTTTCTAGGGTAAATGCATTGGTCACATTGGGCCAATGTCCGGCCTTC
AAATTGGCCCGGTTCTGGCGCCCAGTTGGGGCTCCACCACAGCTTTGATGCTGCCACCGT
TGCACCTTGATCCGCTCCTGTTCGAACTGCAGTCGTTGCTGCTGTGCTCCCATTGTGCCA
GTGTACAAATGCCCCTGAATGAAAATTTGCTTAACTGTTTTCATTGCTGGCCAAGAGTGA
GCGGATGGCTTAAATGTTTTCAGCTTGCCGTGGCGAAGGCTAAGCGTGTTGGGAAATGCT
TGATTTATGAGGCGGTTGCATTGAAGATCAAAGATTAATTGAATTGGAAAAGTTTTAACA
TAATTAAATGTACTTTGGATGCTAGCGATATCTTGAGAGTTATTTAAGAACTCATTTTAA
ATTATGTCTTTACCGAGGATTTTGAATTATAATTTAGAAATATACAAACAGTCCTTGAAA
TACTCAAATAATTTTCAATTACTTATCAAATATTTATTCTACTTTCAGGTAAGTCAACTG
CGATCGATCAATCAAGCTTCTAATCCCTTCATTCCCGCCGCGTATGTAAGTTGTAACAAA
TTAACTAAGCGAAAACTAGTTCCAGCTCAACAATATCAATCGCTCGATCGAATCGAATGT
CATCAGAGGTTCTTCACCTGTCCCCAGTGTTTCTAGTGGGCCACAACCTTGCCACCGCTG
AAACTGAGTCAAATAACTCATAAAAATAAATGAGCGCGGCTGCGGAATACGGTGTCATGT
CCGATGTGTTATGTACATTGGAGCCTCAGATCCACACGATTTGCATTTTGCAATTGAATC
GAGAGAGAGACCAGCGCTACGCTCTATGCAATAAATAAATTCAACATAATTTTTCTTAAT
GTTGTGCTCTCTGCCCCTTTTGCTTTGTTCGAGCTGAGCACCGAGTTGAATGCACCAGCA
GCATTGTGAAGCAATAGCCTCGATCTAAATTTACACACAGATACACACGCACACTCAGGC
AGCGAACTGCAGCTACGGATTTTGTCATAGATATGCGAGTGTGCGTGTGTCTGTGTGTTG
AACTTGCACTCAATTTGTGTGTCGCTCACACACACACTCTCAAAAGGGGAAAAGCTTAGA
GCGAGAAGCTTTTTTGGCGATGGCGAACGGAAATGGCAGCGGAAGAGCGGGCAAGAGGTA
TACCTCTCTCTCTTTCTTACACCTAAAACTGAAGGATTAAAACAAGCAGATCCCTTAAAA
AAAAGAATTTAATACTTTATTTTAATATACAATCGAATTATTTTTATTGTTATTTTTGCT
AGACTAGGAGATTTTCTATTAACAAAACACTGTCAAATAGTGTTAAATACTGAAATTTCA
AATCTGACTTAAACCCAAATCGAACTATTTAAACGTTATGGACTTTTAAAATATTCTATA
AAAAAAAAAAATATTTTAAAACATTATTATTATACATATTTCCAAATTTAAAGGAAATCT
ATAACCTGCTTCTCATTAAAATTGCTTATTATCGATATGTGAATAACATATTATATTTAA
TAATTACATTTAATTTATTGGCAAAACGAATCAGATATATGCAATCAATGGCTAAATTCA
ATTAAAAAGTTGCAATTTTTCAATACGCCCTAATCATAATCCATAAATACTTTTAATTAT
TGCAAACCAAACTCAGCTAACAAAAGCCAACCACCCACACAAGCTGACCGTATTTTTCAA
TAGAATCTCAAAAATAGCAGACAAAAAAGTCGCACAAATACGCAGAGAGCACTTTTAGAG
GTTACTTCGAAGCGGGTCAGTTCAGTTCATTCGCCCTGTCTCACAATTAGGTGGCTAAAG
GGGATGGCGTGGGGGCTGAGCGGGGGTTTTTCGGTGGGCCAGAGAGGGGGTGCAACCTTG
CAGTGCATTTTCATAGAGCCGCTCGCTATCGCGTCGTAAGGTTGTGAGTGTAGAGCGCCA
TATTGCCAAGCCAACTGCACGTGACCTCGTTGCATGTGGCGACTGTTACCCCTCTCTTTC
CCTCCCCCACCATGTGCATATTATATATATTTTTTTTTGTTCGCCCAGCCTAGCACACAA
ATTGAAGTCGACAAACGTTCATGAACTCAATTTCGGGTTTCCTTCAAATCTGCAGTGACG
TCAAAGAGCAACTGTAAATATATTTTCTCAAGCTTTTTAGCTGAATTAATAACAGGCCTA
AAAATGTTACTGCTATTATTTTTCTGCTAATCAAACAAACATATTTATTTTCGAAAATCC
AAGTCAGTTATATGGTAAAACGAATTTCAATTTTAATTTAACGAATGTGGATGTTTAGCG
TGTGGCGCCATCTGACGGTGGTTGGCGCATACTTGTCTTCTTCAGAAAGCTCTGAGTTGC
TGAAACCGTCCACTTGGGGCGCCTACACAGATTACAGAAAGCTTTTTTAAAAGTTGGTCA
TTTAGATTTCGTAAATTAATGCAGCTTCAATAAAAATAATTTGTTCGATATAAAAATAAC
TATCGAAGGGCCAATAAATATCTCACTAAATATAAATCAATATAAAACACATACCACCAA
TTTTTGGTAAATTTGTATGATTACATAGGTGCGTTCGATTTTTTGTAAGCTACAAAAAGA
TTTGAAGATTGCCTTGAAAATAGTTTAAGTTTCCTCATAGATCTTTAGATACCTGTTGAT
CTTTACAATCTCTTTTATATATGCTAGACTTTTCTATTCAATTGCGTAGCGATCCGTCAA
AGTGATCTCAAATTCTAATTGCCTTGATCGAAGGTGATGCATAAACCCTTTACTTGGATT
GGATTTTTTCAATTTTTTTAGGGTTGGCTGGGAACTTTATGCGCATTGCAAATTCAGTTT
GGGCCCTTACACTTAAGTGATTCTCAATGCGATACGCTCCTTCCACCCTTCTCTTTTCTC
CTTCCGCCCTCTTTTCCCCCCGCCGAATATCTCTCTTTTTCGTGTGGCAGCTTTTCTCCT
TTGGCTTCTTTCAAGGTTGTTCGGACATTGACATTTTCATTATTTGGTGAGTTCTCTTTT
TATGCCAAAAAAGTTTGGTTTTCGGTTTTGCAGTGTCTTCTTCTTGTTCGTTTTTTGGTG
CGTATTCTTCTCCCTATGCTTTTTCTTATGGTTCTTTGTCTTTTTTTTATTTTTGTTAAT
GTTGCCCGCATAAAATTTTGAGTTGATCCAAAGCGGTTTGCTCAATAGTCTTTCATTTCT
CTTCTGTTTTTTTTTTTCGGAGCTTCCTACAAAATGGCGAACAACGTGCCACGAGCCACG
TAACTCCCCCAAAAGCCCCCTACCTGGTTTCTAGGGCAATATTTCGTTGGTTACCTCTAT
CCATGCAGGGTATTTTAGCATTTTGAACACGTTCGCCCCTTAGCCCTTGACTTTGAAATC
GAGTTGGGTTGGGTTCTGCTTGGGTTTTGCGTTTAGAGATTATGTTCTCGGTTTCGCGCT
AGGTAGATAATTCGTAGATATTTGGGGCCGACTTCCTCCTTCTTTTGTGCTGAAGTTCAA
GTTCGTTCTACGCATTTTAAATGCTGCCTGCGTTCGCGCTGTGTATAATCGTTTAAATTC
TGTGATTTTTTTTTCGTTTGCGCCCCTGAGGCAATTGTAATTGACACTTGAATATGCCAA
ACGCACAGCTGAGCGTGAAAGAGGGGTGTGGGGCCGCTTTTGGCCGCTTGGCAACTGAGC
CATGACATGGCCAAAACTAAGCACCAAGCAAAAGTTACTTGAACTCGCCTAATTACGCGA
ATTACGATTGTCTAACTTCGACCGAACCGAGCCTCAAAAGTGACTCTGCGAAAATTCTCA
TAATTTTTAATAGGCTTTTGCCAGTTGGAACCTTTTAACTCCAAAGCGTTTGGCGAAATG
ACATCACCAGTCATCAGTTCAGACCCTCCTAATCGTATTAATCATGGCAAAGCACACGCA
CTCGCATAATTAGCAATAAAACATCTAACAACTATCATTAGAACTGAAAGCCTAACAAAT
TCTAAAACAAGATCCGCCAGCATTTTGCACAAATTTTGAAAGGAACTTTAATTGAGGCAC
ATATGGATTTTACTCCAGCCCACACTTCTTTTAGAACTCGTACACTCTATGAATAATTAT
CACACTTTTTAGTATGATAATCGCCAAACAGCTCAAAACGAATCCCAAAAAAATAACCAC
GAAATGCACTTGAAAACATACTTTCCCAACTTACTTTCCTCAAAAACCAAAACAAACAAT
CCCAGTGAAATGCCGATGCCCATTAACCTATTTCACTTGCCCAAGACGCTGTCCAAATAA
AGAAAGCAGGCCATGGCCACGTTACATAACTGAATGAAAGACGAAGAAAGTAGCAAAGAG
AAAGAACGAAATAGCATAACCGAAGATAGCAACAGCTGGAGAAAAAAAAAAAAAGAAAAG
AGGATGTGAGCTCTTACTGCGATCTCAACTTTTGATTTCAGCATCACCTTAGAAGAACAC
ATAGTGTACTCGGTTCGGTATTTATATAGTTTTCAAGTGTTACTTCTTATTTTCTGGAGA
ACAGAGATGCTATCAGTAATGGATTGAAGTAACCGAAACTGAAAAAAGAAAAAGTCGATG
AACAACTTTCCGTTTTTTTGTGCCAGTAAACATTATAATATACATAGCAATAATTCAAAT
TGAAATTGGAAAAGAATGCGAAAGAGATCGTGATAGGAAACGATTCCAGCCAACATTTAA
ATCTGACCTTCCCAGCGAGTTTTGACCCTTGTCGTTGCCAAATTATTATTTGGCCTTTGC
CTCTACTCTTCGATCATCGACAGAAGTTTTGTTTGAACAAGTTTCCAGCAGATTATTTCG
TTAATTAACGAGTGTCGAAACTGGTTCTCCGCGCGCATAAGATCATCGGAGATAATTTCG
GGCCTCAAACAAATCAAGTTGATATCGTTTTAACACCCGCACAAGTTTCAAATCGTTTCA
AACTATTTCCTATGCTCAAGTGATCGCAATACCCTTGCAGAGGCCTATCAGCTTGGGTGC
AAAGCTTGTGAAGGATACACAGGACACAAAAAGGATAGATGTAGTCCACTAATATATTAG
AAATAATTTAATGTTAAATACACTCCATATTATTTATTTTAATAAGAAGAATAAATAATT
TATTAGTTATATTTATTCGAGAAATATCTAATGCTACAATTTCTATTACACAACTTTTAT
GAAAGGGTGATGATGTTTCGTATGTAGATCATTCCACAAATATGTATCTTTTTTGGGATG
TGGAGCTTGGGTTTCTTACCTTCCTTTCCATTTGATCCCCGTCTTGGACTCTCCGTCTCC
TTTCCTCTCTGTCTTCCTTTCCATTTCCATCTCGCTTCCTCAGAGCAGCTCATTCGAAAA
TCGTTCTAGTTTCATTAAACCGCAAAGAGAGCGATCGAGAGCGCTATTTGAGTGTGTTAG
TGAGGAGGAGAGAGATAATTTGGCGATTGTATTAGTGTTCGGGTGCTGCCCGCACTTCGT
GTTTTTCGATTCGTTTCATTTTATTTTATTTTATTTCGTTTCCCATTGTGCGTGTGCGTA
GCAAGTTTACTGACCTTGAACTTCGAAATAATTTTCTGTGTATGTACACCGAAAATGAGA
CCATCACGCATACATACATATGTACAAAAAAAAATACCCGCACACGCATTTTAAAATAGA
GAGCTACATAAATGTTATTTGGGCTGCCCGAAACAATTGTTGTACTCGCACTTGGAGGCA
GAACTTTGTCCGTCTAAATATTTTCATTGTTTTCTCTAGTGGAGTGAACTCGGCAAACGC
ACAAACGCAATTTGTATCTGAGTGGCTAAAAATAAGGAATTGTATCTCATGGACACACGA
TTAGCTATTTGCCCCCGCAGCGCCATCTGTCGGAGTCCATTCGACTTAACCTTCGATGCT
GGCGATTTGTCCTCCTGTCGGAAACGTGTTTATTTGGGGCACAAACACTTTTGACAAGAT
ATCCATTTAACTATTTCTAATAATTTAAAATATAAGGGGCTTTCGTTTAATCATACAAAA
CATATAATTCACGAAACAATCTTATAAATTTGCCAAATCTTATATGCATATAAACATTTT
TATTATTGAAGTAAACGCTAAATTAATTTTCAACTGAGCTATTATTAATCTCAATTTCAA
CAGTATAGTAAGCTATTTACGATTTACCCACCCATGGGCCCAAATACGCGATATTAACCC
CTATGCAAACGATTATGTTTATCTATTTCGTTCACGTGTATTTCAATGATAAGATAAGTT
TAGTTATATTTTACCTGTTCTACATATGTATATGTACTATATACGAACATATACATACAT
ATATGGAGCTGGGCTCGCTGAACTCTAGCAAGGGCTTTTTGCGCACTTGGCAATATTATT
TTGCCCCTGGTGCGGTCATACGCCTATACCGAATCAGAAGCAACAAACATGTATGTACAT
ATCTATGTACATATACATACATATGTACATCGCAACATACAAAAAACGCGGAAATGATCT
AAAATCGGGAGTGGGGGTTAAACCTTGGAATAAGTTTGATAAGAGCGTGTTTTTGATTAC
CCTTCCATTGTAGCATTCGACATTTGTTAACTAATTTGGCTCATCATATATTCTCGATTC
TTTCCATTCCAGGTGAGTGATACGAACCCCGAAACTAAGTGCTAACCTTTAGTGGTAAAT
CGAGGAACTCATTTGGTATGCCAACGAATCCGAGGAGTGGTCGGTGGAATCATTAATTTC
TTATGCCACAGGTGCCTGTGGGCCAGGTACCGTTCTATTCTGATTGGGAAGTTTCTGGGA
TCTGTGCGAGCCTGTTTTCTAAGTGCGCTAGGTTATGGTTGCCCAGTTCTGGGTCTTGAG
GCAGGTAGAAGACAGTAGGCGTGTATCCCTCAAAAGGTTCTTTGTGGGCTCGGTTGATGA
ATGAACTGTCAGTCGATAGCATTGCCGTAATTTAACCGGCTTTATACGTTTATATTTTTA
TTGGTACCTGTTGTATGATTGTATGATCCTATTGCTGCAAGACATTATACATTGCATTCG
GTTTGAAATAGAGTTGGAGCAGTCTTTCCTTTTCATCTACTTCGAGAATTAGAAGTATGA
AGTACAAATTAAATTATTATAGATATAAGCATAATTTGACAAGCACTCAATTCGCCAGCA
TGACTCTTTGCCTATATAGAGATCTACAACACTTAAATATTCCCTGGAAAGTAAAATAAT
AAAATGGAAAAATCAAAGAAGAAAATGACGAACATTTTGGCGTTGGTGAAAATGCAAAGC
GCAAAAGAAAACAGCTAGAATCGACCAGAAAAAGAAAACCGAAGAAAAACAACCATTATG
AAGGGAAAAGGTAGAAATTATATGACCGAATGACTCGCAATTGGACTCGGGACTCGGACT
TGCTGGCGGTCGATGCCACGAATCTAGGTTATTACGCCGAAAATAATTAAAAATACAATA
AACCCCGAGCAGAGAAAAAAAAGAAAGAAAAGGGGCCGAAAGAGACTCCCTGAAATTTCG
TAAATCATGCAAAATTGTTACAAAAGACGTTCTTCCCCTTGCTTGGCTTCCCGCGACTTT
TGGGCCGCCACTCTTCTCTTTGACTGCTTCGTTTCTTTGTCTTGGCCAAATTATTCATAC
CTCTTACACGTGTTTCAAGTTCATTGCCAAATTTCGGCACGACCACAGCCGTCCAGAAAG
AGACGGCCACAATGTGAAGTATAGAGAGGGATGTATAGCACTTGGTACAGACTTTTCTGT
TGGGCGGTTTCTTTTCTGCCCGGTTTTCGCTTTTCTGGTTTGGCTTATGATTCCGTCGAG
CTGAGTTGGCCAAAAGCATTTTCTGCTCCCTGGGACTGAGTGACTGACTGACCGACCGAG
CTAGCAAACTGCTGATCTGGCAAGAAGATATCCATATTTGTCTTTTAACATCAGTTGGCT
TATGTAGATTTGGAAGTCTAAGAAGTGATCGCAACTCCAAGCTAAAAGCGATTGGGTTAG
GCAATGATATTTGTAAGTCGAATATTTAGAGATACGAGAAGCAAGTTCAAATTCACAAAT
TTTATAAAAGTGGAAGTCTCTTCTATCTATTCTAATATTTCGAAGTTTGTTAAGCTTAGT
GCGCAAGGCGGTCTTTAAAATAGAAAACAATATTTTTTAAATAATACAGATGTGTTAAAT
ATAAATGTAAATATAGATAAGGATTTATAGATGTATATGTCATTAAAAATTGATTTCGAA
TATCTCCCACACTTTCCACCAAAGCCTGGCCATTTCCTTTCTCCTTCCTAACTTTTTGAA
TTGCCTGCGGCGATCTCCATTTTCCATATTTGACTACTTAAAGGCTTGTCTGACTGTAAA
AACACACAGAATCCCACGCCACGAGTGACGCATTTTATTCACCCTCCCCCCCCCCTCCAT
CGCACACTTTTTTGTTGTTGGTTTGTTTGTTTGATTGTCCCACCAACGTCATCGCCACTG
CCCACTGAATCCGGCATTCACTTTGGCCGCCTCCACTTGGCAAAGCCACTCGATCTGCAG
CCTCGTTGCGATCATTGCACTTTGCGTCTGCGGTCGTCGTGTTGCAAATTGTGTGTTGAC
TGCGAAAGAACCAGTTTCTCTGCAGCTCCGAACTCGCCAAACTGGAAACGATCGCTTCGC
GGACTTCGTGTTGCAAGTTGCAGAGCAGCGGATCGGCATCGTCTGTCTTTCTCCGGTCGG
TCAATGGTTCTCTGGTTCATTGCCATTGCGCTGGGGGTAACTAACCCAGCAAACGAGGCA
TACCACACCATACCAAACCACACTACACCGTTTGCGAGTACCATACAACAATATCGTTGA
AAAAAAAAAAAAAAAAAAAAAACGCGACGACAACAAGTTTTGCAGCGTCATTTTGCCAAC
AACGTTGTAGTTGTCGTTGTCGTTGTCGCTGCTCGGCTGGCATGTTGTTAACTGAAGCAA
GGACGTTGTCTTTGGTGAAAATGCATGGGTGTTTGTGGAAATGTATGGCTCTTGAAGATC
TTCGTATGCCGTACTGTAGTAGTATGCCGCTGGGCCGGCCATTCACTCGCACAATCGCCC
ATGTGCGAAAAGAAAATCAAATAAAATGAGATGACTAAACGATAGATAAATACTCTGCTG
CGGCTCAACTTTGCTGTTGGAGTTGTTCGAGTTGTTGTTATAGCCTAGCCTCTTGGTTCG
TTGACTTACAAATGGCTGTACGTCCCATCGAGTTGTTGTTGTTGCTGTTGTTGTTGTGGC
ATGTGAGCTGTTGATTGCAGTTAGCTGTTTGTGTTTTTGTTCGGCGTAGAGAAAACACAG
TTTGAGCCTCAAGGGAAATTTGGAAAATTGGAAAAGCGAAGAGGAAAATCAAAATTGGAT
TTAGTTTTTAATTTAGATGTTTATTATTTTCTATATGCTAATATCATGGATACAAGGATG
TGAATGTTGCATTAAATAGAAAAATTCTTACTAACAAATTAAACGTTTGATATGGTTTGA
TTTTTTGTAAGGAAAATCTTTTCATTTCAATTGTTTATATAATCCTTTTCATGCATATTG
CAATTTAATTTAAAAATACACGTACTCATCTCCGATGCCACTTTCAGTTAAAACTGAACT
GCAACAATGTCAACAACCTGACTTCCCATTGTGACTCAGTCGAGATCGAGATCGGTTCGT
GAACTTCTCCAGACATTAACTGTGTCGATCGATTCATTTTGTTCCCTTATTTTGTCACTG
AATTCTCCACACATTTCATAAGATTATTTCCAGTAATCGAAATGCGAATTCAATTCAATC
GACGTGTGGCAGGGATATTAATCAGAGCGAAATATCCCCCACAATCGTAATAATTATCGC
ATTGGCTTACATTCGTTCTCGTTGCGAAGAATTGTGGCCCGTCACGATTGTATTGTACAA
TCAGCGATATGTCATTACCCACTACTATATGTCTGAATTTGGATCGGCATTCGTCAGCAG
TTCCAGCCGCCAACTGCCGAATGAAATTCCATGAGTTACCCAAGAGGCAATTGACCCGGG
CCGGGAAAAATATACAATCACAATCCTGATGACATTCACCCCGTTTACGAATCCGCAACA
TGTGCAAAGCAGACGAAAGGAGAGCAGTGCTAAAAAGCAAACAACAACAAATGCGGAGTG
CAACGCGAAAACAAACAGAGAAAGTGCATAGGCGGCGATTTTTGGAGGGGTTTGCATCCC
GAAAACAATTATTTTGATTACAGCTGATGAACTTCCCCAGAAAAATGAACTCTCAAATTA
TACAAGTATTATAGATAAAAACACTTTTAGAAACCCCTTTTTCAAACGACTGACAGAAAA
GATTGCATATTCGCGACTCTTACGGTTTATCTGGTGTATTCGTCACTTTTTCTGCGGTGA
CGTTTTGCAACACAAATTTTGTCGGTTACTTAAACGCTTTCCGTGTTGTTCTGAATGCAA
AAAGCGAGCAGTATAGAGATACAGAATGAGAGTCCGAAAAAAGAAACAAACGATTCTTTT
GAACTTGTTGCGTTGCCTTTGGAGATCATTGTTATTGCTTTTTTTTTCTGGCGTTGATGA
TAATGATATATAAAGCATATAAAGGAAGTAATATTTTGGGAGTTAGCTTGGGCTTTTTGT
TTGTTTGTTACTCCTGGCCTCGTTTGTTCTTAAAGAAGGTTCTTTTTCTGGGGAGGGGCA
CACACGCGTATTTAATTGGGTTGCCAAAAGCGGTGCCACGGCGATAAGATCGAAATTGCA
TCCGCTTATATATTTTATCCAGAAACTGCAGCTGTCCATCTAAAGCTTAAACCTCTCAGA
CTATGTACATTAATTTGAAAGTATTAAAAATTTAAGATTAAGAAAGTGTTTCTTTATTAT
TTTAAAATCAAGATTTCATTTAATAGCTTATGGCTTTAAGGTGTATTTATATGATACTAG
GACTACTTTTACATGTTAGTTGAACACCTCGCTGTTCTAGCTATATTAACTCCCCACTTT
GAATTGAACATTCTGACATAATTTGCACGTAAACTATAATCTTAATTGGCCACCTAAGGC
TAAAATTTCCTTCTAAATATTTTTTGCGCAGTTTTTGAAGCTTCTCTCTAGCTAAATACC
GTTAATAGACAATTTCTTTTCGTACTTCCCTTTTCTGGCCAAATTTTGTTTACGAAAAAA
TCGAGTGTGGAACGAAAACATAGTCAACATTCAGAAGAATCAACAGGCATAGTTATTCCA
AAACGCCGAAGACAGCGGCCGTCAAAACAACAATAAAAGAATAGACCATTACATAAGCCC
CATTCCCAAACTATTTCCAAAAAAAAAAAAAAGTAGAAAGTCATTAAGTAAGCAAAGTGC
CGCGAAAAGAGAAACAGAAACCGGAAAAAAGAAAGAACGAAAAAAATCAAAAGTTGTAAA
CAAATATGAGCGTAAAGGAAAACGAAAATCGGGACGGGAGGTGATGTAAAAGGGGTACTG
CACCCCGCCCATCTTCCCGGCCCCCTGTCTTCTGAATTCTTCTGGATTCTTCTGGCCGAC
AGTGAACTTGTCCCAAATAAACAAAATTCCAAACGGTCAAAAACTCGGTTGGGCAACCAT
GTTTGCTTCTCTCTCTCTACCCACCTTTCTTCCCCTTTCCACCTCTTACCGCACTGTATC
AGCCTTTCTCCGCTCCCCCGTATTCGTATTGCGTAGTTCTCATTTCTTTGTTATTCACAT
TGTTTTCTACGCCAAAAAGGTGTCGATGTCAATGGGAATGGCTTAAAAGTGAGGAGGGGT
AGTGGGGGGTACTTTTGGGGGTCTTTGGAGACCAAGTTTATGCTATTGTCATATGATTTT
TCCAAGAATCTCGTAGTTCAGAAAGTTCTTTGACCAGATTGAGTCACTTGACCAGAGAAG
GCTCATAATGTGAAGTACCCAATAAAATGTAACCCGCATTAAGTGATCGTGAAAATGTTG
GAAAAGGGGACAGACAAACTTCATAGTTCAAATTCTTCTAAAGATTCTCATAAATGTTAC
AATTTACACACATATAGTAAATGTTTATTCTAGATATCTTAACAAAAGGGGCAATCCTAT
GATCTATAATACTTCTATATTGATTTTAAGAAGCAACCATTACTATAGAATATAACCAGG
CTTTTAGTACCCAGACCAATTTGAAAAATCTACAATCCTTGCTCGATATTTTATCCATTT
TGTTGTACATTTGATTTAACCCAACTTGTACCTAAAATATGTAAAGTTCCCTGTTTATCT
GGGTGTGCAGATCTCGCTTTCCTTTCTCGACAACTACCTACATGGAATTCCGCCCATTTC
CTCTCCCTTTTGAGATACCACCCGGCTCTACTCTTTCCATCTGCCCACAAGTCAGTCAAC
CCATCAATTCCTTTCCAGCGTTAGCCGACTTTCACTGCCACCCACGGCATTTGAATGACC
TCCAAAAGAGGAAAAACGCAAGAGAGTGCCGTAGATTTTCCTGCGCCCCCACGAATTTCC
AGTCAATGCACTCGGTCCATAAAGTTAATAAACTATAAATTACTATCAAAAAACCATCGA
AGAAAATGCCGAAAAAAACTTTCACAAAAAATGCAGCTGAGCCAATTTTGCGCCGATGTT
CGTGCAACACGTGGAAAATGCACTTCTCCCCCTTTTCCCAATAGTTTCAACTTCGACTCC
GAGCAATATTTTCACTTTGTTTGGGTTGCTGTGGGTTAAAGTCCTGCCATCGAGGTGTCA
GTCAACTTTCGTGGCAGTCGTTGCATGCTGCATGCTGCTAGTTGCTAGTCGCCCGTTGCA
AGTTGCCAGTTCCCAGTTCCAATTTGCTGCTGTGTATCACTAGCATAGTTGCCCACCAAA
CTCACTCGAATGCTCCAATGAGTTTTAGTACACTGAAAACATAACAAAACGCATTTAGAC
TTTTAGTTTAACAAGTGCATAGACCACCATAGTTGAAATGTGAAATAAATTCGTATGCAC
TAACTATAAACTTTTCATGGGCTAGGCAATATCTATTGCTTAAATAGATCAAATATATTT
TTGCACAGTGTAGGGCAGAACGAGCGGGGGTATGTTATATCGAAGTGACAGAGGAAGGGA
GTGCAGCGACCTGCGATCGTCGACCGAGTCAACAACACTCACCGCATACTGAATCATGGA
TGGGAATTGCCAAAGGGGGTGCAGGTGGGGCGATCGTGGACGGGGGTTTCTCTTTGACTT
GGCAACGTCATCAGCTGACGTCTACCCCCTCTAGTGCCCCCTTCTTTCAACAAATTGCAG
TTGCATACCAGTTTTTTCGCGCTATTTTGCATGCGATCGCTGGATGAAAAGGGGAAACCG
ACTCGTGGTAAACGGGGCAGGGAGGGCCCCATGTGGTAGAAAGCGCCAATGCACTGCCGA
CTGCCATGCCATAGTATAACGAACTCTCTGAACAATCTCGACACTGGTCGTCGGGGTGTT
TGACTTCTGTGCCTGGCACCGTCGCACCACCGATCGAAAGTCCAGGGGAACATGGGCCAT
CGGGGAATGCGACCTGGGCACTAAGCAGGTAATTGGGGGAAGATCATCCGTTCATGCGAA
CAGTTGGTGGATAGAAGATATCTCAGGGCAACATCATGAACGGTTTAAGTGTTCATATAT
TGCTGTGTTTATTAAAGTGATCGCCTAGAATTTGTAATTCGAACATATAAACATATATGT
ACATTTAAGTTGGTTTTACCAGATTAACAACACATTAACTTGTGTATAATTATTAATACT
TTTCCAGATTTATTTTAAAATTTTTCTAATGACCCTCAACCCACCCATCTAATTTCGCGT
TCCGGCTGAAGCATCAAGGTTTCTAGAGCATTCTTCTGGCCAAGCAAAATATGCGCTCAG
TTGGCATTTTTCGCACTGGTGATCTAAACCCACTGCCTCACTAATCGCCTGATGATCAAC
TTGTCACCCTTCTCCTTTAGCGCGATCAGCGAACCCCCTGAACTGCCATGACTGCGTGTG
ATAATCGTCAGATTTCCAACTACTCGACCTCAGAAGCCCCAAGGGTCTCTCGACCTCTCG
ACTCTTCCTGCTTGGCTATAATCTAATCAGAAACCAGAAGCGCTAGGCGATCGATTTGCC
ACCTGATTCAATCCACGGCTCCACGGCAATATCTTTCTATGACCGCCAGATAGTACATTA
AACTCCACTTCCTTGTGTTTGCGAGGGAAGGGGGCACTGGCGCTCATCGCTTCGCATTCA
TAAATTATCAGTCAGCAGGCGCAGAAAAAAACGAAACGAAAAAATTATGCTAAACACGTT
TGAGGTGGCGTACATATGTGCTTGTGCTCAAACAGGTTTCAAATTCCCCGACGAACCACA
GACCAATTTCGGGTCTTATGCGTACTCTCTTCCAGGCCCCAGTTTCTTTTTATATATTCT
TTTTGTCTCACTAATTATTATGCTGTGGCCAAAAAGACAGCCGAAAGGGTTGCGAATTTT
CGAAAGAAACGAGAAGTGAGAAGACGCGGCGGCGAAGAACGCACAATTCTACAGAAGACA
AGACTTCGGTTAATGGAGGTCATTCACTTTCGCACGAATTGTTTCTCCACTGGAGTCAAG
TCCAAGTCCAAGTTTCATCTTACCCGCCATATATATCGCATAATCTTATTACGTTCCCAA
ATATACATCGGTTTATATACAATACATTCTGTGCCTGACTTTTGATTTTCGTTGTTCTCG
GGTTTGTTTTCTTTTCGCTTTTTTTGTTTTTTGTTTATATGTTATTTTTATGGCTTTTCT
GCACTTATTACCGACTGAGATATCAATCGGTGTGTGCTGTTTTTATGCCATGGTCTGCGG
CAGCTGCCAGCCTATTGACCAAAAAAGTGGTTTGATCAAATAATGTGGTTTGATCGGTTT
CCTTTCGGCTCGTTGGCTCCCCACGATTCGATTTGGTCAAGTGGCGAAGGCTTAGCGCCC
AAAGAAAAGAGAATCGTAACAGAGAAAGGGGAGAGAGCAATAGGGTTCCTAAGTCGAGAT
CTTTCTTTCTGGGTTCTAAAGTTACCATTAAGAACTGGTAAATAAATGTACTACATAAAA
CTTCTATCAAATGCATTAAACACTAATTAGTGTTGCACTTAATTCTATGAATTAAATTAT
TTTCTTTCTTTACTTCTCCCGGCCTATCCTAGACTATTTTCATTCCTTTAGACAAAATAT
TAACTGCTTAGCTGTTCTGCCACCTTATTTAGTTCCCGTCATTCATAAATCAACGCTAAA
TTCATATTCTTCGCCATAATTTATCCCTCCGATGAGCCATTAGGCATCTGTGTGTCTCTG
TTATTAAGTGTCCAAGTATCTATTCCAATTAACTACCGTTCGAATCTATTTATCTATCGA
ATGCAAAGCCATAATTCAAGGCCCGTTCAAGAGCTTATTATACAAACCCGACCAAGTGCA
AATTGCCAATTAAACATGAGTACTGGAAAATGCCAATATATGGAGAGATCGAGATTGATG
GGTAAAAAGAAAGATAGCCCGGGTTAAGGTTTTGTGTCTCTGGCGTAATCCTAGAAAGCA
CGTGCGGCAATTACCAATTTTCGCAAACACATGGCCAAAAGTGCATTCAACTTGGCCAAC
TGCGCGCATGCGTGGCTCGCGTTAGAGTGAGAGGCCACGAGACAAGTCAATAAACTGCAC
AGCTTATCAGACAAACTAAGCACGATCGGAGGAGGGGAGTGGGGCAGAACTAAAACTGCA
GCTGCGGGGTGCGAATTCGGTGTTGTTAGCCTGGCTATTTTCCCACCAAAACAGGGCTTG
AAGCTTGATAAAAGGCGCTTTGATGGTTAGCAAGATAAGCTAAATTTATCTTAAAATTGT
AAGCACGGTAGTCGAGAGATCCTAAGATATAGTAACGAACTAATTGTTAAAAACATTTAA
AAATATACTTCGATATATGAATATTAAAAGTTACAAATTCTTGTAAATAAATTGGTAACG
TTAAAATAATTATTATAATAAATGTGTTGGACTCTTGATATCATTATCTAAGAGCCGTAA
ACTCAAAGAATATTAAAGATAACCATGTGCCATTAAAATCTTTAATATATAATTGTTAAA
TATTTATACTATTCGAAAGTGCAACTCTATAGTTTGGCATGACTGGAGTGCGAGTAGCCC
TCAATTACAGTTACAAAACTGTAAGCAGTCGTAAAACCATTCCCCCACCCCACCCCGCTG
CAGTTGGGTGTGTGCGTGCGTATCTGTGTGTAGAGTCAATGCACGCAACTAGGCATAGAT
ACGAATGCGAATCCGAAAGCCACGGCGACCAGAGAAGAATGTGCAAGAAAAAATTGCACA
CAAGACGAACGGTCGGAAAAGAGATAGGGGACAGGAGAGCGAGACGGTCGGAGGGAAGAG
TGCATTGCACTGCCCGAAGGGTTAAAGACCCTCAATGAGCGATCCGCTGCGAGTGGAAAA
ATCCGAGGATCCACACACACACACCAGCGAAAATCTGTGCAGCGGGAAAGCAAAAGTGCA
GCCTCCCCATGGCAAGACATTCAAAGAGGAAAAAAGAAAAACAATACCAAACCGAAACGA
ACCTACATCAACATCGCTGGAAAGTGGATGGCATGGGTGGGGGCGCGGGGCAGGGGATCG
TAGCAATCTCAGCCTCAGTGCAGTGGCTTTGAACTTCACACAGATTCAGCTCTCTCTTTC
GCTCGGCGCACGCTCTATCTCTTTCCATGGCTCTCTTTTTCTACGCCAATGCCTGCTATA
CCCTATACATATGGAGTAATATTGTTTTTCCTTCTGGCTTGTACCATTTTAAGTAGAACA
TTTATGTTTTGCTACTTAAGCGAAAAATATGTAGTTTTTAAATTAAATTGTGCTGTTTAA
AAGTTAAATACAAATTTCGAAATAAATGCAAGCTATTTTGATCCAAATCTCACATATAAC
CAACACAGGATATAAATAAACTTTTATTCCCCTTAAGAATGCAAAATGTTACCATAATAT
TAACAAGCTGATGTTAAATATACATTCAATATTCAGTCAATTTGTAATAACATCTTAGAG
GGTAATTCAAATGTCCATCCTTGTGGTGCAATTTTCCTGTCATGATGTTCGGTCTATGTA
ACAATCGATGTGGCCTGCTTTATGTGTGTGTGTATGTGTATTTGGTTTTATATTTTTTTC
AATGTCGAGTTCACTTTTTAAGCGGGGCATGAGCGTTGCTATTGGGATAGATCATTGAAC
GTTCAATGCGCCTTGATTGAAGCGAGTCCGTGGTTTGAGTTTGAGTTGAGTGATCATCGC
ATCGCGTCGGATCGGATCGCTCAAGTGGAGGCGTCTGCTCCAAGGCACTTTTGATTAATT
CCCACTGCACCCCGCCCAGCACCGATAAGGCAATGCGTTTCCTGCCCTTGCATGTCAGCA
GATAATAACAATGGGAAGTGGAAAATGGGAAAAGCTGGTGCCCGGGAGAGGCGGCAATAG
AAAAACCACCGAAAAGAACCGACTCGAATCGCTCACGAAGCAGATAAACCAAACAACAAG
AAGCAACAGAAGACGAGGTCCAGAAACGAGTTCAAGTACAATCCCAGAACCAGAAAAGAA
CCGAGAGGGAGTGAAAAACGTATACAGGATTTAATGGGGAAATGGAAAATGCTGTGGAGC
ATCAAGCCGTGGAGCATTTTCTGGAAATTTCCTTGACGCGGCAAACAGGAAACCCACTGA
TCAGGCTAAATGGAAAATTCGAGTTAGTGCTGGTTAATGTGTATTAAAAACACACGTTTT
AATTTCATTTATTTTAAATTTAAAGAAGATTTAAAGAAATGGTTAAAGATTGTTTAAAGA
ATTGTATAAATTACAACATTTGACCTCTCGACCTTCTCCTTAGCCTTTGTGAACTTTTCA
TAGTCCATGGAAATTTTTGCAAGTCTAAACACATATCGGTTCTTTGATAATTTTTGGCAC
TTGGCTCTAATTGTTTATGCAGCAAACAAAAACTAATAACTATTTATGGGCTCGTGCAAA
CAAGAGGAAGTGGTGGCGAAATGGAGGAAAGCAGTTCAACAAACTGAGACCAGGCCATGG
TCAAGATGTGGCTGTATTATTTAGAATTTTTGCAGTTCCTAACAGGCGATAAAAACAACA
CCACAAACGCATGAGCAAAAATTCTGACGACCTTGGCTAATAAAAAGCGTGGGCAGGGAA
AGCTTTGCATAGATTATGTAACTGTACCCGAACTATCAGTTGTCGTGGACCTTGAAAACC
CTTATCGAATCTTAACCTTTTGCAAAAACTACGAAAATACAGCGAGTCCGGAATAAATAG
AAATCAACTGCTGATAAGCACACCTGTACACCCGCTACCCCTTTTCCGCCCACACACTGT
GACTTGTTCTATTAGCTATTTTTATCAGAAACAAGAGGACCAACAAATATGGGAATGAGA
GAAAAAGCATTTTTAATATGGAATATACATACCCTTATATTGTTATTAAAAAGAATAAGT
ATTTCCATATTCTTTTACATAAGTAAGTTCGAAATCAATTTAAAAACTTCTAAGAATTAT
GATTTTTGTAAAAATCGAAGTAGGATTGGCCTCGTACATATATACATACATATAAGCTAA
ATATTAAATATTAAAAATAAATAAACATTCTTCTTAATTTAGAAAACAATCATATATAAC
ATGGTACCCTCATTAAAAAGGGTATTCGAAAAAGTGACGCGGAGGAACAAAGCGCTCAGA
GGGAGACGGAGATAGACAGTGGAAAAGAGACGGGCATATAGGAACAAAGATAAGAGAACT
CTGGGCCGAGGAATTTGTGCTGCTGACCTTCATTTCGGTTTCGACGCTGATAACAAAGAC
TCACCGATAAGAGACTAACTGTCACTGCTTTCCCATTAGTGTGTGTGTGTGAGGGTTTAT
TATTATTATTATTATTATTTAAGTTTGCTGGCTGGTTACGTCGATAAGGCGCATGTGGTT
CCACTGTACGCGTAGTTCTCACACACACGCCCGATTAGTGGCCATTATGACATAGGCTTT
GCCCCAAAACTATTATGTCTTACGGCTTTTATCAGTTTTACACGTGGGTGATGAACTTCA
GGGGGTAGTACTGTACTTACAGGTGTTATTGGGACTTACCTGGTAATCGAAGGCATTTCC
AGACGGGAAACTGTCTGAGAAAGCGAAAGAATAGTGAAATATTACGTGAACTGTGCGATT
AGATTTTGTATTATTGCACGATATTTGTGAAGAACCTTGATAGGAATGTATAAACTGAAC
CAACAAGTGCATATCTAGACATATAAACTACTTAAATTGTATAAGTTTAAATGACAAATC
TAATTTGAATTATTCAGATACTCTTGCCAAGGTGTGTAGAGTTCACATCATTTATCAAAT
CTGATATTTTTGCCAGCCTAATTTTATCGCCGATTTTAATAGCGATAGGGTCCCTTGTCT
TCACTGGGGGCAACCTTCAGAATACATATCATGCATATGTACATTCGGATCGTTCTTGTA
CCCATCGCCCCTTCGCCATGACATCATGAACCAGCCCAAAAATTATGCGTAATCAACGAC
ACAATCCTACCAGAACAACCAAAAGTGCCGGAAAAAAGAAGGCACGCAAAAAAATTAAAT
TGCTCGAGTACGAAAAATCACTATAAAAAAAATTCGGCACAGCTAAAACGAGAAAAAAAA
ACAAAGAAAAAACAACACAGGCGGAATACACACATTTTCAATGCGTAAGCCGCAAAATGG
TTGGCCTTCAAATTGACCGAGTTCATGAACGCGGACGGGCGGACGGATAGACCGGCGGGC
TCACGCACCTTCTCATTGTGCGTTAATTATATAGATACAGATACTCAAACACATAGATAA
ACCAAAGAGCGATAGACGAACAGACAGACAGAATGGGGAGTTACGCAATGTGAAACTGGT
TTCGGAGTTCTAAAATCTACTTGCCCAAATTGTTAACAACTAATACGGGGAAGTTTCTTT
TTATTTATTTTATTTTATTTTTTTTTTTTCTTATCGTATTTACCTTACCCCTGCGATGGC
AAGCTTGATTTTTTTTTTTGGCAAATTAAATCCAGCGACAAAATGCACAAGGAAAAATTT
ATAAAAGAGTCGTTCAACTTGATCAGTGGAGTAGCACGGAAGCCTTCAACCGCTCGCCAA
CCGATTAACAGTTGTCAATGATTATACCACAATAAAATAAGTAAAATAATATAAATTTGA
TGCCACACACTGATCCATTTCTCTGGCATGTGCGTGCGGCCCTCATTCTCAATTTATCGG
TCAATTGTACGCCGTACGCCGTTCGCCGGAGAGTTGAAGGCGAGTTTTGCGTCAGGGACA
CTTCTTTATCGTAGTACTTTGATCCAGCTGTCGTGACTAAGTGACTAAGTAACAGCCAGC
CAGGCCTCATATACCATACTGATAAACGGACTGAAATTCGCAACATAAAACGGGAGAGCG
ACGAGATACAACTTGGGCTTGGGATGGGGGGATGTGGATGGTTCGGATGAGTTGGGATGG
GTGGGGGGAGAAAGCCAATGACATTTCCAAGGAGTTCACTCGCCTCATGATCGCGAACAG
TGATCGCGGGCCAGATCATGACATGGCGAAACTCATTGGGAATTGGCAGAAAAAATGTAA
TCATTAGAAACGTGGTCAGGTCTGAATGATGTATCATTTAAAAACCCCAGTACATGCATA
GATAGATTAAAAGATGGAATTTTCCAACACACATAAACTATGACTATTCATTCAAGACTC
TTTAAACCGTCATGTGTAAATGATAGAGGGCCTGTCCCTTTTGCTATTAGACGAAAATGT
AAATTCAGTCAGCCGGGCATTCCCATGATACTGATAAGGAAATACATACATACAACGCAG
ACATATGTACTTCAGAGTCCCTTGAAGACTAATAAAAGCGAATACCATCTCCCAAATATT
GATAATAATACATTTTTTATTTTTTGGAGAGTTCACCCTCATTGAACTTGACCCCCACTT
GAACCCCTGGATGGGGATCTGATCTCCTCGGAGGTTCCACTTTCGTTTTGTCTGCTCGTT
TATACGTATGCGCATCTCCAGACTCGAACTCGCCGCTCCGGGGACTTGACTCTTGAGCTG
CCTTGGACTGTTCTCATTATTGAAATTGCATTAATAAGGAAGTTCAATGTTTATTTTTGT
TTGGGTCTGGCGGCTGAAGGAAAATGTGCTTTTGTTGTTATTATGCCGCTCGAGTCTCTG
ATTACGGAGTCCGGTGGCCGATCAACGTCAGCAATTCGATGTGAAAGTGATCGAAGAGCA
GAGGGATAAAGGTAATTAGAGATTTGATTCAAGGGTACCGGAGTGATCCGCATTTGTAGC
TCATGTATCGATATGAAGGCAATAGAATTTCTGTGCGAGCACCCCCATTGGTTTAAGCAA
ACTGTTCTCAAACAATCTTCATATTATCAAGATGGCAATTGAAGAGATCGTTTTAGAGAT
CATCTTAATATAACTTCCTCCCCTATGTGCACTTTGTGTTAGACGCATTGTCAATTTCAT
TCAATAAACAGTGGTATTAACAGCTAATTTATCCTAAACAGCTCCCACATTCCCACAAAA
ATACCCCCATAAAGACTAAGAAAAAATGAATATCTGTTTGGAGAAAAACATGTCGTATTC
CAAAAAGAAAAACAAAACCCTCCCGCCTGCCGAGGAAAATGTGTTAAATTTTCCCCCGCC
GACAAATGTGCCGAAAAGTAGAAAAATGGAAACAAGGAAAACTCAGTCAAAGATTATTTT
TGGAACGCACGAGTGAGACGGCGAGTGTCTAGCCTTGAATGGGTCAAATGTGGGGGGAAG
GTGTTGGGCAGGGAGGGGTTATCGGGGGTCTCCTAATTCAGCCACACGTGGCTCAACGAT
CCAGGAAATAAATTTAGCATTGACCTAGGCGAAGTTTTTTCAGCATTCAGTGGGGTTTAT
TGCCTTTTGGCCGTGTAAATATTTGATTTACATGTTTTCCGCCCAGTGTCAACGACTGAA
AGTCAACGATCCTATCCGCGGATCTGAAGTCTTCATTACTGTGAGTGATATAATTTTTAA
TTGCATGTAATTTCATAAATTTTCACTCCGTCGAAGTTTTATTGAACTCCATCAAGGGGG
AGGGGGTGGATTGGGCTCTCTCTGGAGCGACATGTGTTTCTCTCACAGCTGTTTTTCACC
CTCACTGGCTCTTACCACTGCTGATTGTGCGTTTATGCGGGGCACGGTTGGTGAAATCAA
TTCATGAAGTGTCTAAAAATGTTTGTTCCTAAAAACCACACTCTATTTAAAATCTCTCAC
TTACTAGTGAAAAACATGATAATAAACAACTTGCCAAAAAAAATCCAATGAAATTGACAC
TTATGTTAAAAAAATAGGTGAGATTGTAACCGTTGATGTACACTTACGAAGTACGTAACA
AGTTCATGAACTGATTTCGTGAGCAGGTCTCTCCATAATCGCCGTATCTGTGGGATCGCG
CGCTCCTGCTCGCACTCGCTGGGTGGATGGCAGCACATGTTCGAAGTGCGAGAGAGTGCA
AAGCGGAGAGCGCCGACGTCGACGCCGAAAAAACTGAACAAGATCCGCCGCGAATGTTGA
TTTTCCTTTCATTGACTAACTGCCACTCGCAGCGCGCAGATCGTCGGCTCCGCTTGTTCC
GTTCCGTTCGTTTCGTTTCGTTTCGTTCGATCTACTTCGAGTCGCGAGTTTTAAGCAGTG
TAGTGAGTGCCCCGTGAAAAGGATAACCCAAAAAGTGATTTCTACTATTTTCCAATAGTT
TTTATCAGTGTGAAGAAAACATGTAAACTTGGCTCAAAAAGGGCTTTAAAAGATACAAAG
CTTCAATGCGAAGGATAAAATAATATCGCACCAGTGCTTCAAAAACCAAAACTATGCCTA
AGGCTGGAAATTTAAATTAAAATTTTTTTAATAAATATTCCAAAAATATTGCCCCTGAAA
AGTGTTGATAAACCCCCAACCGAGCAAAATGTTAATGTCCGCGGACAGTTCAGATAGCGC
CAAGACTTCTGTGATCTGCAGCACGGTGAGTGCCAGCATGCTAGCACCACCAGCTCCAGA
ACAGCCCAGCACCACAGCACCACCCATTTTGGGGGTAACAGGTCGATCTCACCTGGAAAA
TGCCCTGAAACTACCGCCAAACACAAGTGTTTCGGCTTACTACCAGCACAACAGCAAGCT
GGGCATGGGCCAGAATTACAATCCGGAATTCAGGAGCCTGGTAGCACCTGTCACAGATCT
GGATACTGTGCCACCCACAGGTGTGACCATGGCGAGTTCTTCGAATTCTCCCAACTCCTC
CGTCAAGCTGCCCCACAGCGGCGTGATCTTTGTCAGCAAATCGAGTGCCGTCAGCACCAC
CGATGGTCCCACTGCAGTGTTGCAACAGCAGCAGCCGCAGCAGCAAATGCCCCAGCACTT
CGAGTCCCTGCCCCACCACCACCCCCAGCAGGAACACCAGCCACAGCAGCAGCAGCAACA
ACATCACCTTCAGCACCACCCACATCCACATGTGATGTATCCGCACGGATATCAGCAGGC
CAATCTGCACCACTCGGGTGGTATTGCTGTGGTTCCGGCGGATTCGCGTCCCCAGACTCC
CGAGTACATCAAGTCCTACCCAGTTATGGATACAACTGTGGCTAGTTCGGTAAAGGGGGA
ACCAGAACTCAACATAGGTGAGTTGTGTGAGATAGGAAATTGAGGAAATACTAAATATAT
GAGGAGAAATGGGATATAGATTAGAGTTAGGAAGAAATACATAAATCAATGTGTGACATT
TCTTGAACGCATTTAAAGTTATCTAAATCCGATTCCAATAAGAAACCCGTATCGATCTCA
TAAAATTAAGCACTCTTATGCTTGGCTTCCGTTTTGACAGAATGAGAAACCTTGAAAACC
AAAAGTATGCAAACCATAAAATGCCGGTATATAGTGTGTATCTGAAGAATAAAGTATATA
TGACCGCATTGAGAGAAAAAATTCGATCTCGTGTTTGCCGATCTGATTCGATTTCTGACC
TTCCCCCGCCAATTAGCATTTGGAATATTGGCCTGGCAAGGCGGAAATTTGCGAGGTGGC
GCCCGATCAAATTACTGTGACGTCACACGTCCAGCAATCGTGTGACCATCATTATCAACG
TAATTATCTATATCAGTAAGCGATGATCGCCGTTTAGTCAGTCAGTCAGTTAGTTCAGTC
ATCAAGGTCGTTCCGCATCCGAAATCATTTTCTGTTTAAGCACCGAGTTCAAGTAAGTTC
AATTAACTTCAGCACTCGCCATCGGGTTTTTCTCATTTTATTTATTTATTATTTCTTGTT
CCATCGAAAATTATAACAGTACCAATGTCAGGCTTTTGTTTTATGACTAAAGGAAGTTAA
TGCACTTATGAGCAACCGGTTCAAGTCCGCATAAAGACTCCGGATCAGATCGAATCGTAT
AGGGGCAATATCATTTCAAGCGATGAGTCAAGGTAGTTCTTTCTACAGAGAGGGAACTGG
TTGATTGTCGTTGAAGTTTTTTGCATGGATTCCAACTAAACTAGACGGTGGGATTATTTA
AGGTCTTGGGCTTAGGGGAAGGTGTTTATGGTAATGACATACATAAATGGGCATTAGCTT
TGCTTTAGATACGAATTATGGCAAATTTCATATGCTGCCTAATTGTATTTATAAAAATGT
AAATATCTTGGGATCTTGAGGTTCAAAAATGTCGATTTTTTAACATACATAAAAGATCCA
ATAGATACAGTATCGCCATATTCACGTCCTAAACCGAAACACGCCTAAAATAAATTGAAT
TTCGCACTTACTAGCATGACAGTCGAGCCGAAAGTGAAAACCGAAATAATATTTATATGT
GTCTCGATTATGTATCCAATTTCCAATCCCCCACCATTTCTCACCCACTCCCGTTGCCAT
TATTTGCTTTACTTAGCAAAAGTGTGTTTTTCCCCCATGGCTTCGATATTTATTTATGCG
TTTGTGTGTTGGCATTGCATTTCACTAAGTGAAAAACTGGGCGAAAGAGATGGAGCGATG
ACAAAGTCGGTTTCCAAGTTCATTGCTACCCTGTGGATCGCGGATCGCTGGATCGGTGGA
TTTCTTTTCGCATTCGCAAATGAATTTCTTGGTGTTTTTGCTCGGTTTCGGCCGGGTCGA
TGTGCATCCGCTTGCCAAGTTTCGCGTTGCAATTGCAGCCAAACGAAAGTGAAAAGCCAA
CTGCAGCTTGACTTGGCCAAAGCCAGAGCCAAATTCACTTTTCACCACCGAGGCGACTGA
GCATGCGCGGCCAATTTACGGGCAAACAAACAGAAAGAAAAAATAAATACAAAACCGGGT
CTAAGCCTCTTTGACATTTTTACATAGCAGCGGGTTAATGACTCCTCTGTGCCACCCCTC
TTCACCCCTTTCAAATGTCGGTGAAAGTCAAGCTGCAACGCTACAATTGTCCAAAAGAAA
AGTTCGCCTTGCCACCATTGCTCTCCGCAATTTATTTGTCTTTTGCTTTATTTTTTTTTT
TTATATTTTTTTCCTTCGCTTTTCGCAGGCGCTTTTCAAATATCGTAGGCGGCTCTTGAA
CTTTTGCTCGCTTGGAAAGTTTACTCTATTCGATTTTTATTTCATTTTCATTTTATTTGA
TATTCGTCCGATCGTGTTTATTTTTATTGGCACAATTATTTGTGCATTTTAGAAATTTAT
TAAGCGGCCAAAGACCTGAAAGTGAAAACCATCGACAAATCGAAAGTAACGAATTTTGTG
TTTCTTATTGCATTTTATTTGTGGGCTAAAGATTTGTTTGTCCATTTTTGGGCACTTTTA
CTTTTGGCTAATTGGTTCGAGCAGGTGGAGATGGAAGTGTTTTTGAAGGTTTTTTTTTTA
TGTAGAATATAGGAATTTTTACTGTCCCAACACATACTTTTATTTGGCAATAAGCAAACG
TTCCCACGCCAGCGATCAGTAACCCCAAAAAAGTTCAATAAATTAATGAATTCCTCAAAA
AGTACAAGGCACTCACTCGAAAGCAAAACAAGCCCCAAGATCAATGCACTCAGCGCATTT
TTCAAAAAATTCTGTTTCATTGAGGGAGGGGTCATTAATTCCCATTCCCGCTAAAAACAA
AAAATATCCCATTGCATAATCGGAATTTTAGGCGGCAGTTGTTAATTCAATGAGCTCCCA
GCGAAGGTGACTAAAAACGCGCCCACTTTACAAGGTGTATCCCTCATTTTGAGCTGACCT
CAGTTGCGTTTTTTGAACTTGACGAAAATGTTGAATACAATTTTTTATTCTTGACTTGAT
TAAACGATACATTGAACTGGCGCTAAAATAAAGCAACTGAAAAACCTGTCCGAACATTTC
CGCATTGAAGTTTGTGGGCAGAGGGAGAACGCTTCTCTCGCCCCCTCTCTTTTCCTCCTG
CACACGCAAAACTTTTATTGATTGAGCGGGAAAGAGAGCGAATGAGAGCGGCAAAAATTT
CAATGTCAAATTTTAATTTAGTAGTTTTTTTTTTCTTTACCCACACAAAAACAGAACATT
GGCAATATGGCAATATCTCTCGCTCTCTCTCTCTCTTTTTGGCCAGCGATCCTCCCTCTC
GCTCTCTCTTGTATTAATAAATATTTTGAGTAGTCGAAAATTTGACTGTGAGTGTGTGCT
TTTTTCTGGGGTGTGTTTTTGTGAGGGGAGCTGCCATTTGTTTGGCTTATTTCTAGTATT
TCTCTGATAGTGCCCGTTCCACCTCTTCGCAGACACCCCCCAAAACCCCCGCCCCTTACC
GCATCTGTGTGCGTGTGGAGTGAATGAAACTTTCAAGGTCGCCTGTTCGCACTAGTGTGC
GTGTGAGCAGTGCGTATTAGATAATTCCCATGGATTTGGCAGTCTGATTATTCAGTTAGC
TAGAATTTCGCAGGCCGATCCGAAAAAAACATTTGTATTAAATTTATCATAATACGAAAG
AATTATAAAATAATATAATATTTCAAATTTAAATATTTATATAAAATTCCTATCCGCCTG
AATCACACAGTTCAGCTGGGTGGAAAAATAAAAAATCCTATGAGACAGTAAAGAACTTTC
AAAAAACTATTAATAAGAACATTTAAAGACTATATTATTCTGACTCACTAATCATATTAA
CTTTTATCTGAACGTACCCCCAATTCCCTTCCTCATATGGGTTATTATTACACCGAAAAA
AACAGAATAATATTTATCAGGCATTACACGTGTCGCCGATTAGCGAATGCCAACCACTCA
CTCAAAGTTCCCAAGGCAATGAGGTGGAGAAAGAGAGGGACAGAGGGGCGAGAAAAGAGA
CAGAGATAGGGAGGAGAACTGACCTTGCTGCCTTTGTTTATAGAACACATTTTGGTAATC
CGTGAGCGAATCTATTACAAATGCTAGTTCTTCCCAAAAAAAAAAAAACTAAATTTATAT
AAATCACAATGTGCCGATGACGTAAGCCAAGCGATTCTGATTTCAAATGGGTTCCGAATT
AGGAAAAAAACAGAAACACAGACAGAGTCCGAGGGAGATAGAAACAGTACGTGGCATTCT
TTATTCTCTTAACGCCCGCAATGAATTATTTTTAAATGTGTACCACGAAATCCAAAAAAA
AAAAATACAAGAAATACACAAAGGAAGTCCCAAAACAACAACAATATTATATTTAATAAA
GACAAAATGTGGGATGGTTTTTTTTTTCAAGTTCAAATAAACATGCCAGCTGTGATTGTT
TTTCACTTTTTTTCGCTTTCTTCTCTGATAAGAACTTCAATTGCGGCTGCTTGTCTTACA
GATAGTTTTGTATCTTTATCTATAAGGAAAACACGCGCTTATGAATAAGATGTTTTGGTG
TTTTGCTTCCCATTTGGGAAGTTCTTGATCAAAGAACTCGTATGGTGTAATTTACAGACC
TTATCATGTGCAGGTTAATTAGTTGGCAAACGTAAATGTAGACCACCATGCATCTGCACT
CTTTGTTGAACGCAAGTGTATCAGCATGCAGCGATCTTTTAGTCTGGAAACTTGAAGCGA
ATTCAGTCAGTGGCGTGCCAGAGATCAGTGCAACACGCAACCCCTTTCCTCTTCGCAGCC
TGTTTTTTGTTGTGGCTGCCCGATGCAAAAGTGCAACGATCTGCAGTGCGAAATGTCAGT
GAACTTGTCGGCATTGCAGCCGTATAGGCTATATGTTGATGCTGGTTGTGTGTGAGTCTG
GCACAGAAATAGCAAAACGCAGATACAGATACAAGTTGCTCATGATCGTGATCGTGATGA
TGATGGCCATGGCAGCGTGAAGATCATGAACATTGTTTGCCATTTACAATTGTTTACAAA
GCGTGGCGCGTCTGATTGTTAGAGAAAAAGAGGAAGTACTAAAGAAGCCAAAGAGATATG
AAAGAGACAGAGAGGGAGTTATCCTACTGACGAGAGAAAGACTTTCTTTGGAGCTTCCTC
AACATGAAGAACAAACCAAAACGAAACCTGTTTATAGAAAGTCTTTCTCTCGGCTGAAAG
AACTTGTTTCCGCCCAAAAGAAAGTCTTTCTCCGGCGCTCATTCTCTGGTTCTTGTGCTC
TCTCTTGTTTACTTTCTTCTGGTTTGATCGCCTGTTTTTCTCTCTTGTTTACCTGGCGTG
CCGGTGAAAGTTACGTAACATTTCTTTGGCCAAGAACGAGCTCAAGTTCAGCAACAAGTT
TTTGTTGCCTCGCCCATTTCGTTTTGTTGCTTTCTTCGCCTTGGCAATGGCATTGCGTCT
CTTTATTTGAAGAAAGTATTACGTCCACTTTGCGGTGACTTTCTTCTGGTTGTTTAAGGT
GTGCGATACTGAAATGGAAGTGACAATGAAAGTTGTTGAATGTTTGCCTCCCAGTTTTGT
ATAATTTTATAATGTGTGGCACAACTTACTGTGTTGCTATTCTTTTAGATACAGATTCAG
TCATTTCCTTTTTTTTATATTTTCAATATTGTGAAATTCGTTTTCCACCACAATGTACTG
CTTCAGTCAATCTAAATCACCCAATCATTACTCCACAATTTCATCAGTTCCTTTAATGCT
ATTTTCTGGTTATTAATCGCAAATTGCCATCTTTTCTTTGCAGAATTCGATGGCACCACA
GTGCTGTGCCGCGTTTGCGGGGATAAGGCCTCCGGTTTCCATTACGGCGTGCATTCCTGC
GAGGGTTGCAAGGTAAGTTCGTGCACAACACAGCCTTAGATGTACAAAGAACAGAGAGGT
GGTCGGTACCGCGGGGGTGGCAATGCAAAAGTGTGCTCGCCACGTGCAACTTGATGCCCA
ACCACCAAACTTCGGGTCTGACATTGAACTCGGTTGACCTCCTTGGCAGGGAAAAAAAGG
GATCAGGAATTACGTTGGCAGGGTTGTTTTTCTGCCAGCAACAGGCCCTTGCCCTTCGCA
AAAACCTGCGTCGTCTGGCGAATTGTCCTTGCATTAAATTGCGTCGCAATAAAATAAATC
AAAATGTACAACATCGCGGTCCTGGGCACAACAAATGAGACACAGAAAGTATAAAAAAAT
AAAATAAAGCAACCACCAAACCAGAACGAAACCTTCAAATCTGCTTTTGTGAGCGATTCT
TTTCATTCTGCACTGGAAAATCAAATTAGCGATCAATGCAATACGATGATTATTGCGTTT
TAAGGATCAGTTTAGATCTCTCAATTGATTCAAATTGGATTGGAATGCTAAGAAGACCTT
ATTCATATTTGTTAATTTTGTTTGAAACGATTTTACTTCAAATGCGAAATAGCTAAGCAG
TAAAGTCCTGCTAGAAACCCATTTTAAGGATAGGGGAATATTCTAAAATATTTGTAATAT
TTTGTGCAGTGTTTTCCTTGGGCTCCTGCTGCTTTTAAAGCCTGCGTTGCCGCCCTTTGT
CGTCTGTGACATTGAAAATGCCGGCAAGTTCATTCGCCCAAAGTGCTGAGCCTCTGCCTC
TGGACAGAGTCCAGCGATCGTTCCAGTGATTGTTCCTTGCCCAGAGATGAGTGTCTCGCA
TGAAAGAATCTTAATCGGGTCGAGCTGCTGCCGGGGATCGTGTCACGCGATCATCACTAT
ATCCACTCTGCACAACCTTGGCAAAGTAGTTTGCCCTATTCCCTTATATTCGCCGGCACT
CGGGGTTCGGCAAGCGAGTCGGGTTTAATGTCTCAATGACGTCCTTGAATTGGGTTAACA
GCCAGCCGAGGTTCGTTCTCGTTCTCGCTCCCTCTTTCATCTGCCGTCCCTTTCTTTACG
TCTGGCCCTTGGCGGTCCTTGTATTTGTTTTTGCCTCTAAAGTTTAAACTGTCTGCGCGT
CTGAAATTTCAAACGTTGCTAAAATACGCGGACAGTGATCCCTCCGAAATTGAAACGTTT
AGAAGGAAGTCAAGGCTGGTAGGAAAATTGTGAAAACTAGATCAATTTATTTTCTTATTA
TATTTCCAAGGAACAAATATTATTTTATTTCCCAGGAACAAATATATGTATCACTCTTTT
TTACCTGAAACTCTACAGAGAAATGTTGTTAAGTTTTAGTTTTATTTTGTAATACCCCCT
GTATGTGTGTCCACCTCGAGTTGTTCTGCAAAGGAAGATGCAGAAGTTCGTTGACTTTGG
ACCAGTTTTTTCGGCCTTTCAATTTTCGTGGAACTTCTTTTGTTGTGTGCTAATTTATAT
GTTTATTATGTGAATGTAAATATATGTTTAACTGAATAGGTAGGCCTACGAATTTGTGTT
TCCCTCGCGCATTTTTGAAGTTCAAGGTTAGCCAACAGACGCCATCTCGCTCCCACCGAC
TCACGCGTATATTCCCGTCCCGCTCGCTACCTTTGAGGAAGCCAGTTTCGCGTATTGCTC
ATACGCCGCGTGGTGCTGATATTTCCGCCCCATCCATTTGTGGCTGCGATTTTAGACTTG
TGTGCCTACCTGATCTGCTCGGTGGACCTTCGTCTTGTCTATTGACCTCTATTTCAGAGA
CAGATTCTTGGATTTCATGTTTTCTTTTTTTGTTTTAGATCTTTTTTGCGTTTTGAGCTT
GACGAATGACTTCATTCGTTGCCAACTGACTCATTTTCAGACCTGGCAACTAAGACTCTA
TTTGGAACTCGTTTGTTCTTGGTCGTATTTTATAGTTTTAGAGCCGCTTAAGGGTTCTAC
GCGCTGATTAATTATGGCGGAAAAGGTTTGACAAAAAGCGTGTTGTATATTTATAGATTT
CTTAGGCCTATGATATTTTCGTTTTCAAGGTAAGACGATGACTTTGGTATTCCATAACCT
TTCAATTGACATCCGATCATTGCAATTTCATGATATGCATATCTTACATGATTTCTACAT
TGTGAGTTATGCTCGAAATGTTCCATATCTTACCTCAAATTCCCCAAAGACATCGGTTGA
TAGTACATATTCTTCTTCTAGGCAAGAACCGAAAATTGGTACCGTGACTCACATCTTTTT
TGCCCCACTCCATTATCCTTGGCCCAACTAGTTTCACACATTTGTTGCCTGCTGCCTTAA
TGACCCAATTCCCGATTTCGTAACTACATCAAAAAAAAAATAGTAGAGGGCAGGTGATAT
TATTTATATTTTTTGTGAGGGACCACGACGAAGGAGCGTGCGAAGAGGAATAGTCAAATG
GATGTTAATTTTCTATAAAATGCCGGGGGACTTTTCGTGGTGGTCAGCTTTCTTTATTTC
TGATTCTGGGCCTATTATCTAACTTGTTTGTTATTCCTTCCACATTATTTAGCATATTTA
TTTATTTACCCACACTCAGGCATACAATTTTGTATTTTCTTTCTTTTTTTTTTTTGCTGC
CGCTGGTTGTGAGGCTCTCGTTTTATTTTTCTGTTTCCATTTCGCTTCGGCAGTTGTTGT
GTATGCTTCGTGTAGTTTTTCGTGCTTGGGAAGGGACGGGGGCGAGTATCTGTGTGAGTG
GCGCTGCAGTTGTGTGCGTGCAGCAAATGTGAATGAACTCGTTCAATGTCAAAGCAGAAA
CAGAAGCAGCGTACGCAGCATAGGCCACGAGAAAGCAGTGGAGGGAGAGGCGGAGAAAGA
AGAGAGCATTACTCTCTCGCTCTTTTGTATTGCTTTTTGGTTTTGGTTTTTCATTGCATT
TAATCAAGAGAGAAATAATCAGTATATGTGTTGGATAAAGCAATAGTTTTATTGTTCTGT
TTAAGCTATTCAAATGAACTATTTAAATGCGAAAGGGCTCATAAGTCATTGCCAAGTCTC
CTTCTCCAACCCACTTTCTTTCATAACTCTACCTATCTTTCTAATTTTTCATAGACCCTA
ACCTGCACCAATTTTAGAGCACTCATCAGATTATATTTGTTATATGAACAAACACCAAAT
GCACTTGATAATCTCGAAGAAAGAAAAGCAAAGAAAATGGGAAGAAAATAAAGTCCCAAA
ACAAACAGAAGACATTTAATTTTGATGGTCTTATCAGGGGGCAAAATACTAATATATACC
CATATTTTCGCCATTCCCAAGATTTTATCACGGAGACCTCAATTCTCATTTGGCTTTCGA
GGTTTTCCACTTGCCTGCACTTCAAATTGGAAAACCAAAAGGAAAAGCCAGGGAAAACGA
GCGAGAGAGAGAAGAGAGCGGTGAATCCGATTCTGATTGTTGGGCTAGGACTCACAGCAC
TCACACAGAGACACAAAGGTTAATGCTCTGAAATGCACTTGAACGACTGACTGCAGTCGC
AGTCGTCGTCGGCAGAGACGCCGACAGCGACGCAGCGTTGCATGAAATTGTCTAGGCGTG
AGTTTGTGTGCATGTGTGTGAGTGAGCACGAGGTGTGGCGAGGGTGAAAAAAACTAAAAA
GAGAGGACGGGGAGCAGGAGGTGGAGTTGGGGTGGGAGGCGCTATTTATTCGTATTTAGG
TTGTGCCTCTCCAGGGAAAATTCTAGAAAATGCATTTCCTTTTCGAATGAGTCTTAGATT
TGATACAGAAACAGAAAAATGTTTCTTTTTTTCAAGTTTTTAAAAGTGTTTCACTTACCA
AGTGCGTGAAAAGATTAACATTGTATTTAATTGGAATTAAAAACATTTCCTTGTATTTTT
TAGAAACAATATATTTAGTTTGCAAACTAACAATATTATTTATTTAAAGAAAATACATTA
ATAAAGGGTATATGGACAATTTCTTTAGTCATTTTGTTTAATTTTCAACCACATAACTGT
GCTAATTTTTCCACACATTTCCATTTTACAACTATTCAAACCAACACTCGCACAAAATTA
ACGATGCAAAAACACTCTCCCACTCTCTTTTTCGTTCTCTTTCGGCTTACGCATCGCTAG
TGACGTTTTGTGCTCCGCATTTCTGCCCACAAACAGTTCAATGCACCTTGCAAAAATTGG
GTCAACAACCTCAGCCTATTTGGGTTACAGTCCAGCACAACGACAACAATTCCGTGTGCT
AGATAGAAAGATATATGTGCGAGCGTACATATGTAATCATCTTAGCGAACAATAATCCTG
GCCTATTAATATGATGGCAAAAACTTTAAAATAACCCCCTTTTTTAAGAGAACGAGTATA
GCGCAATGGAGAATATCATAGTTTAGTCTTGAAAGTCTTAAAGGATTTTTGGTATTGCAC
GAAAGTCATTTTCATTGTGATAATAAAAAGGATTCGTTTGGATTGCCATTAAATTTGCGC
AGCCAGATCATACGATTATTTTACATTGTGCATGTCATTTTACATCTGTGTCTACATAAC
ATACTGGCGCCATCTAGTGTTAGGTGTCTACCTTACGATCGAGTTGTGCGATTTTCAAGC
TCGAAAGTATGCAATGAAATATTTAAGATTGGTTGACTTGTAGCAGCGAGCTTTCGAGAG
TACGTTTTTGAAGGCGACAAATTGAAAATATTTTTGGTTAAAGTGACAAATACAAAATAC
AAAAAATGTTATTAGTAACAAATTTAGTAAGCACGAATAACAACAGCGAAAGGATCTAGG
TCAGCTAAAAGTATTACAAAGCTATTTCAAAGATTTTTATGCAAGGTTGTGCAAATAGCT
ATTCTAAAGATTTTAGTGCAAGGTTTTGCACAGTTTTGAAAACAAACAAGCATACAACAT
TTCCTTCCGAATATATTATGCAATGCAAAACGGCCATAAAGCTCCCAAGAACACGGAGGC
GCACTTAAAACAGCCATTAAAATGCAAATGACTAATTATTCGAATAGTAAATATGCTTTG
CCGCACAGCCAAGGCCAAATCGAATTCGTTTACTTGCTCCAGCGAATGAGTAATTAGTGC
TGAAAGCAGAATCAAATGGCGAGCAAATTAATGCCTCCGACACGCCCACTAATGCGGCCT
TTGGGTTTTGGCCTTATCTGTTGGCAAAGAGAACGTGCAACTGCAACAGCAGCTGCAACT
GCAACTGCAGCAGCAGCAGCAACTCTACTACGAGCTGTGCTAAATGCAATTTTTTTTCCT
TTCTGTTACGAGCGATAGTAAAATGTGAAACGAGTGTTTGTGAGTGTTTGGTCGAGTGGC
TGAGCAAACACAGATATATGTGGATAGATATAGATATAGATATATGTATATACATACCAC
ATATACCTGAACCACCCCCGAAGCTGAGGGCAGCAGCCACTTTTGCTGACCCAGTTAAAA
GTCGTTCGCCCCGACTTTGGTGCCACGTGCCACGTTTTTCACCCGCCTTGAGTTCTTGGC
TCCAGCTCGCAAAAGACTTTGCTTTCATTCGAGGTTACTTACCCCTTTTTCGGGGTGGTG
TTTGGCTTGCGGCTTAGCTTGTTTCACTTTTCCACAGCTGCTGCTGCTGCTGCTGCTTCT
ACTGTTGCTGCTAAGGCCAAAAATATGGTGTTTGTTTAGACTGACATTTGTGGGGCCAAA
GGAGGGACTTGTGGAAGGGGTTGCTTTCAATATTCAAGGGTTGTCTCATTTTACGACTAA
TTGAAAAGATGAAATATTAGGCTGAAATATTTGGAAAATTATAACTTTTGCAAACAAATG
TAAGCCAGATGAATTATGTCACATTTTTGTCAGTACGGATTTCAGGCAATAAATATCATA
AGATTTATGCTGCTCTTCAGTTTTCAAGATATTTTTTAAGTACTCATGAAATATATTTTA
CTCATTTAAAATTATGCTTTACAATTATCCCACACTCTGTGAAGGAATTAACTTCTGTTG
CGTAATCTCTTTCCATTAGATGTCACATTTGGCCAGCCTTTTGTTTGGTCTCTTCCCAGC
CCGCTACATGTTGCACACACACTAGCTGTTGCTTTCTCTTTCTCCGCTGCAATCTAGCTG
GAAATTTCCCAGTTTGTTGGCAACATTCTAGAACACTCGCACACCCAGAGGGGCAGAAAA
ACAGAACGTCAACGAACTTGCAACAAACGCAACGAGTTTTTCTGCAGCATTGCTTTATTT
TTGCTAGCTGTGTGAGCAATGAAAGTACCGCAACTCACAGGGCGAGCGAGATGGATGGCC
GGTGAGAAGAGAGAGAGAGAGAGGGAGAAAGGCTGAATAGTTGCAACGAAGTGCATTGAC
TCTGCTTTCTTTGCCAAGCCAAATCGTTGACGTCAGCCCGGGTTGAATGCACTTTTCGCG
CGGAAAAACCCGAGCCAGCCGAGACGCGAACCCCACTACTGGCCCGATCACATGTTGCAA
GTGGCAAGTGGCAGGTCTAGATGTTGCTACTGCAACTGCAACATCCAGCGGCTAGAGGGT
TCAATGCGCTGGCGATGCTTGCCGGCTGCACCTTGGCTATAATTGTCTTATGTCATAAGT
CAAAAATCCATCTGACATTTTGCCGTTGACAGTTTTATGTCGTTTCTGCGCGCTCCGTTT
TCGCCTTGACTTGGCCAATAATTAAGAGCGAATTATTTATGTGGCCTGTGTGTGTGTCGG
GGCGTGCCATCTTGGCCAGGATTGTCGGTGGTCGGCGAATAGCTTGGCGTGGGAATGGCT
CACGATTCGTAAATTGCCTGCCAAGGGAATCGTTCTTTTAGCCGCAATTAAGTTTAAGGG
AGCTCAGATTGTTGGTACGAGTTAATTTGCTTGTTTAATTGAACTTTTGGCATGGGAAAT
TCGGTTGAAAATGATTGGTATTTAAGTTTTAGGGTTCGGCTTAATAGGGCTGATCACATT
TCTTATGTTACCCGTGTATGTCAGGTGTGGCTAATTAACCACAATATATAGAAGGCAGAA
TACATACAAAATATACAGAATGCACTCCTAACCTTACTGGTAAATCAAAAATCAAGTTAG
TTTCTTTAAACAGTAGGAGTATCATAACTTAAGTAGCCTTCCAAACGGTTCAACCTTTTT
CCTAACAAACTTCCTCTTTCCATTGCAGGTAAGCTTTTGATTTTGATTCGCTCCGCTCAT
TTCCCCAGACCACCCGATAATTTTCATTGTAAGTACCGCCCTGAACAGGCCTTCAATTAT
CCCTAAAACAAAATGTGCGCCCTTCCTTCCCCCAACTAATTGATTTATGTGGCCGCCGCA
TTTTGAGGCGCGATAAGCAGCACGAAGTATGCCCCAGAGCCAAAAGCCAACCTCCAGTCA
AGCAGTCCAATCCAATTCAATCCGAACCCGAATCGCGGAATCCGCGGTAGTAACAATGCA
AGTTTGTTGAGCACGCGAAGCGAATGGGGAATGAAGTTCGGAACGGTTTGGTAGTCGAAA
AAGAACCACAAAGAAAAACCTTGCAACTGGCCGGCAGGCGTTTAGCTTTAACTGATTTTG
CTGCTGCCTCTTTTTTTCTTTTCTGGTTTTTATTTTATTTTTTTTTTTGCCGCCGCTTGT
GTACTAACCTCGGACAAGCGGCCAAACATTGCGGCGCAGCTCGTAATCCTTCTGGCTACC
TAACGGTTACTGGACGCGGTCAAAGACCGCTCCAACTGCCTCCCAGTAGCGCAGCTGCTG
CCCTGGGTTTCCCCCGTCTATTCCCCCCCATGAAGTGCCCCTTCCCACTCACTGTTTTGG
CCAGGTTTTGATAGCAATGGTCATGCCACGCACGTTTCGCTGTTAGTTTCCAGTTGCCAG
GCAGCAAAGGCCCACGGGCAGAGACCACAAAGTAGCCTGGGAATGCAAGGGGGAGTACGA
AATGGGCAATCAGTTAAGGAGATGGAGGGCGGATCGAGAAGTTATCATGTGCTGCAGTAC
TTAAAGCAGTAGCTAGTTAACAAGTGTTATTATGTAATAATATTTTTCATAATTATGCCA
TGATCAAGCCATGCATTTAATAACAACTTTTTAAAATAAGTAGGTAAATTTGGAATTAAA
TATCAGAATGCTGAGAGGACTAAATTCTAAATAAATAGAATTTAGACTACATAAAAGCAC
GACGTTCTTTGAAGTTCTTACTTACTCCTTGAAATATTTGTACATCCTCGGCCATTTTTT
TAATCGCTTTTTATAAACAAAAAACTTTCAATGTGTGTTATTTTCCTAAGAAATATTTGA
TTTATATGCCCATTATATCGACTACACATCTTCTCAATAATATATTTGACATATTCTCTT
ATTTATGATCAGATTTAACTACCCAAAATGGTTTTTATTACGCCTCACTTCCACAACCTA
AGTCCGCTTGAATTTCATTGAAAACTCTTGACTCCAACCCGTGGAAAATTGTGCGTAAAG
TGCGTGACTAAGCCCACCGCCGAGCACCGTTCCCGTTTTCCCGGTGGAAAAGTGGGGGGC
GCTGAGGCCAAAACCCTCTCAGGCGTTAAACAACGTTTTGTTTTGGCCACAAATCTCAGA
CACTCCATGCCGACTGCCGCATGTTGCATGATAATTATGCAACCCGGCTGTGTGCTGCAG
GCCAAAAAACATCAGCAACGGGCCAACAGAGTGGCCCCGCCTCCTCGAACCACCTCGAAC
CATTTCGTCCTCCCCTCATTTTCCTCTGCATCTAATTTTCGTAGTCGTTGCACGCGCTTT
CATTGCATGCGTGTGCACTGCAATCCCCCTTCCCACGCCCCTTTAACCCGCTCTCGTGGT
TGGGGGCATGCCAAATGGCACTAACTCATTTCCGTCACAAATTCTATGAATGTGTAGCCG
GCCCGCCCCTCGGGTGCCACTATTTTTATGGCAATTAATGTGGAACAGGCAGTTTTGGCC
TGGTCAACGCTGCGTATGAGTAATCTAATATTTGCCCTGCCCCGTATAGAATTTTAGCTT
TTGCCGTTTCTGCACTCTCGCATTGCTCATAATGTGGCTTTCGTTGGCTTTACGGTTGCA
TTTACGAATCCATATGGGCGTGTCAAGCGGAGGCGGGCAATGCTAACGCACACAGTGCGT
ATGGATAATATTATAGATAGATAGGCATATACATAATTGGGTTCCGAATGGAGTGATAGA
GTGGCAGCAGGCAAGCCGTATCAAAAAGCCATGGAATTACAAATTATTTATTGCTTTTCC
ATACTTTTATTGGCTGCAAATAATATTTGGCGAAGCTTAGCTGCATTTATTAACTGCATA
TATTACAGCATAACAGTTTTTGTTAGTTAACTCGAAAGAGATCCATCCTTTGTTTTAGAA
AGTTCGTGCAGTTGCCCAATCATTAAAAAGTTATATTTTGGCCCATTATTTTTAAAGAGG
CCCTATTGTCCTTACACACGATTATGTCATTGAGCGACGTTTGGCATTTTTTCCTGGTTG
TCTCAGCAGTCCGTTTAATAGCTCCCAACATGGAGACCCTTAAGGCTCGATCTGAAAACA
ACACCTTGCCTCATTTAATGGTGTCGTGCCGTGTCGTGTCGAATCGAATCGAATTGAAGT
CGCCTCATGTCAGTCAGGGGCTGTTGTCATAACCTCAAACATGCAACAGACATCTGAAGA
CAACAAAAAATCCTAGCGAAAATGTCAAGCCGAGTGGAGTTTTGCAGTTTTCAGCAGAAT
AAGATCAAGCCGCTGGTAATTTATGTTGACTCTGAAAAAAAATCGAATGTAAGACAATTT
GAGATAGATTTTTTCTTTTTCGGTACTTCGCGTTGTGCGAAACTCGTTCGGCAGCCTTCA
GAAATCCGCAGCACGTACCTTGTTAGCCAGCCCGTACAATCACCTCAACAGAGTTGTCCA
AAAGCCCCCCACACAGGCCCCGTGGAAATGGGAAAACGTGACTCGATGGCGGACCCCAGT
CAAGTAGATGGAATTGCATTTAATGGGCCCAAGCCTAACCGAACTGAAACGAACCGAGCC
GCGCCGATTTTGCCCAGGCATTAAGATCTCACTGTTCTCCTCTACAATTCAAATTCAAAA
TCGCAATTGATTTCGCTGGGGCTTCGTCTGTTACGTTTGATATTTGAATTTCGAGCCGAC
ACCAATCCATAGGCATTAGGTCCAAGAAAATTTGTATTTTTCGACAACAAATTGAAAAAT
CAAGCGGCGCTCTCAAGTGGGTGACACATGCAACGAGTCATTCAACTTGAGCGCAATTAA
TTCATTGAAATCGATGCAGAAACAACATATCAAAGCACTTCAATTATTTGATTGACTCTA
GTAACTCGGCTTCTAGTTGAGTTACCAAGGTGTTTTAGCTATTGAATGGGCGCATGAAAC
ACCTTTTTTGAGCGTTTTTTTTTTGTTTTGAGTTGAGTGCCTAATAAAGTGCCTAAGAAC
CGCCAATAAACTGAAGTTATGTTCTTAGGCATGACATGATCTCATATTTGTGGGTTCATA
AAAATAATATGAATACGACGCTATAAAATTTCAAAAATTCCTAATCCCTCATTTTCCTCA
GACATTCGCATAACAATTAATTTGGCGGCTAACCCATTTTTTTGTTTTACAGGCGCACAG
AAATACTCCGCCAAATAAGTTTGAGTCGGTTTTTTTTTCGGCTTTTCCCTAGTTTTCCAA
CATGAATTTCATCTAATAATAAAATTGTTTCGAGTGCGAGTGCGGCGACAAATCGTTTTT
CAAATGCCTAAAATTCGTGTTTCCGTCAGAGAGCTGTCAGAATAAGTCCCAAAAAAATTA
AAAATAAAAGAGCAGAACGACGCGACGTTGTCAGGAATTCACTTGAGAGGCGAAGACTAT
TTTTAATTGCTTTTAATTAACAGAACCTACAAAATTTTAAGTGACAAGCATAATAATTCT
TGCTGCAAGTGTGCGTGTACGTGAGTGCTTGGGTGTGTGTGAGTGTGTGTGTCATTAATG
CAATTATTTCGACAGCACAAATGTGCCAGAAAAAAGACGAAAAAAAAGAGGTAAGACGAG
CAAAATGCAAAGGAGTCTTTTTTTCGGCAAAGGCATTTTCGCCTGTGTTGTGGGTCACAC
AGAACATCCGAAGTAGATAAGAAAACGGCTGCCAAGTAAAAGGCAGTCGCATGAAAAGCA
AAGGAAAGAGAGAGAGAGACGAATGCAAAATATGCCGCTATACCAAGTGCAATGAACTTT
GGGTGGGCGCCGCTGCCAGCGGAAAACTCTGCTGCCGCTCAAAAGCGACGACAAAACAGC
GATGGAAAAACGACGACAGAACAGCACGGCACAGCACAGAACTCAACTGAAAAGCCAAGC
AAAGCAAAAGCACAGCAAATGCACAGCAAAAGCAACGAAGTCAAGCAAGTTCTAGTTGAG
GCAGGCCACCAAAGACCGAAGAACTGCGAAGAACTCGGGCCCAGACCAAAAACAGAGCAT
GCATGTCATTATAAAAGTCTAGAAATATCGTTTGGACACTGGAAAAAAATATGCAGTCCG
AACATAGAGGCAGCGAAATGCTAAACAAATTATTCTACATATAGCTTTCCAGTTATAAAA
TTGTATGAATCAATAAAGCAAAAAGCCTATTGATACGTATTAAACAAATCAAATGCTGAT
AAACGGAATATTGTGGGCTAAACTAACTAAACAGTAACACAGTAACAGTTGCTTTACAAA
GCTTCCACACACGAAATTCTTTCGGTGCATTTGTATTTGTATGCCCACTGATTAGGCTTG
AAGATTTACAGCTAATCTATATTTTAGAATTGTGCTCGTGGAGGGGGTGTTGGCCGCGGG
ATGTACCCTAATCCAAGAACCATGCCCCTCTGCTAGCAAACCTCTCCAAGCAAACCCGTT
GCGGCGTGCCTCCTCGTTTGCGGTTGGGTTTATTGAACCCGCCGAATTGGGTTAGCGTAG
GTTAGCTTGGGTTAGGTTAGTTACTCGCCGCCTGCTGCGTTTTTGTATCTGTGTGCTAGT
GCGCGCGTATCTGTGTGCGAGTGTGCTTGTTCTAAAATTGTGAAATGCGATAACGACTAA
CGCTGACTAACACCATACGAACGAGCGTAGTACATATGAAGTTGCTGCCGCGCAGTTCTT
GTTGCTTTTGTGGGCTTTGATTTGGTTTAATTGCCCAAGGAATCGCGGGATGGGGTTGGA
GGCAAGGCAAACAGTTCGGGTTGCAAATGGGCAGGTGAAGTGGAGCCAGCCTGTCGAGAG
GGTTCCCAGTGCTGCTCGGAATCAAAGTTCCATAGCTATGCACTTATGCAGGGTTCCGTG
CGGAGTTCTAGTGGCTTCTCGCTTTTGATGGGAGTTGTGATAAGTGGCGGGGTCTCTATG
ATTGAGTACCTCAAATGGTGGAAATGGCTCGAGATGGTGCGGATAAGATTGCCCGTTGTT
AATTGGGCTCTATGTTTTCTGTGGTTTTTTTATTTCAAAAGATCCTAACTAGGCTAGTTG
CATTTGAAGTCAGTTTAGCTTGGAATGGGTTGGGATTTGCTTGAGTTGGATTTATTTGTA
TTCAGTTTAATTTAATTGGTGAAGAAGGTATTTCTTTTTGATTATTCTGGTTGTTTCTCG
GAGTTTTGGCCTTAAGATGAGAGGGCAAGAGCAGGTAGAATATTGATATTGATTTATTTT
AAACATGGCAATATCTTAATTTTTTAATTATTTTAAGTTGTTCTTGCTAAATAATACAGT
CCTTGTTTTGTAATACTTTAAGTCGATTGAATCTAATTGTGTGCTCTCCTCTTGTATTTT
CAGGTATGTTCTACACTCCCTTTTTAAATAGGCATTTGTTACCTGAGTAAGTTATTGATA
TGGGATTGCGTAGAATGCATTCTTGGGATACCACCCCCGCAGATACGAATTCCCCCAAAA
TTTCCCTCGAATGCAATTACCACGCGACGCAGAAGCGAGCGACCAAAAAAAAACCGACGA
ACGGACTCGACCGATTAGTGTTCCTTCGAGAGTGTGCGTGCGTATTTGTGTGTGTTGGCA
AGCGCCTCGAGTGCGCCTGTGTGTGTGCGTGTGCCACACTGTTCTATGGGGCACTATAGC
GAACTATGTGTAAAGTTGTTGCCATGCTCGTTGACTTCGTTGGCTGCAATTGCAATTGCG
TAGAGAGGCTCTCCGCAGACACTCGAGGTTATTGAACGGCAGCGACCTCACTTTGCATCG
CACTCACATCGAGGCACATGTCCACACACACACACACACACACACACGCACAAACACACA
TGCAAGCCAACACACATTAGATTGCTGGGCAATTTTCTTGTTGCTCTTGTCGGGCAAACG
CAATTTATAAATTAATCAAATAAATTATTGCCATTGGACAAGCACTGTCCGCGCTTGTGA
TAATCTTGTTGGCCACAAAGCATTTCGGTTCACTTCGATAATGTGGCGCAACGTTCTCGA
AATTTTTCGAAAACTTTGCCTTTTCGCCCACTTGTAGCGCGATTATGAGCGGTTTGGGTT
TGGGCCGAAAAGTAGACTGGTTAAGGGGCACTTACATGTATTTGGTTAAAAATAAGCAAC
TTATTATTGCTTAACACGTTGGAAAAATGTACAGGCACCATCTGGACTTACAAGTCCAAA
TCGCTTGACCAAAACAATGTTGGTCATTTAAATTTTAAACATTAAAGTGATCATAAAATG
TAATATTTCTTAAATATTATATTCATCTTATGTGACCATAAAACATGGAAATATTTCCTA
ACAAATCACACTCATTTAATCAGTTACCCATTGTTTCTCAACCGAATTTTTTGTTGGACC
GACCGAATTTGATTAATTACATATAATTTGCTCAGACACCGAAATCTCGTCGATAAAGAT
CGAATCTCGATGAACGGCTATGCAGCTAAAATTACTATATTCCCAACTGCCTAGAACTCT
GAACTCAATATTTCAATTATAGACCGTAATCAACTCAAGCCACGCCCACTTCCTGCAGTG
AGAATTTGCTTTTTGCATCGGCAGCGGCTGTCTCTCACATACATGACTCAATATTGAAAA
TAATTTGCAATGACTTTTGTCATAAATTGTTCAAAGCTGTTGCATAATCCAAGTCAGAGC
TGCAGCTGTGCGCTCGTACACATGGAGAAAAATATGAGAACTTTTTTAAAAGTGACCTTA
TTAAATGAAAGTAACCATAACTACGTTTTAAAGTGCCATCCTATAGGAAGATAAATTTTA
TTGAATTACAAAATATTATTACTTGAAACTCATTATTAACTAAAATCCTAAAAATTAAAC
AAATTAAATTTGGAGTTGTCTTATACATTTCTTTAGACATGGTGTGGTAATCAATAGTTT
TTCGTATATGCGATCAACGATCAAAATCGAATTTCAATTGTATTTTTCTCCAAGTGTAAG
CATTTAAAGCGCCCACTTAGTCGAGTGAGATGGCGATAGTGATCTCAATGCGTTGCAACT
GAAACAAAATCAAATCACACTCGAAAAAAAATCACAAAAAAAGCGACGCACGCCCAAATA
CAGCACGTGAGCTTACATTTTGGCTGGTTTTGATCATTTTTGGAAGCCTGCATTTCGGGT
GAGTCATTAAAAGAGCCGCCAACAGCAATGAAGAATTTATATGACAGCAAAGACAGCCGA
AAAAGGCGAAAACAATGATTGAAATTACATTAATACCGGCCATTAAAGAAACCAGAAAGA
GACGGGGCGTGAGTGGGAGTGGGACGAAAGAGTGGTAGACAGGGACGGGTAGAATCAGGG
GCTTTGGCTTCGACTTCGACTTCGTTCAGAGTTCAGTGCACTTTTGGTCAGCTTGAGGCC
GTCATCACCTGATATCCCCGTCTCTCTCCCTCAGCCAGCCTAGCCCCGTCTCTTTCGCTC
TCTGCCAAATGGCAACGACCTGCGCAGAACTGCAGTTAGATTCGCACTGCTGCTGCTGCT
GCTGCTGCTGCTGCTGTTGCAGTCGCACGCAAAAGACCTTGCCTCTCTCTTTTTTTTTCG
TGGGTCTCCGAAACGGGTTTCATGCCCCATGTGCGAGTGTTTGGTCAACTGTTTTAATAT
TTGCCGCAATTGCCTGACTTGTCTTGGATTAGATTTGAGCTGTTCGGCATTATTGTTTTT
CTATTTTTTTGTGTATATATGATTACCTTTGTTTGCCAGCTACCAGACCCAAATAACAAT
CGCGCAATAATGCTAGATAATTGTTTTGAGCGCCGAAAAGTGTTTCCACTTGCGTCAATT
GCGGACGGGTTGGCCAAAAATTGGGTAATGAGGCAGTTTTGATGGGGTAGCTTTAAATTC
ATTTTGCTAAACAAAATGCTTAGTTGTGCTGTCGTTCAGAAGCAATCAAAATAATCATCA
CACCTACTAATTCATTTCAATGACTGTCCTCTTAGAGAATTTTGTAAACCATTTAAATTT
GGTCTACTCACAACAATAAAGAAAATATAGAATGATATTCTGTTTTTTTTTTTTTTAATT
ACGATGATAAAAAGTTACATTGAATTTATTCAATTTATTTATTATTGAATTATATAAAGA
AATAACTTGATTTCGCAACCTTATAAATATATCAGCAACCATGGTATCCCAAATTCGAAT
TCAAGCTTAACCAGGCGTGTTCTAATGCTTAGAGCTTAGCTATCGATAGATCGGATCAAA
GGCCAAACCACACAATAGTAATTGCAAAATAATTGCGGCGAGTTCATTGAACTGCTCGCA
CTCGCCGTCTCTTTCGCACGCCGTGACGCACGTCTGAAGGGGAACAGGCAAATAGTAGAT
GGGAGACAAGTACCGAAAAAAATAACAAGTAGTGAGAAAAAACACAGAACTAGCCGCGGG
AGAAGCGGATAATGTGTGGTTATAAATATTCGGATATAAATATGAGAAGCACCGTATGTG
GAGCACCGATGCCCGAAACTTATTTAACAAAAGATGGAGAGATGAACAGGGCACACTTCC
TGTCCTGCCACTCGTGCTTTCTTCCTCTGCGGAATTTATCCTTCAACTTTGGCCAGCTGC
GGTCATTGCTCCAGCTCGGGAGTCCGGAGGCCCCAGAGCTACGGGAGCAGCCAGAGAAAC
GGAGTCACATGACCACCTTCGGGTGGAAAGGCGGGTTGGGCGAAAGGCAAACACTTTCGT
TGCACCCAGAGCGTAACCCCTAAAAATTTTCGTGTATTTCCACAATCAACCCCCGGACCC
GTGCATCCGGTTCGGTTTTTTGCTCGGTTCTCGCTTCGATTCTTGGCCCCAGCTACGAGA
GTTGAACGCACTGAAAGTGGGTCAAAGCAAAACCGAGACACCGCTGAAATCACCCGTACG
CCCAACCACCCACCACCCCCGAAAACACGGGAAAAGTGAAAAGTGGGCTGGGTCTGTGTG
GGCAGCATTCTGTCGTCTGACAGGGCACAGGTGTCTTCCATTTCATTCCATACCATCCCA
TTTCATTCCACAACAGCAGTCCGCTTTTCCCACTGCGGAGAGTGCGCGCCAATTTTTCGC
CTTGAGTTCATTGGCCTGGTTAAAGGACAGAGCTCCACTTCTTCCTCTTCACTATCGCAA
CGAAAGTGTTTGAGTGGAAAACTAATCACTGCAAACTGCAAAAACGGGTAGAGTACGCGT
GGGTTAGGGGCTGCATTGCCTTTGAGTTGTAATGGAGTCCTTTGACGAGATTTTAATCAG
TGAGTCGCTGGATCACCGAGCCCTTTGGTTTGAGCAGGTTTTTGGTTCTAAGCGGTAACT
CTTTAACCTTAAATATCCACATTTATGTAAAAAAATTATATACTCTTTCGTGCTAAAACA
TTTATGGTTATTATAACCCCTGGAAAAGCTTCTGAGTCATCTTGCTTTTGGCCAATTTCT
ATGGCAACCAGGTGGTCGTATAAGCACCTGGCCATTTTGACCAATTAAATGCAATGCATT
TCCTTCCTGAGGTCACTTCCTCTCCGCTTCTTCTTCTTCTTCTTCTTCGCAGAGCGCTCT
TCTCAGCGGGCAACTGTTCCTAGGCACACAAATAGAAACCCCGGCCCCCACATACATAAA
TTGCTTATGCAAAAAATAACCATTTTGCTGAGCGCCAAGTCAGGAGAGGAGAGCGTTCTC
TTTCTTCGATTCCCCACCTCTCTCTCGCTCTCTACTACCGCTCTGTTGATACCATTTTCT
TTAAGGTTATTGCAGTGCAATGTCCTCAATTGTCGGTCGCCTTGGTGTTTTGCTTTTCTC
GTTGCCTTTTTCGGGAGCTCAGATGCTGTCGCAATGTCCCTTGCGCTCGTTCTTTTCCCG
TCTCTTTCTGCTCCTCTATGTGCCTCTCTTTCGGCAGCAGTTGCCCTTCGCTGGCACAAA
ATGTGAAATGTGAAAGGTATTTCCGTTTTATTGTCGTGGCTCCGATTCCGGAGTTCAATA
TTGGTTTATTTTGTTGACTTCTGATTTGTCATCATTTGTGGTTTATTTGCCAGTGTGGGA
ACACATTAAATATGGTTAGCTGGAAATCAAAGGTAATCTGGATTACTTTCGACCACACGA
AATGCCTTAATTATGTTGATTTACGCGCAGGGATTACGACCTAATGAGAAATTATTGATC
TTATAGCCAGTCATAGCCATATATGATACGTATGCCGTGAAGTGTATTGCCCTATAATGA
TTTAAGTTAAATTACATTAAAATATATGTTAAAACGTTATATGTATATATTAATATATAA
ACCATAAAAATTATTTAGCTTTAGAACCATCATATTGTATGTCTTCCTGGCATTTATAGT
GTTCCCCTGTTAGTTCAATAAATCAGGACATGTATTTGATTGGCTATGGTTGTTCTAGAA
TTAACTTAACATGTTCCTGACCACGCAACCCCACCCCCAAAGCCTGCCGCCAAAACCACC
CTCACATACCGCCCCAAATACAAGAACAAATACAAACACAAAGACAGGCTGCAAAAGCAG
CAGAAACAGCAACGTGCCCCACAATAACAACTATTGCAAGGCGACCATGAAGGCAGCGGG
TTGAACGAACTGAGCGCCAGCAGCGCAGCAGCAGAGCCAGCGACTGCAGAAGTGACGTCA
ATGAGCGCGAGGCCACACTGTCACAGTGTACATGTGTTAGTGTGTTCTGTGGGGGAGGAT
TGCAAGTGCAAGCGAGAGGGTGAGAGTACTCCCTTTTTGCCTACGTGCGGCTGACCTCGT
GTTGCTTTTACTACTAGAACATAAGGATAACGCGAGGCAGAGAGGCACAGTGAGAGGCGG
CATTATCCTTGGTGGCTGGGAGCGTTGACCTCTGACCTGAATGGTTGGCCAGGCGCAGGT
CGCACAGTTGTAATTCGAACATAATTTATTTACACATCATTTAACATTTTTGGCAGCGCC
TGTCTCTTTTCACAGTGGTACTTCTTAAGAATATAGATTTCATCGTTTGATTTTGTAATT
TTTAGTTATACTAATAGTATGAAAAGTCTATTGATATTTGTCTTTCGTACAGCTAATATT
TCTGTCCATTTGAACAGAGATGCCGAAATGCCCCCTCGAATTCTCAAAATAGTTCGCATT
AACAATGTTTGCCTGTTAATCTTTCTTTGAATTATGAGCCACTGTCGAATAAACTTCAAG
ACGAGCTTGACGAACGAGCGTTGAATGAACTGCAAGGCGCCATAAAGTTCCGGATCGGAT
TTGAAGTGCCAGTCTGAAGTCTGAAGACCCAGGCACGTGCTAATTGCTGACGCATCGCAT
GAGCTCCCAAAAGGGAAGAAGAAAAGGGGTGGGTGCGGAAGAAACGGGCTGGAAGAAAAG
TGGTCGACGAAGTTCTGAAAGCCCAACAAACGATCGACGTTATGACAGGAGATTAGGTAT
TGTCTGTTTATGTGGCAGTGTGAGTTGTTTTTCAATATGTGTGGGCGGCTGACGCAGCTC
AGAACATAAAAATGGGGAAGAAAGAACAGGGGAAGTGGAGATCAGTCGGGAAGTTTCCAA
ATGGTTTCGGGGAAGTTTGTGGAATGTCTTGTTTATGTTTCAGATATTCAGATATTGATT
AGGGAAACGTATTTTAGTAGAGATCAGTGTGGAATTGAGGCGATAACTTTAATTTTCCTA
TGAAACACCACTTTAAGATCCCTTGATCATTCATTAACCACATAGACACGAAAGTATCTT
GAGCTAATTTCGACACCCATTCAGCCACGATATCGTTCAATTTTCCTTCGTTTTCTCCTG
GCAACCTTAATTGCCAAACATTTTTGGACCTGCTCAACAGCTCTTCTGGGGCGATCGATC
GATCGAATTGATGTCAAGTTCCGACAGTAGCACCCTCCCCAAAGAGAAGAAATACACCCC
AAGCAAAACAAAGAACCGAAACAGAACAGAAATCTTGGTCAAGCACTTTTTGAGGCGGCG
ATCGTGCCAACAGGTAGGCGGTTTCAGCAAAAAACACTGGCAGGAAAATAAACAAAAACG
GCAAGAAACCCCCCGCGGCATAGAACCATTCATGAAAACAACTCGAGCCCACCGAAAAAA
AATTAAAAACAAAAATTAACAACAAATTACAGTAGAAAATATGTGCCAAAGCAGAGCCGA
AAAGAAATTATTTAACAAACAAACAAAGAGTGAATTATAAAATGACGTTGCGGATCGAAA
AAAGGGGGAGGCCACAAAGAGAGTGTGCGATGGGACGGGGGAGCACGTCAGGGAGAACAG
TGGGCAGAGAGAAAGAGAGAGAGCAGGCTATGGGTATGGCTATGTGTGCTTGTCAAAGTG
CTCTCACTTTCTTTTGAAACTTGTTATTCGCTTTGCACGCAGAGTTCATTCACATTTGGC
CACGCCGTGAGAGAGAGAAGCGGAGGGAGTTGGAGTGGCCGAAAGAGAGGGGAAATGGCA
CGGCACAGCTGTTCTCGAAAGTTCCCCAGTAGCCGCGTTCGAAAATGAGCGCAAATCTCT
TAGCACCCCCAACCAAAGTGCAATGACCCCTGATTTGGTAGCTTAGATGGCAGGCTCTGT
TCAGAAATTTGCGAAAAATGTGTGCAAATTTTTAATTGCCAAAGATTTCCTTGAACGCAT
TTCGACAGTTTTATATGCATGTGTGCATACTGAACAACCTCCCCACACCCTCCCCCTTAA
AGCCAGGCCCACCTGAGGTTTCTGTGTCGTTGACCGACCGCCAGAGCTCAAAAATCGCAC
AAATATTTAGATATACATACACCCAAATATATACGTATATATATCTGCCTGAACTGCAGC
GAATTTGCATGCAAAATGCATTGAGAGCACAGCTCGCTCTTTACTTCGTTTCGAGTTCGT
TCGGTTTCGGCCTCTCCGTTCGGCTCTCTCTCGCCATCCCGCTCCCGCACACATTGGACT
CTCTCTCGCAGCTCCACATTCGAAGGTGGCTGACCGAAATGTGGGTCACGACAATGGCGG
GGTTCGTTGAACTGAACCACCGCCGCAGTCGCTGCCGTGCTCGCTGCTCTGCCTCTGCTG
ACGTCGTTAACGTTTTGGGGCTTTCGGTTACGTAGCTCGTGTGCGAGCGAGAGGGGCTAC
TAGAGGGACTGCGACACACAAGTTGTGTGCATTTTTTGGCCCCAAAAAATCACAATGGGC
ACAAAATATTATTTAATACATCACATAATTGTTTAATCATCTGGCTGGAAAATGTGGAGT
TCATTGAACTGCCAGCGACTGACAAATTGCGATTTTCAATGCTGCAAAAATATTTACTCA
AGCAAATTGTTTGCACTTCGTTAATTAGGCGGGGAGTGCCGCCCAAATTGGGTCATATTT
GCAGAGTATCCAAGAAGTTGGAGAAACAGCTGCTCAGACATTTATTTAGCACACACCTAA
ATGTATACATTTGCTACAAAAAAAATTATAAATGTTTACCCTTATATTAATTTTCAAATT
TCTAAATAATCAGTAAATACATTCGAATAGGCTTTTGTAACCGTCACCTAAAAATATCCC
AAATTTACTGCATAATAACACTTTGCACATTTCGAAAATTGGGAGCTTAGCTAACATGCT
ATATCGTCTAAAGAGTCTGACAACTATCGCACAACTTTATCTCAAATATGTATTTCGAAC
TGTTCTGGAAACACACCCCATCCCCTCGGGTTTATCTGACCCCAAAAAGCGTTCGGGAAC
ATCGTTCCAGATCTGAGATCCTCTTAGGCCTGTCATACTCGCTTTGATGGCTCAGCCAGC
CCCCATATCAATTAATCTTATTTGTCACTCATTTATCAAAACATGAGCAAACACAATACG
CGCGCTCGGAATCTATGGGGCACAATCGAGCAGCCCGCCTGTTCTGTTTTGTTATCAAAC
AAAGCTGATCAGTCAGGTGGCAGTGGCAGCACAACTACCTGAGATACCTGAGCTACCTGA
GAAATCAGAGTGTCGCGTGGGTGTTCGAAGAATTGTTTACCAGGCGCCCCCACTGCAGCA
GCAGCAGCAGCAGCGACAATCCCCGCAACAACATCTATTGTTAGACGCTGGCTTCGCTGT
CGACGCTTTGGAGTGAACGTCCTCAGTTGGCACACAAAAACAAAAACACAAAACGACAGC
AACAACATCGGTGGGGGGAGTACGAGCGGGATGGGGGTAATGGGGGGCACCGGGGGAGTG
GAGGCCGAGAGAGCGAGAGAGCGACCCGAAGCAACACAACACCAACACGAGGCCCAAAAA
GACACTTCGGCTGGGTTCAGCTCGTGTTGCTCTGGGTCGTTTTGTATTGCTGGTGGACGC
TGCTTTCATTCGCAAATTGCTCGTCGTTGGCAGCGGTTGTGCAGAGCAAGAAAAGCGCGC
GAAAAACCAAGCAAAAAATTAATACAGCTGGATCAAGCGAAAGAGATAGAGAGCAGAGTC
AACAGCAACAAATGTTCAATAGCAAATGATATCGCATATTTTTGTTGGTGCCAGTGAAGT
GAGATCAAAGTGAAGTGTGCAATGTTCCTTATTAGCAAATCGTAGAGCAACCAACAATCG
AGAGTTCAAGTGTCATTTCGAAGCCAAAAAGCAAAATCTCTAATTCAAATATGGTTTGTG
CAATGCAAGAGGTTGCTGCCGTGCAGCATCAGCAGCAGCAACAGCAACTCCAGTTGCCCC
AGCAGCAACAGCAGCAGCAGCAGACAACACAGCAGCAACATGCAACAACTATAGTGCTGC
TGACGGGCAATGGCGGCGGTAATCTGCACATTGTCGCCACACCGCAACAGCATCAGCCGA
TGCATCAGCTCCACCATCAGCATCAGCATCAGCATCAGCACCAGCAGCAGGCCAAGAGCC
AACAGCTGAAGCAACAACACTCGGCGCTGGTCAAGTTGCTGGAGTCGGCGCCCATCAAGC
AGCAACAGCAGACGCCCAAGCAAATTGTTTACCTGCAGCAGCAGCAGCAGCAACCGCAAC
GCAAAAGACTGAAAAACGAAGCAGCAATCGTACAACAGCAACAACAAACACCTGCAACAC
TAGTAAAGACAACAACCACCAGCAACAGCAACAGCAACAACACCCAGACAACAAATAGTA
TTAGTCAGCAGCAACAGCAGCATCAGATTGTGTTGCAGCACCAGCAGCCAGCCGCGGCAG
CAACACCAAAGCCATGTGCCGATCTGAGCGCCAAAAATGACAGCGAGTCGGGCATCGACG
AGGACTCCCCCAACAGCGATGAGGATTGCCCCAATGCCAACCCGGCGGGCACATCGCTCG
AGGACAGCAGCTACGAGCAGTATCAGTGCCCCTGGAAGAAGATACGCTATGCGCGTGAGC
TCAAGCAGCGCGAGTTGGAGCAGCAGCAGACCACCGGAGGCAGCAACGCGCAGCAGCAAG
TCGAGGCGAAGCCAGCTGCAATACCCACCAGCAACATCAAGCAGCTGCACTGTGATAGTC
CCTTTTCGGCGCAGACCCACAAGGAAATCGCCAATCTCCTGCGCCAACAGTCCCAGCAAC
AACAGGTTGTGGCCACGCAGCAGCAGCAGCAACAGCAGCAGCAGCACCAGCACCAGCAAC
AACGAAGGGATAGCTCCGACAGCAACTGCTCGCTGATGAGCAACTCGAGCAACTCCAGTG
CGGGCAATTGTTGCACCTGCAACGCTGGCGACGACCAGCAGCTGGAGGAGATGGACGAGG
CCCACGATTCGGGCTGCGACGATGAACTTTGCGAGCAGCATCACCAGCGACTGGACTCCT
CCCAACTGAATTACCTGTGCCAGAAGTTCGATGAGAAACTGGACACGGCGCTGAGCAACA
GCAGCGCCAACACGGGGAGGAACACGCCAGCTGTAACAGCTAACGAAGATGCCGATGTAG
GTTTAGAGAGTGGGAATTATAGCTTAGTTTAGCTTACTTTTAGACATCTAATAGGCCACC
CCTATACATTTATCTTTACCAACATTGATGTTTATAAGTGGCTAATTTGTTCTATTTTTT
CAATCGTTTCAGGGATTCTTCCGCCGCTCCATCCAGCAAAAGATCCAGTATCGCCCGTGC
ACCAAGAATCAGCAGTGCAGCATTCTGCGCATCAATCGCAATCGTTGTCAATATTGCCGC
CTGAAAAAGTGCATTGCCGTGGGCATGAGTCGCGATGGTGAGTACCTTGGGTTCTTTTCT
ATGCAAATATCAAATAAGGGAGTGGGACTGATAGAACGGGCCAAATTAAATCAAGCTCAA
ACCAATGCTAGCAGTCACATTTGCACGATGGGAGCCGACTGGCACACGAAGTGCCTTCGG
CTGCTCGGAGTTCAATGACCAGCCGTGAACGAAATGAGTATGAGTGTGAGTGTGAGTCTG
AGTATGAATGTGGCGGCTGTATTGCAACATTTCGCTTGGCGCGATTTCATGGCAAAGTAA
AAGTTGTCTATTTTGTTAAAACAATTTCCCCGAGCAACAACAAAAACCACCCGCATGATA
AATTGAGAGCAGGCTGTCGGCGAGAAGTGTGCGCCATTTCGAAATGGTGTTAAAAGTTGA
ATGAACGCACTTAACCCAAATCCATAATGGAGACAGCAGAGCGAGGCCATCGCGTCTCTC
GCGCTATCGCCATCTCTCTCCTTCTGGGCTCTCCTCTCTCTCTGTCGCTCTTTTCGTTAC
GCTGACTGCATTTGTTATTATTGAGTTTTGTAATAATTTGTTTAAATTAAGCTCACAGCC
CGGAAAATATTTACAGGAAATAGCCAGCGATTATGAAAGCACATCACACACACACGCACA
CAAACACACTCAAACTCTCTCGCACTCTCTTTTCCACGTTCATTGACTTCTCGCTGGGCG
GCCATGTTTGCTGTTTGCAGTGAAAACGAAAACGAAAGTGGTTCATGCGTGTGTGTGTGT
GTGTGTGAGGGAGAAAGATGGGGATAGAGCGGCAAAGGGAGACGGGGATACGCTGTTTTG
TAGGCAGCACGCAGACGCGGCCTTTGTGTAAAATATGTAGTATTTGTTGGTGCCTTCGAT
GTTGTAATTGATGGATTAGATTTTGATATTTTTCGAATGTGGAGCGCGCGTGTGAGGCAA
TGGGAATGTAAAAAATAGGCAGACACAAAATAATAAGCTATTTACATCATTATTGTGCTT
AGTATATGTTTGTCAAATTGTATTAATCAGCAAAGCTTATTGTCTATAAGGAGCCACAAC
GCCTGATTATTTTCATATTTTTCCCAAATCATCCCCTCATTAATGTTGACTACTAGTTTT
ATGCTTTTGCTTACCACCACCAAACATTAATGGGCTATGCTGTCACCATTTAAATGCCAT
CGTTAATTAGCCACTAACCTAGAGCTGAGCGCAATAATTTTTTAGCAAATCCTTGAACTA
GTTCTGCGCCTAGAGCAACCTAAAGCTGGTGCCAAAAATAAGTCATGTGAACCGAGCAAA
AATTCGACCGTCAACCAAATAAACAGCAAACTCGAACTCGGCAACAGCAATGAAATGAAA
TGAAATGAAATCGAAAAAATGAAAGAAAAACAAAGAGAAAAGGCAAACCAACAAATTTCG
AATTGTTTATAATAAAAATGACCGTGTGCTATTTAAGCGACGGCGACTGCGCTGCCGGTT
GCCTTATCTTTCAAGGAAAATTAAAATAAAACGCACACACCAAAAACACAAAACTAAAAA
AACAAAAAAACACAAAAAAAACATCGAGGGCCGCTGATGAACAATTTACAGTTATAAAAC
AAGAGCGACTGACCTAGAAAACGCCACGAAATAATAATTTATTTTTTGTTTATTAAAAAT
CACGAAGAAGACGTTGCATACTTTCACTTTTTGGAAAAAACCAAACCAAACCAAAAAAAA
AAAACTTGGAATATAATTGGTGGCCATTTCGAAACACTTTCTTTTTCATTTCGTTACATT
TCGCCTGCTTTCATAATTTCTTCGCCAGTAATAGGCGCCATTTTGTTGGCGTTGATGTGG
TTTTCTGTTTTTCTTTTTTGTATTGCAAAGACACGAAAATAACGCAAGAAATGAAAACGA
AACCGAAATTTAGCGCACACAAGCGCCCCCCTTCCCCCCCCCCCCTCGAAAAAGTCAAAT
AAAATACGTCCCAACAACTCAGCTCAGTTCATTGACCGCCGCTGACGTGCAGCGAAACTG
GGTCACCATTGGCAGCGCAGCAGCAGCGCAGTCGCACGGCAGTGAAGGTGGTTGCGTCTG
TGTGAGTGACTCGTATCTGTGTGAGCGCCGATAGTAAACAGCGTACAATGTGCACAACAT
AGTGCAACACTCGTCGTCGTCGCTCAATTTCGCTGCTCATTTTGCATTTGATTTGGCGGA
TTTGCTTCGAAATTTATTAGTTCGCCGTGGGCTGGCCAAAAAAAAAAAAAGAAAAAAAAG
TGGAAACAATAAATCGTTGGATTTTTCTCGCCATACGCGCATATTCCATATATATTGTAT
TTATTTGTGGTCGCCGTGCTTTTCCTTACTAGCCGAGGCACATGCACATGCACACATGCT
GGCTTTTAATTGAAATGAACTTAAATTAGCGCGAGGTTAGGCAAATTGAAAGTAAATATG
CGACACGAACGAGTATCGCGATAAAGCCCGCGAAAAAAAGAGGGGTGGAGGTCGATCGAA
ATATGCTTGGAGATTAGCCGAATAGCAAATATAACTAACTAGCTATGCTACTGTATTTTA
TATCTCTTGTACATATATCTCCCGATCAAATCGCTGCCTGGCAACTAAGCGTGAAGCACA
TAGATAACCGCACCTAGCCAGCTACCAACATGCACAGCAGCAGCAATTAGTTGCTGGTGT
GTCCGTCGTCCCAAAGGCACATAAAATAATCAAACAATTGTCAATTATCGAAGGCATAGC
ATTTTTTCCATATAGACACACATAAATATATACATATATATATAAGCGAGCAACTACGAC
ACGCTCGTTGTTGCTGTTGTTGTCGCAATCATTATTATTTTGAGGCTACACACACACACA
CACACATAGCAGCAATGGCAACAGCATGCATGTAGATTTCGCCTTGCCTCGCCGCTGCGA
GTGTTTTGAACTTTATTCAGGTCAATTACAAATACATTAAAGTGCCAGTGCTACACACAG
ATACTCATGGCAAGCTGTTGACTAAAATAATATTGGAGGCTACACAAAATTTACAATAAC
AACGAGAACAAGGCGGACAAGGAGACCAGAGACCAGAGACCAGATACTAGAGACCAGAGA
CCGAAAGGCAAGGGGTTGGGCCTTTGGTAGGAGTTAAACACTTGGACCAGTTCAAGGAGC
CTTCGACTCGGCTCATGAGAGTGGGCGCGTTAGTGGGCGGCGCTGGAAACAGCTCACAGC
TTCAAGTACAAAATGCTAATGATGACGATGTGGGTGAGGTTCTACATTGAGGTGGTGGGG
TCGGGTACTTTGACTGCACTATTAAGGCGGTGAAGGTTTTTGTGAGGCAATCGAAAAGGT
TGAGCAGACTGGCTAAAGCTAAATAAGTATGCCGAAATAGAGGATCATCTAAAAGCCTAA
TGTATTTGGTATGTTTTTTAATCAAGCCAGTACTTTCTGGTAATTTCTTTGGGTCCAATT
ACTACACTGCTTATACAATTACCTACTATCCATAAGTGAAATCATTTCACGCGTGTCATC
CATCGCCGAAAAAAAAGGGAGGATAAAAGCGGCAGAAAGAGAGCAGCGAAAGAAATGCTT
CAGCAACGGCAGCTGCTTGACAACTTGAGTTTTGGCCGCCTGCTGGCGCTTCTTTTGCTT
GCTTTTTTCTTGGCTTTGGTTACATAAAGTCGTTGCCTGCCTGCCTGCCTTCACCTGCCT
CACAAAAGGCAGCCACAAAAAGTTGTTAACGGTGAAATTGCGAAGAAAAGAGCGCCAAAA
GCAGCGAATCGAAGAAAGAAACGAAACGAAACGCAACGAAACGCTGAGAAAACAAGGCAA
GAGCCAAAAGTGTAGTTGGCTGCCAACGGCGAACGTAACAAACTTGTTTTACACCAGACG
CTGGCGTCGCCTACTACGCAAGCTGAACCTTCAAAAGGTTCATTTACCTCTCGCCACGAA
GAGCGTTCGTCTGGCGGTAGCCGAGCCGAGCTTTGTGCATGCACACATCCATGTATCTGC
ATCTGTATTTTACATATATTTTTTTCCCGGGGAGGAGCGGGCGAAATAAAAAATGTACTT
TCGCTTTTTTCAATGCCTCGGCGCCAAAAACTAGTTTTCCAGCTCTCAAATCCGGAGAGT
TGCTCCGAGAGAGCAGCGTTGCAGCAATATTGCTGCTGCTGCAGTTGCTGTTGCAGTTGC
TGCTGCTGCTGCTGCTGCTCTTGGTGTTGCCGCTGTCGCTGCTGCTGCTGCTGCTTCTGC
TGCTGTTGCTGGTTTTGGGCCACAGTTAAGCGAGCGACCGAGCCGCAGAGTTCAACGACT
CTTGTAAAATTTCTCGAAGGTTTCGCATTGCAACATCCAGCGGCGAGCAGTCGCAACTTG
TTCGAAGTCGGAGCTGCATTTGCATGCCGTCTCTCTCTCTCTCTGTCTCTCTCTCTGCCA
GCATACGAGTATGCCCCTCTCTTTCGCGTATGTGCTGAATGCTGTTCATTGCACTCGGCC
TCGTTTCGTTTCGTTCGGCTGCAATTTTTGCACGACGTCAGAGGCTGAGCGAAACGCGAA
TGTTTCAAACTGCTGCTGCTTGGGGCACCGGGCACGGGGGCTTGCAGTTTGTCGCCGAGT
GCAGCGACTTCTATTTGGGTCAGGCACGGTCATTCGCCTCTGCCGCAGCGACGACTGCGA
CGGCATTGGCGCGCATTTATTCGAAAATGATTAGACACGAAATGGAATTATTTTTGCGTA
TGCGTTTGAAGTCCGTTCGCTTGAAATGCGCGTAGATGCAGATCAGCTTGACCCAATTTC
AATTACGCGCGCAGGGAGGGGAGGGGATTATAATTTCTGAACTTGTAAACAAGTTGGCTG
TGTTTACTGGGCGTTTTTCGGGGCGAAATTGTAAAGGTCAGGGGAATGGAAAGGAAAGGT
ATATTATAATGGAAAATATACTTATATATTATAATAATTCTGCCCTGAGCTATTTTTCGA
TAGCGTTTAATATATTTTATATAGAATAAGTATCGGGTAATTAGTATGTACTGTGCCCAA
ATTAGCCTCACAATGCAATAAACAAAACAAAAAATCATTTAAATGCGCCTGCTTTTGTGT
GCCTTTTGTTTGATTTTCGCCTGTTGTTCGCGCGGCGCGTCATCGATGAGAAATGAAACC
AGGCACGACCTTTTCATGTAAAATTAATAATATGGCACAGGGTCTACTCTACCCTGAGCA
ATCCGAGCGATGTCAAGTGCTATGCGCCATATGCTATGCGCTATAGGCGGCGACCTCCCC
GACGATTTTCATTGAGGCATTTTTCATGACCCACAAAAACCGACGACAACGAAGGCTCCA
AACCGAAAATAAAACTAAAATGCTTGCCTATGCGGGGGCTTTCTTTGTCTTGAGAAATTT
CGAGAAACTTCAAAACAAACGCATGATGGCTTCGTTATTATTATTAATTTTATTATTTGG
GGTTCACTTTTCGGCCCCTTTCTTTGGCATATCATTTCATTTGTGAGTGCGCCCCCTTTG
TTTGTCCGTGCGGCTCTTTCCACACGCTTCGATCGCGTTGTAAACAACTTACGCAAGCAA
ACCAAAAACCAAGAAACCAAAGCAACAACAATTGTGTCGCTTATGTGACTTTACGTAAAG
CCATCCAGAGGTGTCTGTGAATCACCTTCTTCCCCATTCCCCTTGCCACAACCAACAGCC
CCCAACCGAAAGTAGGCCTAACCCTCCGCACACTTTTCGTCTTTCTCCGCTCGGTGGGTG
CAATGAACTCGAGTGTCTCGTAAACAACAAGTTTGGTTTTCGGCTTTCGTTTATTATTTC
CCCGTAATTCAGGAAGTCAGCCGCGCAAATGCCCAAACAGTAACAAGAAATCATAAACAA
CTCGCGTTTAGAAAGCAACTTGATACAAGGCACTTGGGATGGCACGGCGCTAAATGGGAC
TGACGTCGCGACTTGTCGCAGTGAAAGTGAAACTTGTAAATTGGCTTTTAATTGCCGACA
TTATTGTGAATGTCAATTATGACCGCAGCGACGCTATCGAACTGGTTTCAGTTCGAGACG
CAGAAGACTCTTATATAAGTTTTGCATTGTAAATGAAAGATGAGAAATTAAGAAATTGAG
ATGCCCGTTGAGCTTACTATATTCCTATCTACACGAACTAGAAATGATAAGTAAATTATG
TTTCAAACAACGAACTTACAGTTTGAGCATGGCGAAACATTGGATGTAATTATAAATAAG
CCCATTAAATTACCAGCCTGTTATCACATCGCAATTTTCATTTTTTCATTTTTGTTTAAT
TTTTGGGGCCACCTTCGCCCCACTGGTATCCAGTTGTCTCGACGCCCTTCCGCCTTTTCG
TGTATTCGGTGTTTAGCCCCAATCTTCGGGGCGTTATGCAACCATTATAGGCCTACCTAA
AACTGTTGACCAATCCAGTTGCTTGCATTTCCACGGCACGCACGAAAATTTCTACCCGAA
AAAGAGCCAAACAACTTTCACTTTTACTTTCGTCGCATCGCCGGAATGATTATTAAATGT
TGCTCGTTGTTCGTTACGTTTTTGTGGCCTTATTCGGGCCGCTCAGTTCATTGACCAGTG
TGCTGGGGTAAACCGAACCGACTCGATGACAAAGCCAGAGTTTGAATAAACAAACAATCT
GGAACACTCACGTCAGTTGGCGATGATCGCCCCAATGAGTCAGCTATGAAAGCAGAAAAA
ATATCTGCATTTAAATGCATACTCAATGCTTAACCCTCAGCTAGCAGACGGGGCCAGTGG
CGTCGTAAATTATCCACTCAGGCGCGAAGTCATCAAGCTTGATTTAACAATCTCATTACT
GGCCTCAGCCTCCATCCTAGATTTTCCACCTGCCAACGAGACGTATGCGCAATGTTCAAC
TCACATCACTCATACGCAGTGTGTATAATGACAGTGTGCAAAATATTCAAATTACAAGTG
CGAAAAAAGCTTGCCGAAAGCTTGCATATGCTCCCCCGTGGTGAAAAGCTTTGCCAAGCT
TAAGAGCTCTAAAGAGAGTCAGTGCTGCTCTTAAATTTTCTCTCCGAGTGTGTTGAACTT
TCCTGCCGCAGTAAAAGAGATATATGCGCCGATAAAAAAGATGAAGAAGAGCTGTTGGGG
CAAGCTTATCACATAAAGCTTATCAGCGCTTGAACTTGCTTTGTGTGTGGGGTGGGTCAT
TGTTTCTATATATTAAAGAGCAATTAGAAGCAATGTGGGTATTAAAAAATATGAATGGAA
AAAGACATATTATATTTAAAAAAAATTTTAATTTAAACGTTGTGCAAAAGAGATGTGACA
TAAATAAGCACAAAAAAATATTAAAGTATTAAATATTAAATTCTTAAAGAATTTATTGCT
ATAAATTTAGAATTAACTTTAGATATTTGAAGAACTTCACATCTTATCAACAATAAAAAA
ACAAAGACTGACAAAGAGCTTTTTCCACTCTTAAGTCCTCTCTTCGGCTCTCTTTCGACT
GCTCCGTTGGTCGTTGCCTCTGCGGCTTTTGTGTTGTTTTGTGCGGCGTTTTCAGTTTTC
CGTTTCTGTTTTGAGACCGAAGCTCAGTCACCGTCGCAGTCGCAGCAGTTGAGGTTCGCT
CTCCTCGATTTCGGGCAAATCCGATACCATATAGCACAGCGTACCGCACTCTGGGTATAT
TCGTAACGCGCTTTGGCTTTTACAGTTAGTCGCGTTCGAGACCTTGTCGAGTTTTGTCAT
GTTAGCCAGCGATCCGCGGGATCCGAAATAAGCCAAGAATCACAACGCGAGTGCGGCAGT
TGCCAGCAGTAACTACACCAATATTTATATTAATTAAAATAAATTAAATGAAACAACATG
CTGATTAATGCCAATGAATGTTAAATGCAATTGTTAATGTGAAGAAAAGTCGACCAAGTC
TCCCCAAAACAACACTTATTCAACATCCACTACACACTCGCCTTTCTGGATTACGCGCCC
AAAAAAAAACAAAAATTAAAAATTAAACCAAACCAACAACTAATTTATTTGCTAAATATT
CCAAAAATTCAATCAATGTGAAAAGCAAGCAAACAAAGTTCCTCTCACAACAAAACAGCA
GTTAATTAAAATATCTAACCGAGATAAAGTGCAAAGAAGATAACAAGTTTCTCAAGCAAA
CATCCATATGTACCTGAGTACCAACCAAAAAGCTGTGTGTGTGCCAAAAACCGAAGAGGA
ATTATCCAAAAATATTTAATGAGCAAGCTCAACTGAGTGGTTGATGTGCCCCCCAAGGGA
AAAGTGACCAAGTCAAGATATTTTGTCAAATCGAACACAGAAAACACAAAAATGGGCGAA
GAACTCCCGATATTGAAGGGCATACTTAAAGGCAACGTCAACTATCACAATGCGCGTAAG
TTATCCGATCCGAAAGTCGCACAAAAGTTGAAGTTAGAAAGTGAAAGAGCCAAACACCAA
TTTCCCTAAGCCAACTGACACAGATTTGGCCAGAAAAAGGGTTGAACAAGATTAAAATAA
CACCCAGCTTTCGGTTTTCAAAAAAATCAAGTCGACCAAACTGGCAGAGAAATGCAGGCG
TTCTGAGATTCTCCACTTTTGATTCGCTTTTTGTTTACCTTTTTTTTTTTCTTGTCGATG
CCTCCAAACAAATAGCATCAACCAAAAAGCGAGCGCCATTGAAGTGTTGACCTCGTTTAA
AAACATACAATAATTTTTTCTTTGCCGCGGAAGAGCTTTAAACTTGAATCGAAACTGCGG
CGAAGGCAGCGTTGCGTTGCTATTTTCTAAATGAAAAAAAAAATAGGAAAAAAACAACAA
GAAAAAGAGCCGAAAGAGCGGAGCAACAATATCGCATGTTTGACCAACTTTTTCAGTCTC
TCCGCATGGGAAAGTTGGACGTTGCGGCGCGTCGCTCTAATTTCTACGCGCAGTTCGTCG
CTGCGCCTGCGCAGACTTCATTTTCCATTTCGTTTGACCTGGATTTCGCTGCACGGCAAG
TGGGTCACACTCTCTCGCTGGCTGCTGGAAAAAGCGGTGAAAAATCAGTTAAAGAGCCGC
TGTTTCACTTTTGCGACCGAGCCGGAGTGAAACTGTGCGAGTGAAAATTTCTTTTGACAT
TGAAAAGTTGGCCAAACATTTGTCAGATTTTGTTTAATGCTCCGCAAATGGCCAGGGGCT
AAAGTGGGACTCAAGGAAATTAATGTAGTAGAAGTGCTCTAAATGGGCTTATAATAAATG
AATACATCATAAGTTAAGTAGGTCTTAGTCTCCCTCGATCGCCTGCAAACCCAATTAGCC
AGCCCACAGATCGACCGACATTATCGATGCCTTTCATCTGCACTCCCCTTTGATTTATTC
CTAGTGCGAAAAACGTGACCGCAAATGTGCCTGGTTTTTTTTCTTCTCTCGTTGGTGAAA
TGTGAAAGTTCACCCACATACAAATTTTTCGGTTGCAGCCAAAGGCAGAAATTAAAAATC
TAAAAAAAGAGAAAGTGTAACAGGGGAGAGAAGACTGAACACCGAAGACTGACAGACTGA
AGAAACACAGAAACGCAGAGGCAGCTGAGGCATTGACCCACTTCGAAGGGCTGTAAATAT
GGCAGGGGAAGACGGGGCACTTCCTGCGTGACAACAGGACAACAGCTGTACGTTGCACCT
GCTACGCAATGCAGTGAAGTGTGTAATTGATGGGGCCCATAATTTTATGCTCAAGTTTAG
GTTTAAGCACCGCTTACAAGGCCGAAAACTAACCGAATGTGTCCTTTTTCCAATTGCAGC
TGTGCGTTTTGGACGCGTGCCGAAGCGCGAAAAGGCGCGTATCCTGGCGGCCATGCAACA
GAGCACCCAGAATCGCGGCCAGCAGCGAGCCCTCGCCACCGAGCTGGATGACCAGCCACG
CCTCCTCGCCGCCGTGCTGCGCGCCCACCTCGAGACCTGTGAGTTCACCAAGGAGAAGGT
CTCGGCGATGCGGCAGCGGGCGCGGGATTGCCCCTCCTACTCCATGCCCACACTTCTGGT
AAGTCTCACCCTAAGTTCCCAAAGTGGGAAATATAGATAGAAAATGTAAGAAACTATAAT
AGGATATTGTCAGATTTTTAGCGTGAGCAGCAAATCATTACAATATTATGGTTTTTTTTT
TTAATTTATTACCATCCGGTCAAGTAGAACAAACAAGCATATATTGTGGAGATTTTACAA
CTCCATTTACAGAGACAATCATAAATAACCATTGGCCATAAAATTATGAAAATGTCTAGC
AGCTGCCCTATGTAGACAATCAGTACGTTATTAATTGACCGCCAAAGGTTACGGCGTAGG
CGAAGTCACATTTCCGGGCCGCCGACTTCTGTTGACATGCATAGATCAGCAAAACAATAT
CAACTAGCTAGTAACTGCTTTTTGCCTTTTGCTCACTAGCAACTGGCAACTGGCAACTTG
GCTTACTGGTTACTGCCTACTGCCGGCGTTAGTCATGCGCCAAGGTGAACCTGTTTGCAC
GATTCTAAACCAGGAAATCGAGCGCCACACGTAGACGCGTCTACGAGCCACTCTTTTCAG
AGTCTTCGCTCTTCGGCGATTCTTGCGGGGCCTCCAAACGTGGCCATTGAAGTGGCAAGT
TTGGGGTCAAGTTCTTGACGAAAAGCTTGTCAATGTCAGATTTATGACGTTTCCCCTGAC
AGCTAAATGATGAATGCTATGAATGCTAGCTATCGTTTATTTCTGTGATTACTTTGTAAA
TTCCATAAAGTGTTTATTTTACAATCGACGTCACTTGGTTTTTTTTTTTTTGTGGCCAAA
TAGATCGTGGTGGAGAATAGAGGAAGTACAGATTCGGCGCTGTAAATAATAGCCCAAAAA
AATCATTTCACATACCATAACCAAAAGCGATAAAGAAAAGTGCTATATAACAAAAAAAAA
ACGTGTCCCGGCTCTCGGCAACAACAAAGTACGCAAACAAAGTTCTAAAGCTCAAGGTCA
AGCGTAGCGTCATTATTAATGAAAGCACACACACACAAGCATCGGCTGCTATCACGGTGG
GAAAGAGAGGGATAGCACAGGATTAGAGAGAGACCAAGCGAGCTGGCCAGACACATGCGT
TGTCCATTTAAATAAATTATTATTAAAATATTTAAAAGCGACACGAGCACAACGAAAAAT
GGGAAAAACATTGGCACAAAGTCAGAGTCAAGTGCAAGGCTAAAAAAGTTAAAATTTGAT
TTGGTGTTTGGGGAGGAAAGAAAGGAAATCAAATGCGATCGACAAGTTTAAGAAGTACTA
TGTGTAGTATAGAACAGCGACCTTGGAGCAAGTTATTTTTTAACCTTGGAGTGAGCGAAA
TGAGCGGATCCGCTTCCCTCTCTTTCTCTGTTTGCAGTTCATATTTTCCACTATATATGA
GTAAACAATAATGGCACAAAAAATATGCATAAAATGTCATGAGTATGAGGAAGCGAATGC
CAGACAAACGGCGTCACAAAACTGCAATACACATATATACATATCTATGTACATGTATGC
ACAGATACAGATACAGTGAGAGCAATCTGTAAAATTGTCAGGTGGTTCATTTAGACAGCG
TCGTAATATGCAAAATGTCAGCAATTCAGTTTATGACGGAAGGCGGAAGATTCGCCGGCG
GTGCAAGGTGAGGCTAAGGCGCTACGATCTCGGTGAAATTCGGAATTCGGAACCGAAATA
GAAATTCCTCTAGCGAAACGATTAGCCCTAAAGATTATTCAATCTGTGGCTGTCCATATC
AGCCGGTACATGAGTTCTGCGAATTATTTTTGGCAAAAACTCAAGGCCACACTAACGCCA
ATTGAAGGTCGAATCGAATCGGATGGGATGTTATGGGATCTTGTGATATGTCAGGAAAGG
CAATTCGGGTAGCGGGAGTCGAGTCATAAATAGCCCCCCCACACAACACACTCATTAGTA
TTTTTCGCAAACTATTTCCGCTTTTGCGCAGATGAGAAATATTTTCGTGGCGGAAAATCA
AATGATACGACGACGTCAAAGCGCCGGCAAAAAGAAAATGTGGCGAAAATCAGTTTGCCG
GTTGCCGGCTGCTATTTTCCCTCTCTCTTTCGTGCGAGCGCGTTTCTATGGCATTCTTTT
TTTTATGTTTCTGCGCGAAGAAAACACATTTTCAAGGTTAATCAAACGAAAATCGAATCA
GAAAAGAGATTCGGCGGCAGACAGCACAACGTGTGCTTATTGAAACAGAACGTAGCAAGT
AAAAAGCGAGAAGCACACATGAAAGAAATCAAACGTAAATTAAAATCCAAGTCGCTGAAA
ACAATGGTGGGCAGATGATGATGATAGATGGCACGGGGAGGGGGTGGTTGGGCGTGGGGT
GGCACGTTCGCTGTCTGGGGCACTTGGCGCATGTTCGTGTAACTCAAAACCCGGAAAGCC
AAATGGCGAAATAACATGCACATTCGCTCGGCTTAGACGCTGAGCAATTCCCACACCCCG
CCCCTTTTTTTCCACCTCATTCCGCTGGCGAAATACAAAAAACACGCGTCGAAAGCAGGA
AAAAGAATAACAACCATAGAGTAACAGCACACAATCCGGAACCTTGAACTCTAGTTCGTC
GACCTTGGCTGCTAATGTCAGCGGCAAAAGCTCTCGACTATGGGGGATGTAGCCTACGGA
TGGAGTGGGGTGGGGTGGGGAAAAGCGAGAGAGCAGCCCCTAGAAACTAAAACCACAAAA
ACTAACCCGGCCAGCTGACGTAGGCGAAGCTTTCCCTCTATTTTCTATTTTCTTTTTGCG
CACATTGTGTCGAAAGCTTCCAGCGGCGTTTAAGGAAATGCGACATTCGCAGAGTGAGAG
AGAGAGACGGCAGATAGCTGGCGTGGTGGGCGTGCGGAAGTACAAATAGTTATTATTATT
GATTTAAATGAGTGGGCGGGAGGGGAGGTTCGCTGACCTTCGCGTGTGAAATAAGCGATG
ACGTGATGGGGTGCGGGGAAAAGTACACGGCCAAGCAACAGTTATAGGAAAAGTTGAACA
GTCAGTTCGAACTATAAACAACTTATACGACAGTTACTGCAGTTGTTTTTGATACTTTAA
ATCAATTTATCACCGGTCAGGTATTAGTTTTAAGCACTCTACTATCTTGGCACATCTCTT
TAACACATTACCACCTTTTTTTTCCTATTTCTTCAGGCCTGTCCGCTGAACCCCGCCCCT
GAACTGCAATCGGAGCAGGAGTTCTCGCAGCGTTTCGCCCACGTAATTCGCGGCGTGATC
GACTTTGCCGGCATGATTCCCGGCTTCCAGCTGCTCACCCAGGACGATAAGTTCACGCTC
CTGAAGGCGGGACTCTTCGACGCCCTGTTTGTGCGCCTGATCTGCATGTTTGACTCGTCG
ATAAACTCAATCATCTGTCTAAATGGCCAGGTGATGCGACGGGATGCGATCCAGAACGGA
GCCAATGCCCGCTTCCTGGTGGACTCCACCTTCAATTTCGCGGAGCGCATGAACTCGATG
AACCTGACAGATGCCGAGATAGGCCTGTTCTGCGCCATCGTTCTGATTACGCCGGATCGC
CCCGGTTTGCGCAACCTGGAGCTGATCGAGAAGATGTACTCGCGACTCAAGGGCTGCCTG
CAGTACATTGTCGCCCAGAATAGGCCCGATCAGCCCGAGTTCCTGGCCAAGTTGCTGGAG
ACGATGCCCGATCTGCGCACCCTGAGCACCCTGCACACCGAGAAACTGGTAGTTTTCCGC
ACCGAGCACAAGGAGCTGCTGCGCCAGCAGATGTGGTCCATGGAGGACGGCAACAACAGC
GATGGCCAGCAGAACAAGTCGCCCTCGGGCAGCTGGGCGGATGCCATGGACGTGGAGGCG
GCCAAGAGTCCGCTTGGCTCGGTATCGAGCACTGAGTCCGCCGACCTGGACTACGGCAGT
CCGAGCAGTTCGCAGCCACAGGGCGTGTCTCTGCCCTCGCCGCCTCAGCAACAGCCCTCG
GCTCTGGCCAGCTCGGCTCCTCTGCTGGCGGCCACCCTCTCCGGAGGATGTCCCCTGCGC
AACCGGGCCAATTCCGGCTCCAGCGGTGACTCCGGAGCAGCTGAGATGGATATCGTTGGC
TCGCACGCACATCTCACCCAGAACGGGCTGACAATCACGCCGATTGTGCGACACCAGCAG
CAGCAACAACAGCAGCAGCAGATCGGTGAGTAATCTTTTATTGAAAAATAGTTATATTGT
AGTATTCTACGCACGTCATAATTGAAAAGTTTTATAATCGGTTGTAGAGATACGATTTCA
CAGTATTTAATTAGAAGCATACACTCTTATTATTCCTCTCATAATTTGAAATTATTTTTC
TTTCTTACAGGAATACTCAATAATGCGCATTCCCGCAACTTGAATGGGGGACACGCGATG
TGCCAGCAACAGCAGCAGCACCCACAACTGCACCACCACTTGACAGCCGGAGCTGCCCGC
TACAGAAAGCTAGATTCGCCCACGGATTCGGGCATTGAGTCGGGCAACGAGAAGAACGAG
TGCAAGGCGGTGAGTTCGGGGGGAAGTTCCTCGTGCTCCAGTCCGCGTTCCAGTGTGGAT
GATGCGCTGGACTGCAGCGATGCCGCCGCCAATCACAATCAGGTGGTGCAGCATCCGCAG
CTGAGTGTGGTGTCCGTGTCACCAGTTCGCTCGCCCCAGCCCTCCACCAGCAGCCATCTG
AAGCGACAGATTGTGGAGGATATGCCCGTGCTGAAGCGCGTGCTGCAGGCTCCCCCTCTG
TACGATACCAACTCGCTGATGGACGAGGCCTACAAGCCGCACAAGAAATTCCGGGCCCTG
CGGCATCGCGAGTTCGAGACCGCCGAGGCGGATGCCAGCAGTTCCACTTCCGGCTCGAAC
AGCCTGAGTGCCGGCAGTCCGCGACAGAGTCCAGTCCCGAACAGTGTGGCCACGCCCCCG
CCATCGGCGGCCAGCGCCGCCGCAGGTAATCCCGCCCAGAGCCAGCTGCACATGCACCTG
ACCCGCAGCAGCCCCAAGGCCTCGATGGCCAGCTCGCACTCGGTGCTGGCCAAGTCTCTC
ATGGCCGAGCCGCGCATGACGCCCGAGCAGATGAAGCGCAGCGATATTATCCAAAACTAC
TTGAAGCGCGAGAACAGCACAGCAGCCAGCAGCACCACCAATGGCGTGGGCAACCGCAGT
CCCAGCAGCAGCTCCACACCGCCGCCATCGGCGGTCCAGAATCAGCAGCGTTGGGGCAGC
AGCTCGGTGATCACCACCACCTGCCAGCAGCGCCAGCAGTCCGTGTCGCCGCACAGCAAC
GGTTCCAGCTCCAGTTCGAGCTCTAGCTCCAGCTCCAGTTCGTCATCCTCCTCCACATCC
TCCAACTGCAGCTCCAGCTCGGCCAGCAGCTGCCAGTATTTCCAGTCGCCGCACTCCACC
AGCAACGGCACCAGTGCACCGGCGAGCTCCAGTTCGGGATCGAACAGCGCCACGCCCCTG
CTGGAACTGCAGGTGGACATTGCTGACTCGGCGCAGCCTCTCAATTTGTCCAAGAAATCG
CCCACGCCGCCGCCCAGCAAGCTGCACGCTCTGGTGGCCGCCGCCAATGCCGTTCAAAGG
TATCCCACATTGTCCGCCGACGTCACAGTGACAGCCTCCAATGGCGGTCCTCCGTCGGCG
GCGGCGAGTCCGGCGCCCAGCAGCAGTCCGCCGGCGAGTGTGGGCTCCCCCAATCCGGGC
CTGAGCGCCGCCGTGCACAAGGTAATGCTGGAGGCGTAAGAGCGGGAGGAGGTAGGTGGT
TTTACGCGGAGAAGTGGGAGAGACAGAGACTGGGAGTGGCAGTTCAGCGAAGCAGGAAGC
AGGATCACTTGGAGCGGCGGGAGTTGAATTAAATTATTTTACCATTTAATTGAGACGTGT
ACAAAGTTTGAAAGCAAAACCAACATGCATGCAATTTAAAACTAATATTTAAAGCAACAA
CAAACAAAACAACTACAAGTTATTAATTTAAAAAACAAACAAACAAACAAACAACAAAAA
ACCCAAGCTTGAATGGTATTACAAAAGAAAAAGAAAAACAGAAAAAATATAAATATATTT
TAGCAGTTAAACTTTAACGTAGCAAGAAACCAACAAACCCAAGGCAGCGCTCTGATTTCG
CATTAACTTTTCTTCAGCTGCTACCGAAAACGCCCCTCACCTCCCCCCCACCCAACCCTT
CCTCCACACACCAACCGTCTTTCGACCCCTGATTGTTTTATAAGTTTTAAGCTCTTGTTG
TACATATTAATTACGTTTATTGGTAACTATGTTTAGCGCTTTAGTTGTAGTTGGAGCAAA
ACTACTTTGCTTTTTTGGATGTTTTTTGAAAAAACTGCAAATTATTATTATTAAATTTTT
AAATACCTAAAAACAAAACAATGTGTGTGAAATTTTTTATTGTGCGATCTCCAAGCAGAA
TTGAAGTGCAGTTTGCAACAAATTTTAACTACGATTAAGTTGATAACGATTCATTTTTTA
TGAATTTAACTAATTTTATGAATTTGTTATAGTTTTCCACCCTTCTATCGATCTTTCTAT
CTGATCATCTAGCTACCCGTATTCCTGATTTCTCCTTTGGCACAAAGCTCTTCTCTATGC
TAAAGAATCAAGTGGAATAAATATTGTTTTCTAATTTTAAAACTACCACAAAAATACGAT
TAAAATATACACGAAGTAATTGAAAATCAAACAAAATGCTTAAAGTTTTAGCAGCAAGCA
GTAAAACGACGATGAAGAAGAGAAACCCAACGTTAAATATATCTGTTGTGTACATAGTTA
AATGTTAAATTAAACACAAAAACATATTTAAAGTACATATAAATACACATAATTATTAAT
GAAGAAACCTATGCTTAAAAGATTCAATGTTTGATTGGCATCTTAGAAAACCAAGCGAAA
AATACAAAAAAAAATCAACAAACAAAAATTATGATATATTATTTAAAAGTAAAGTATACA
TTTACATTACAGAAAAACAAAAGAGAAAACTTGCGGTAGCAACAAAACTATTATATTAAT
TA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2362, 67603..67691, 91092..91236, 100979..101217, 104376..105384, 105550..107241
1015..2362, 67603..67691, 91092..91236, 100979..101217, 104376..105384, 105550..106955
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved