Drosophila_melanogaster Locus Eip74EF
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Eip74EF
Drosophila_melanogaster
Eip74EF
3L
snoRNA:Me28S-A576
54146..54266
61150
GAAGACCACATAGGCAAGCTGCCAAGCTGCCAGCTCTCATGTTTCCATTCTTTATCCTT
TGTTGAACCTTGGGCACGCTTTGTATATTTTATGTGTAATGGAGCCATCAAAGATTCCCT
CTCAAGTCTCACTTTTGTAACCATTTGTTTTTTCAATAAATAGCCGTTTAGTTATCACGC
CACACTAATGACGCATTATATTGGTTAATTTATGAAAGTTAATATATATAGTGAAAAAAC
ATTAATATATTTCAACTTCAAACTTTCACTTAATTCAGGGAAAGAAATTATTATTATTTA
TTATTTATTAGGTTTGTGCTTAAAAATTTTAACAATGAAACATTCGTTCTTTAGTTTTTA
TCCAGCGGTTAAATCAATTAATATAGTTTAAATTGTAAATTAAATAGTTTGACCCTTTTT
TGATCGGATGTACAGCTGTACGTATACGTGATAAACACTTAAGTCAAAAACTCATTTCAA
ACAAAATTTGGTGAGCTTGCAGAACAGGTAAGAAGAAGCTTGCCATTGAATTACGATATT
TTCAATTTAAGTAAGTTTTTGAGTATAAAAGTGAGTATAATGTACTGCTTACTTTTTTGA
GAAAGCAGAATACTTGCTGAATGAGTTTCCGCCGCATTGTAATTGAAATGGATTTAGCGT
TAATCGAACGCAAAGCAATGTTAATATATTTTTTGGCCTTGAAATTAAATAAGGTGTTGT
TGGAAATAAAGTACGCAAAAACAAAAACTATTTCCCACAATTTCGACGTACAGAGGATGC
ACTGTAGCTCCCTACTCTCTTTGGCTCTCCCTGCAATTGCAATTGCATTCCGCTCTCTTA
GCCTCGCTTGCGCTCTCTACGCTAACGAGCTTTGAAGTTCAGAGCGTGAACTTGAGCGTT
TCTCTGCCGTTGTCGTCGCGAGGTGGAGGTGCGCTGGTGTGCGTGAGCGGGTCTCAGTGC
AGCGCAGTGCCTGTGTGCAAAAATACGCTTGTTCGCCGTTTAGTTGTCTTTTGACTGCTG
TAACGGACAGTCGCAAATTTTGCCCCAACTCTGATTCGAGCGATTCGAATGCGAAGAGGA
AAACCTTCGCTTTTCAAACACGCATAACAAAAACCAAACAACAAAACAAATTAGCAGCAA
CAAAAATCAATTGTTCAAACGTAACTGTAACTGCAGCGTTCGCGCCAACCGACAGAACGC
CCGCTCGCCCGCCCGCCCACTTTTCCCGCCCACCGTCGTCGTCGCCGCCGTCGCGTCGCT
AATTAAACGCTTTGCTACCGATCAAAAGTGCAATCCCAAAATATCAAACAAATAAAATGC
GTTACAAAGAGTTCTGAAGCAGCAAAAATCGCGCGAAGAAATCTCGCTGTTCAAGTGGCC
TTAGCGTGATGATTAAAATGTCAATTAATTAATCCAAATATCTGGTGGCATCTGACAGCC
TTTGGTCGGCTTTTCCCGCCCTCCCCTGACCACGCCCCCGCCCCCATAAAGAAAAGTGCC
TGAAAGTTTATACATATTTACACAAGAATTTTAGAAATTAAGTGATAAATCGCAAAGTAA
CTGATAGAAACTTCGAGGCAATAGGGTATATGATTTTTTTCTGCCGTTGCCGGAACATTA
TGGATATATCGCCAATTGGATTACTTTTGCTTGAGATGGTAAGTGACTAATTCCAGAACC
TTGTTTTCCTTTCGACCAGCAGATCGCTCATACGCAGCGTTGCATTCGCCGCGGCAGCGG
AGTTGCCTCGAATGCAGGAAGCGAATGGCGCAAAAAAAAGCTCTCTATTTATTTCGTCAT
CGGTGCACATACATACATTGCACATAGACGCATGTATAGCTACATACTTGAAAGTTCGTG
AAAGTGTTGAAAATTTTAGGAGGAAGAAGATCGGGGTGAAAAGTGGGTGGGAAAAATGCC
TGCGCCTCCAGCGAAAATATCCTTTAATAATAGTTGCTAAAATCTGCAGGATCATTTTGT
GTACTAGAATTATATTATAGAATTAGTACTAATAAAAGCTTTTCTTTGTTAACATATCGA
GTATTTGACATGTTTTCAAAGAAAATGTGCGAAACGCTTGCTTTGTTTACGAGATTGCAT
TATATAAAATATAATATTTTCAATTGGTAATATAGTTTAGGTGGTGTTAAATTTTCTAAC
ACACTTTGCATTGATAAGAGCTCCACACATATCAAACTTGTAGGAATGTCATTATGCATT
ATTAATTTGAAATGACTTGCAAACTTTTTCAATAAGAATACATATTTAATTGTATCGTTT
TTTTCCATTTTTAAGCAATTAAGATATGAATCTAAAAATTGTAATGCATTACATTACAGT
GCAATAATTGAAATAAATATTTGGTCATGCACATTTTCCCACTACCCTTTTATTTATTTT
TAATGCGGGCATGACTAATCCCAGAATTGAGGAAAAAAAAACCAAATTCGCTGAATTTCA
ATTTGGCAAGAAAACTTTTTGCATGTTTGATTTTGGATAATCCCCGCCCTTCTAGAATTT
CACAGCCCAAAGCGCTGGCCCAGTTAAGACTTGAGTTTGGGTTTTAGCCAATTAACAGAA
TTCGATACAAAGTGAAGAAGCGATCAATAAAAGCGCCAGCCACAGCAAATAAATTATATT
TTGCTATTTTATTACGTTTTTTGTAAATGCTACATGTCAATCCGTTTCGTTTTTCTACTC
AATTTGGTTAACCACAAGCTGAGATAAAAAACCTATTCAGATTTGCAAGTCAAAGTTAGG
CGATCGGCCTTCGAAGGGGGCAATAAATAATACTGCCTGACCTGAGGGCCCTGAAAATAC
GTACTTCCTAAAATTTATTCCATTTGCCGCTGAGCAACAGAATCACTGACCAACCTCACC
AAACATTGCCATTCCCCCATTCCCATTTGCCAAAAATAAAACCAAAACAAGGAACAAAAA
TATTTGAAAACAAAATCCAAATGGGATTTGCCAAACAAACGCGATAGCCCTCTGCTGATA
AGAAAGTTTCGAGTAGAGCGCTGGCTCAAAATTAATTTGGATTCTTCACTAAATCAAAGA
TAATCCCAATTTAGTAGCTACAAAAATAAAGTTAAAAGTAAAGTTCTACCAAAACTATCT
TAATGTGATATGGAGCGAGGGAGAGCGCAGATAGAGAGAACGAGATAGTGATCGTCGGAG
AGGAGAGTGGAGTGTGGAGAGGGACGGGTCGAAAACGTTTGCAAAGGCAATGAACGCGAG
CTTTTGGCGTTTTCTTCCGATAACGGGCACTACGTACACAGCACACGCACACCAACAAAC
CCTCGAATATCAATAGACACAAACACACACACATAAGCACGCACTCACACAGATACAATC
GCCCGAGTTCGCTCAGTTTCGCGCTAGTTCAGTTCAGTTTTCCTCCCATGTCGCATGACC
CTGGCCTGCTATTGAAGCTCTAGACACATTCGGAGGGCGATACAAAGCGCACCATTCAAA
ATATATACTAGGTATTGTCTATGTCCGCGCACACATGCCCAAATCATACTAGTTGCCGGC
GTATCTGTACCCAAAGTACTCGCTTTTCTTGCCTTTTTCCACCACTAATGCTAATGCTGC
AGCGGGGTATCCGTTGTATTTCACTTCGGATATATAGCGATAAGTAGGAATTATGTGGGA
GTGATGGGGGTGGCATGGTGCACAGGTGCAGGAGTGGGAAGTGCTAAACTCTTTGGTGAC
AAAGTCAAAAGTGACAGTTATTTAGGAAAACAATATTTACTTATTTAGAAAGATCACAGT
TTTCGCAAATTAATAATAAGTATCAATTATGCAAAAAAAAAGGCTATTTAATATTCATTA
AATGTTCTTTATTTTTAACTTTATTTTATTTTCCACAAGGAACTAATACAATATGTATTC
TTACGGAAGTTTCAAGTTTTAAAATATCCTTGAAAATTTAATACTGGGAATATCAAAAAA
CATGCTTGGAAATTCTTTCAATTATCTAAAAGTATTAACTCTCATCCTTGTCATACATAT
TTACATTTGAAGCCAAAAAGTACCTAACAATAACTTCTGTTTTGTGCATTTTTAAGTCTA
TTTGCTGAGCCCCCAAGTCGAACTTCCTCATTCTCAAACCATACATCAGCATGATTTACG
GTTAGCTCAAAACTCGAATGGCTTCTAGAGTCATAAAATTTGGACAAAGCCCTAGTAATC
TGGCCAATCGGCTAAGCTGTGAATGGCATTCCGTGATCTTGTTTGCTTTGGCCAACTGAT
AAGCGGCCAACGAGGCGTATACTTGATAAAAATCGAACAGAACAAACACAGAAGCAACCT
TAGACAAATCAAAAGAAATCCACTTGATGCCCCAGCCAATTGTTGAAATATTTGTTGGGT
GCTCTTGGGCAATCGTAGCCTTGTCTAAAATATGGGGGGTTGGGGGTGGTGGTGGTGGTG
ATGGTAGCCCTAGGCCTTCTGACAAAAACTAGTTCTAAGAGTTATGTGAATGATATTAAA
ATGACTATGAAAAATCCGACAGCAGATGCTTCGTGCCAATGAAGTTGATACCCACAAACA
CACATGCTTTTTAACCTTAAGTCACGTTTGGATTTGGTGGGTCTGCGACCGCGTAATTTT
GTTGGTAACTACGTTGTTTTCTTGGCATTCTGTATGGCACTACGGCCGTACAACTCTCAA
TGTTTTTGTTATTGTTTGCCGCTTGCGGCAAGTTCAACAAAACATCAGTCGAAAAAACCC
AGCCAAAAGCACATACTGCTGGCTCAACGCTAAACTTCTGCCCCCACAACACACAATTCG
GCACATTGAGGTTCAAGGCCCCCGGCCCCACAAAACGGAGTGGAGCAGAGCGGAGCATTC
GACTTCGCAAGGCCAAGTGCAAGTCCAAGTCCGACTCAGTCGTGGCTTTTCGATTAACCA
TACGCGGCGTATGATTTTCAGTTTTCGTTCGTTTTCGGTTTTCGGTTTTCAGTTTTCAGT
TTTAATTATGCATTTGCTCGGCTCGAGAGGCACGCAAGATAAAGAGTAGCCATGACAAAC
ATTTACCCCAATAGGCCTAAAATGGCAAGGGCTCGGTGAATCGCGGGGCACGTGCCCAAA
AAGCCAGCGACTAGCAAAAGATTAATCAAAGAGCCAGGCCAAAATGAAATATGGCAAGTG
CTTTACGGTCGGGAGTTTCAGCAGCTTGAATGCCCTTTAACAAGAGCTTAATATATTTAC
GATAATAATTACGAACGTAGAACTTATTTACTCAACACAACCTATTTAAGTAAATTAGTA
ATTTTTTATTTTCAAAATATTTTTGGTCTTCAAAACCAAATCTTTAGGAACATTTACACA
TTTATTAAATGTAATTCTTTGAAGCTGTTATAATTATATTATTATTTAATTGAGTAACAT
TATTCCTCCAGAAAATACTGTTTACTGAGTACCAAAAAATGTTTCTTATTTTAATATATT
TATTTTAACGAGCAGCTTACAAAATCAATTAACACTTCGAAAATGTGTCTTTAATATTTT
GTTTAAATTGGCATTTACAATTTAATCTGTTTGAATGGCCTGGTAAATACATCTTGACGT
ATTACTTAACATACGGAATTTTAGTTTTTAGACACTTTAAAATGGTATCTTTCCAACGGG
TATTTAAGAAAGAAATCATTTGATCTGCTAACTAGATGTATATAAATATGTATCTATTTT
AGTTAGTTGTAATATTTGATTTAAGCAGAGCTCAGCATTCAGTGCATTTGGTTCGACAAA
TAAAAGAACTATTAACCATTCTTAGTGACTTAGCAGCTAACAATCGCAGCATAAAAAGCT
TCGCAGTAAGGAAATCAAAATCGGCTTCAGTTCGCTTTCGTGTATCAGATTCACTTTAAC
TTTTCGGCAGCAGAATGGCAAAGGCAGCAGTGGAGGCAAACAAAGTCAGAAAGGCAAAAA
GACAAGGCAAATGCCAGCGAGTCAAGTCGCTCACCCATACAAGTGCCGAAAATCATGACC
TTCCACAATGCCAGCAGAAAACCTACAGCAACAGTTGAGTTCAGTTCAGTTGAGTTTGGT
TGAGTTGAGTTGATTTCGGTGGTTCGTTCGTTCGTTCTCCCTGCGCTGCCTTTCTCGTTG
TTGTTGTTGCCTCGTGAGCGAGCTAGCTTTTTTTTTCACTTCTGTATTTTTGGCAATGCG
TGAGTGAGACATACACACACTCACGCGCGCACACATATACACTCGCAGACGGGCAGGCAA
AGAGTGCGCTGCTCGAAAATAAGGCCAAGGTGACTCACCTTGATTAAGACCCAATCCGAA
TGAGTAGAAGCAGCAAGAGAAGTGCCGCCTGCCGGTAGCAACAACAACAACAACAACAAC
TTAAACAGTAACAACAACAACCACGGCGAAACCAACACGGTTTTCAATGACCTTGCCCAA
AAAAAAGCTCCGAGCATAATAATTAAATAACTTGGGCCAAGCCACTGCCGCGTAGAACCG
AAAATCAGGCTCGAAAACGAAATTGAAAATTCCCAAGTCATTGCCAAAAATAAAATGCAA
AGATACACAGAGGAAAATTAATGATATTTTGAAAATATTGCTTTTAAATTAATTGAGGTA
GACACGTATAATTAAGACAATACGTGTCTACCTCAATTAATTTGTATACATTTTATATTA
TATTACATATGTATCTATATAATTACAATATAAATATATCTACTTAACTTTATTAATATT
ATTTAAGAATTTATAATGGAATTGCCTATGCAATTTAACGAAAATTAATATTTTTCTTTG
TGTAAAAAATATTGGAGCCCCCCAAAACCGAGAAACGGGAGAGAGAGAGACAGCGCGAGA
GCGAGCGAGAGGCAGCGAGACCTCCGCCAGAGGTCAACGCCAGGATCAGTGACATTGCCA
CCGCGTCATTCTCAGCCGACGCAGAGCGTGCATTGACGTCGCGTACATTCACTTCAGCGC
CGAAAAAACAAAAAAAAAAAAAAAAACACTGTATACAAAAATTCACTCTTGGTCTGGTCC
GCTCAGCCTAGTCCGTTGTCGAGAAATGAGTACAGCTGCAGCTCCAAATAATGGCAGCGA
TAGCCTAGAAATATCTAGAATCCTCAATTACATTCTGAAGATCGTTAAAAATACTAATCC
AAGTAACAATACTCAAAATAGTACAGATTACGTGGGCGATTCTTAAAAATCATTCGTAAT
GATTATAGTTTATAATCAGAATAAATAGTTTATATAGTTATAGTTCATCTATACATAAAT
ATATTTCGTCATTTCATCATCCATATCAATTCAGTACATCTGTTTTTCTTTTCTCAATGC
AAAACTAATTAATATTGAATAAATTTTAAGTGAAATAATCAATTTTTTAGTTCTAGTTTA
TGTAATTTATTTAAAAACATCTAACTGCATTTATTTATTTCGGTCTTTCTTTACTAAAAC
TCATAAGCCCAGAATATAGATTGCATTACATTACGTATCCGTAGCGTGGTACATTTATCT
AAAATTCTTACTAATATTATAACGGTTTTATTTCATTGCGTTTACTGAATATTTACTATT
TCACTTCACTATTTTATTTCCTTTCTCATATAGGCACGAGTATTTATTTATCTAATAAGA
AACACCACTTAATTTCACCAGAACTTCTGGTGAGCTATCAATTAAAACATTATGCATTTG
AATTGTGCCTGCGTTCCTCTACCATATCAAGATATTCTTGAAGAGTCAAGGATCTCGCGA
CTATATAAAGTTGATTGTCCTTCGCCGCTGCCCTGAGCCAGCAACAACAACGATGACAAC
AGCGCGTGCGATTTACAGTTGCATTGGCAGTTTGATAGCCCAGTGCCGCCCCAACTGTAA
ACACGTGCCGCTCCGAGCAGCCAAGGCTCCGCGGTTTGAGAGCCACATTCGAGATTCTAA
CGCGCCTATCTCAATAGCCCCCAAATGCTCACACCATTACACACGCGCATTTAGCCTTAG
TTGAGGTCTCGCCATGCAATGCAATGCACCTCGAAACGCACGCACACACATGTGTGTTTG
CATGTGTGTGCGTATGTGAGCGCTGGCGTAATGAAAACAACTCCCGCGCTTTTTCGCGCC
CGCAAGAGAGCGACAGTGAAAGAGAGATGCTAAATTTAGTTCAATGAATTCGAATTTCAC
CCAGCTCTTAGCAGGCTCTCACTCTCCATCTTGCTCTCTCGCGCTTTGTTTTTGTTTTGT
TGTTATTGTTGGGGCACAGTGTATTGACTACCGCAGAGAGCAAAGCACGTTACTCCACTC
GGCACCACTCGGCACCACCCACCACCCCCTCTGGACGCATCGCACTCTGCGATGATGATA
ATGACGTTGCCAGCGGCTGAGTTTCTGCAACTGCAACAACGACACGATGATGATGATGAT
GACGATGGTTATCGAAGGTCTTTCACCCGAACTCGGTCATTGGCGTACATTTGTGTGCTG
CTGCTGCTTCAGCTGCGACGTCGCTGCCACCGATGATGTTGCTGTTGTATCTGCTGCTGG
GCTTCTGCTTGTGCTGCCGCCGCCGCAGCAACTGCAGCTCTGCCTTACTGCCGCCGCTCG
CAAATCCAGAGCTTTTCAAAGTGTACATGTCGCAATTTCTTAAGAAAGTTCAATTACCCC
AAACAATCAGATTTACTGTCTGTTTTTTTGATGCATACACTCGCTGGCCGCACAGTGGGT
GCTGTGCCGAATTTTTCGGGCCCTTTTAAAGTGTTGGTTATATGCCTATATGCCTAGGCT
TATGGGGATAAAATTACAATTATTTTTAGATTTAAATATTAACTCAAAAATTAAAAACTG
GAAATATTTTTAATTATTGGGATAAAGCCTTTAAATCATAAAAAACAAGCAAATTAAATT
TATTGTAATTCAAAATTCATCTTCTTTTTTTTTTGTTTGTTTTCCCATAATATTTTTATT
TAAGATTAAATTGTTTTCTAACACCTTATTAAGTATAAATCCACTATCTCAGTAAAGTTC
TCCGCGTTTCGTGCACAATGCCCACTGTGCAGTCGCTTGGTTCATTCGCTTCTTTCGCTG
CAGTTTCGTTGCTGCTGCCGCTGCAGCGCCTCTGCCGCCGCCACCGCTGCCGCAGTCGGC
GTCGCTGGGTTGCAGTTTTCTAATGTTGCCTGGCATGTTGGGAATGGGCATGGTTGGGTT
TTCAGTTTTCCAGCGCGAGGAGGAAGCGGAAGCGGGGAAGAAGCTGTTGTGTGTTGTTGG
CTGGTTTTATGGTGCATCTTCAAATGTTTGGCTTGCACTCTCGCCCCGTCTCGCTCGCTC
CTACGGCCGTCCCTTTCGCGTTTATTTGCGTCGCTGCATTCAATTTCAATGAGAAATGTT
TTCTTCTCGTTTTCGTTTCTGTTTTTTTTCTCCTTTTTTTTTATTCTTCTGCATTCGGAT
TCGCTTTTGTTTTTTTGGTCATGCAAAAATATATACAAAAACGTTTTCCTCTCTTTTTTT
CGCCTATGAAATGCAGATCAGAATCGGATGCACTTTCCCTTTGGAAAGGATTTTAAGACG
GTCGAACCAAATTTATTCATATGTTATCTAAACACTAAAGCAGCACTCTCAAATTATAAT
ATTATAACTCTCTGAATAAAAGTGTTAATGAATATAAAGCAATAACAACATCTATCTATC
TAACTCGCTTGTAAAACTCAAAGTTTTACAATATTTTATTATTAATTATATATTAATGAT
TTTGTGATGACAAGGTGCACATATGAGTATTAGAAAATTTGAAATACAAAAACCATTTAA
AGTAATTTTATTAATTTTCGTTTGATATATGTACATAGCACAACTTTCCAACCATTTAAA
CATGTATTTATTGGGCCATTTGAATGTACCCACCACTTTCGATCGCTTGTTTAACCTATT
CAAATTCATACTTTCATCTCCATTTAAAAATGCATCTGCTCCCCGCAAATTTCGATATGG
GTTTCCATTGAACTTTAGCCTTCGATGGCCGAACCTTTTTGGACATTTCAAATTATTTGC
ATGCGAATTTGCCGCCGTCATCTCTTGAGGTAATCCATAATTTCCAAAAGAAAGACATTA
TTGCATTCGATCTGTGACCACCCCATCCTCCCATGCCTCCTCCTCCTCCTTCACCACCAA
TCGGCAGTTGCAACTTTCAAACGAGTTTAGTACTTGCACCCAGCAACGGCGATGGCCATT
GCGATGCCTTTTGGCCAGGTCCGAAGGCATCTTGGCCAGGCTGGGCATCCTCGCTGGGGC
CAAGGAATTTGACCGACACATTTACGCTGATGGTTTCGTTTCTTTTTCGAACTCCGATTT
GGTTTATTCGGGCTTATCTTCTCCGCAGGCAGCGCAATGCATTTTTCCATGTTGTGCATT
TTTTCGACGTTTTCTTAAAATAATTTTTCATGTTTTTTTTTTTTTTTGGTATTTTGGTCT
TTTTTCGGCAATGGCGACGAAATATTTTCAATGTCTCAGCGGCCAACTTTCGATGGCTTT
GTGCTCGTATCTTATTTTTATTTATTTCGTTTTGCGCTATCAGTGACAAAACTTGCTTCG
ACTGCATTCGCTGCACCTCTGTCGCAGCGCAGTAGGCGTCGCTGCTGACGCAGGCAGCTT
GCGCAGCAGCGAAATGCAAGTGGAACTGCAGTCTTAATTTTATTTCACTCGCTTATCGAA
TCGATCAAAATCAAATATGGATCATTCTTCTCGCTTAGGATATTTTTTTGTTTTATTTAA
ATGTTTAAAATACCTACTTAACCATTTAAGTTCGAAAAAATAGTTCTAAGCATTTGCATT
TGCTTTAATTAATAAATTAATACATTTTTATAAAACTATTATGCCTTATAATGTCAGAGC
ATATTAGCATTTTAATTAAGAAATAGCTGAGTCAGAAGTATTTCCCCATTTGGAATTTGG
TTGGGTGCTTTAAAATCAAAAGTGAAATTCCCCATAAAAGTTACTCAATAAAACGAAATT
ATTTTGCGCTGCGCTGCATTTCTTGTGGCAGTTTGCACGAGTTCAGCGTGTTGTTGCTGC
TCTTGATTTTTGCGTTATTTTTTTTTTTTTTTTGTTTTTTGGGTGCATTAAACGGCAAAT
TGTTTCGTGGGATCAACACAAAGTGCGTTGATCTCTCGGCTGAAAAAGTGAATGAATGCA
AACGGTGACGTCGCGACGCGACTGCGCTGCGCTGCTCTGCTGGCGTGGGCGTCGCTGCCT
GGTTACGTTTGGCGGCGGCGTGAAAATAGCTCGAATGTGACTAACAATTAATAAATTATT
AATTGCGTTGAATCATGAGTCTGTGCGCTGTGTACTTTTTACTTTTTGGAGCAACTCCCG
ATCGCCATCTCACTCACTCTCTCTCTCTCTCTTTCACTCACTCACCCATTTCACTCCACT
CGATGCGAAAGCAAAAGCAAAACAAAAATTCATCGGCCTGCGTTCGCGTATTGCCCTCTC
ACTCCCCATGCACTGTACAAAAATTTTGCAGGGCATAGTTTCCCATTCCGCAAAATCATT
GAACTTCAAAACAAATCATTAAAAGCAGAAAACATCGCACAAAATATTCAACAACGCCCA
GTTAACGAGAATTTGACAGGATTATTCATTCAAATCTGTAAATGTACATACATATGTAGT
TAATAAAAAACATCGTTTGTTTTTAGCATCCATAGTTTTAATTGCTACCTATTTGATTCG
TAAATGCGAATTCTTCAGCACTTTTATACTTAGTTTGATATAGTGTGCAAGTAGACTGCA
ACTTTGATCATTTACCATGTGATAACGGGCACTTTCTTAAATTTATTTCTCTGCAACTGC
TCCCCTCTCGCTCGCTCCCACGCCCCATCTCCCTCGCACACACGCTCCATCCCGCTCTGG
TCGTGTGAACTCTGCTTTTGACCGACGAGGCAATGTTGTTCGTTGACCTTTCCCAAGTGT
TGTTGCCATGAAAGGAGTGTAAGTGAGTTGTGGGCGCTGCTGCCGCCGCCGCTGCCTCGG
CCGGCGTCGCTGCCCGCCCTCTGCCCGCTGCAGTTTACGCAGCAGCGCCTAGTTGTTGTT
GTTGTTGCTGCGGCCCCCGCTTTTGTTTCATATTTCGGCAAAAGTTTCCTTGGTCATTAA
ACTCTTTAATGCAACGACCTTCCAGTGCGATCGAATCGACAACGACGCGAATTTCAATTG
AAGTCTGAAGCCTGAAAAGCTTTTTGGGTTTTTGTTTTGCTCCTCCATATTTTCGCTTAA
TTTGTTGTTGTGGTTTTTTTTGTTGTGTTTTTGTTATTGTCTTTTCTTCTGCTTGTTGCC
TTTGCGTGAAGGAGTTATCGTTATTGACAGAAGTGTAGTAGTGGCGTTTTTGGCCAGGTT
AGTGCCTTGAATCTGAGCAATGAACCTGCCGGCCGAGAGTGAAGGTTCCTCGCCGTTTTT
GGGGCTTTTGAACGCTTTACTGAGGTCAGGGATGGGCTTAAAGCCCGAAGGATTTACTGC
GCTCGTGTAAATGTACTGGAAAATTTGTGGCCGCGGGCAAAGTTTTGGGGAATTTTTCAA
GTTGTTTGTATGTCGATGTTGCTGATATGAATTTGTGTCTTTAGGGAATATAAATTAAGT
TATTAACAAATGTTTTGACCTAATTATGAGTGCCAATCACGAATGTTATTGGGAAATTTT
AAAGTTCTTATGTATGTATGTTCATACCTTTGCATATAAACAATAAACCCAAATTTATCA
ACAGAGAGAAAGGAAATAGTCAAATATTTTTTAAGGTAATTGTAAAAATTTTAAATACAA
TATGTTAACATTCAGTATTAAATATTTTTAAAAAATCATAATAATTATCTGAGAAAACCA
CTTTTAAAATCTTTTGAACAAAATATCGAAAAAAAAACTTTATCAAATATTAACTACATT
TTCACTTTTATAGGAGTATCTCGATTTTTTGTATTTGCCCGCCAGTTTGCAGTTCCCTGC
CCTTTGCAGCCAGAAATTACCTCACATATTGGAATATGTTTCTTGTGAGTAATTTCGCAC
AATGAAAAGTAAAATTTTGCGGCTGGAGTAAAGGCAAAAACAACAATAACAGCTGCAGCA
ATAACATAAACAAGCAAACTCTTTTGCGGTATTTGCACTTTTGCGTTAAACAATTTGAAT
GAAATCAGAGCGAACAAAAGAGTGAACGTAAGAGAACTGGAGTAAAATAAAGAGCGAAAG
CTCGCTCGGTGAGAAAATGCAACTGCAAGTGATCTCACATACACAGACTTAGACTTGCAG
AATGTCCGTGTGTGTGTGAGTGCTTTACTGTAAATAATTTGTTGTTGCCGCATTTTGCAT
TGCATTTTGCCGGGCGCGCTTTATTTTTTTTCGTCTAATGCTCATAAGTGTGTGTCTGTA
AGAGAGAGAGAGAGAGGGAGAGAGAGAGAGCGCGTATTTGAGCTTGCAGTTGTGTGCGTG
CAACAGCGACTAACTTGTTTTTGTTGCCATCGCATTCGACTTTTTCAATGAGTCAATCCT
TGAAATGTTGACTTCCTGATACGCATATGACTATTGAACAAGTTTGCTTTGTTAGATTTT
TTTGAAGGTTGCGTATTTTATTCACAAACACACGCGCACACACACATGCACTTCGGTGGG
GCACGTTGAAATAGACATAACGACACACATTAATTTTCGTAGTAAGATATGCCTCTTGCT
TTTGTTTCTTATTTTGGCTCTTGCTTTCCGTTCTTCTATTTTAATATTTCAATGCACTTT
GTGGGGCGTAGAATGAATATTTGGCAGAAGCACAGAAAGCTATTGACTAATATTAACAAT
CTAATTAGTTCGATTAAGTCATTAGAATATGTTATGAATGTTGGGCAATTCGGATATTAC
ATAAATTTTCACATTTTTTTATATTTATGGCCCAAATAAATATTTATGGCAAAATTGAAT
ACAGACCTATACTAATGTCTATACTAACAAATAACACTTCTTTTTGTTCATATTATCAAT
TTTTAATATTATAGTATTTTCTTGGCATTTAAATAAAAAATCTTTGAATTCAATATATAG
TTTTCAATTATTTGATGTGTATATATTGTCTATAATGCACTTTTTCCTTTGTCTTGATAG
TGTTATACCACTTCAACAGGAACGCAATAGGTTTCGAAACGAAAATCGCGTAGATTTTCC
ACTGCATTTACAGTTGTGTAGAGGCCAGCATAGAACAATGGGATCAGTGAGTGGGACAAA
TGTATCAGACGACAGCTCTCGGGGACCTGACTCAACTTTTCTTTGCTGGCGCAGTCGCCA
TCTCCATCTCCATTATCCATTATGCATAATGGCTGTGTCTCGTGTGTCTGCTATTTCTTG
ATCGCACTTTTTATGGCGGTGGCAGAATAATTTTTCCATTTAACATTTTTCTGCTGCTGT
TGTTTACGCTCATTTTGTTAATTTAATTAGAATTCATTTTCTGTTGTTGGCTCTTTGTTG
GTTAAATTTTGGTTTCTTCTTGTTTGCCAGCCGTCAAGAATTCGGCTATAGTTTGTATAA
TAGTGACCCAAGGTCGTTTGTTTCCCATGGTTAACCTTATGCTTCGTGTTCTGGTGTAAC
AATGGAGCCATCAGAAGCAGCAGTTAACTGAAATATAACGCATACGCCGCGTGCGCCAGA
TGCGAATGAATTTTCGTTCATAACGATAATGATGATAATAATTTGGTAATTGCTCTTGGG
GGCAATGCGGTCCGAGAGAGACAATGCCCAATCATTTAACACGGCGTTATAAATTTTTGG
CTCAGTGGGCCAACAGGTCGTATGCGCAATTTGGATTAAAGATGTGATTCTAAGGGTTTT
CATGTGACGTTGATGCGTGGAAATTTCCTATGGCTTAATAAATGAATTAAAGGTTAAGCT
GTAGGTTTAATTGCTTTTCTCTAGTAATTAGTTACTAAAACATACCCACCCACTTTTGTT
GGTCGTATTTGTAAGTTGCCCTGACCGATTTGGTAAACTTAGTTCCCCTCTTTAAGCAGG
AGTAGTGTTTCGTCCAATGCAAATTAGTCACACATAATGAGGTGCAATAACCAACTGAAT
TTTTCTTCTTTCCACATACGTGGACATATGTACATTCGACGTTCGACTATGCCGAATTTA
AACCTAAATGTATATAAATACATCGGTGCGAGCGGGAAGGAGACTCGATTACTACAACAT
TCGTTACGCCCTTGGGCGGCAAAGGGGGGTGCTGCCTGTAAAAGCAACAACAAGCACCCT
ACAGCTCGGCCATTCGTGCGGCATTAGCGACTGTCTACAGACTGTAGTCTAGCGTCTAGA
CCCCCAAAGCGACGACCTTAAACTTGAATCGGTATAGCAACAAAAACATAAGAAACGGCA
GCAAAAGAAGAAGCAGCAGCAGCAAAGAAGGTCAACAGAAAACTAAAAAAAAAAAAACAA
TAGCTTTTTGTGGTTACACCTGAAAACGAAAAGCACAAAACTAAGGTTAAAATTTGCCCA
CTTGCTAAATTGTTTCTCAAGCTATGACTAATGAAATGATCGGGGAAAAAGTCCTGAGAA
AATCGTAAATTAATAAAATATCGTAAAAAGTACAGCTTTAGCTACGATATTATATAGTAA
CATAAAGCAATCGAAATTTTTTAGATGTAAACGATTGAACTATAATTATGCATAGTTCCT
AAAAAGCTACAGCTGTACAATATGTAACTGCTAACTATATAATGCGACCTTGAGACTGTT
ACTAAATAAACTAATTAAGCACGAAGCCAACGAAGTTAATGTTTTTACAATTTCAGGCTC
GTCACCAAAGCATAGAAAAAAGTTAGCTAGTTTTTTTTTTGCCAAATCGGAAGTGTCTCC
AGTTAGTTGGCAAAAAGCAAAAACGCAAAAAGAAATACGACAAATTTGTCTAAGTTTTGC
GATACTGTTTTTCAACTATCCGCAAGCGACAACAATAATAATAAAAAGCGCTGGCAAAAA
CAGCGATCTTGAGCGGAGTGTTAATAATATTTTGTTCAATGAAAAGCCGTGTGGTTGTTG
CTATTGTTTATAGTTTTGTTGTGGCTTTTTAAGCACGACTCGCTTATGTTCTTCACGCAC
ACACACAAATGCGCCAGTCGACACGCATTGAGAGCTGCATACAAATTATACAGCCAGAAG
CTTTTATTTTTATATTATTTTATTCGTAGCCATGACAGTGTGAGAAGGTCACCGCTCACA
CATACACGCGCTTAGAAACTGAACGCACACCACAATAACAATAACAATGCAAAAAAGCTA
ATCGCAACAGCAACAACAGCTCACACATATTTACGCAGTCAATAGAAATAGACAAAAGTC
AAAGAAGCCGGCGCATTTCGCTCTCCCTTGCCACCTGTCTCTGTCACGCGCTGCAGCTGT
CTCTGTCCCGCATTCTCTGCAACTAACGCATTTTGCATAGCTTTACTATAGTCTATATAG
CAAAAGCTCCTCCATAATTTGCAGGCCTCAAAAGCTTTCATGTTTTTTTTTTAAGTGCGA
ATTCGAATTCTATGCAGAAATGGGCGTTCGGAAGTGGGGTGTTCCGGGAAATGTAAATTG
TAGATTATTATCTTTATTACTAAATAAATAAAATAATATCGATTGAAAAAATGATCGTTC
TTTGTTCTTCCTAATGGGTTTTTAAGAAAATTGGTATTAGGTTTTAAAAATTCAGAAAAC
TCGAGAAGTAAAATGCAAATAAAGCGGTCTGTAAAATTGATGATCTCCGGCGAAAATATG
TAGTTATTGGGAACAACCGCAGCAGCAGATTATCTTGGCCTCTGCCTTCGAGACAGTCGT
CAACCGGTTTGTCAATGTCTCGCGCGTTTTTTAAACAATTCAAACTTATGCAGCGAATTT
GTGTTTATTTCATATTTATTGATTGGCTTCTGGCCGTGTGGTTTCTTCTTCGATTCTACT
TGCAGAGGCCGCACAGCAAGCCGACATAGGGCGACATTGGCTGATTGACAATTCGGCTGA
TTGGGGCAATCGGAAATTGGGAGCCATTTCCACGGAATCCACTTGTCTTCGGGGCACCGC
CCACCGACGCCCACCGCCGCCCGCCCCCAAATGCCCCAGCGCACCTTCAAACACCATAAA
TGCGTGCCAAAAGCAGCAAACTGGGAACTAATGCAAATTTGGTCAATGCCATCGATATCG
ATGCTAATGGCAATAAAACTTTATACATCTATCGCATTCGCTGTAAGATAAAATCGGCCA
AGTCGGCAAACTGTGAGACTGCTTCCCCGAACTCCATCATTTACCTGTGACAAGTGCGGC
GGCCACAAAAGACCAAAATAATTAACTAAACTATATAAAATGCGCCCGAGTGCGCGGCCA
AGCAAATACAACAACATCGAGTGGCACGTCAATGTGCAACAAGTGAAGCAACCCAGAAAT
GCAGAAAAACACTTTTAGATAACTTTACACTGCCTTACGGTTAACATAAATCGTTAATAT
TAACTTACAAATTACGCGTAGTTCAATATACAAACTATACAACAAGCAAAAAACAATCAA
AATTTATATATTTACAACAACAACGAAACCTTTTACAAATAAGTGAAAAAACAAGAAAAA
AACATTCAGCAACGTCGAGGATCGTCAGCGAACAACGACAACAAAAAGCGAAAGGTGAGA
ATGAAAAACCCTAAATAATATATTTTTTAAGGGGTACCATAGCGTAAAATGTCTCATAAA
TCATTTCCATTTATTTTCAAAAAGACTAAACATTTTCACTATTCTTTTGGTGTAGGAGAT
TTTTGTAATATGCCTGCTTTAATGACCCATTCAAATTTCATCTACAAATAAAGATATTTA
AGTATAAATAAATCATTATCATTATAATTGTTATTATTATTAAAAGTGATTGGGATGCAT
TTGTGGTTTACACCCAAATTCCAGTATGGAAACGGTCGCCTTAAGGTCACCACACCCAGG
GAAAACTGGAAAGCTTTCAACTTTCGCGAAAGAACCCCGTTGTGGAGAGCACTCGATCAG
CCGGCGACTGGGGATGGGGCGCATTGGGGAGCACTGAGTACCGCTCACTGGTCAGTCGGC
GATCGTCAGTTGTCGATCGGCGCACCCAAATCGGGAATTCTCATTGCCAGCTAGTCGCTG
GGGAAACCAGGAAGTGAATGCGGGCTGCACAGTGTAGATTCTCGGCTAAGTACACATGCC
CAGCCGTTTTAACTTAGCATTTCTATGCAATCTCGCTTGCCGATTGCCGCGCTAATCAGA
GATTGCGTATACGCACTGTGGCACTGTGATTACTCGCCAAGCTAAAGAGGCATGAAGAAA
AGCAATGGGAGGGTGGTGAAGGGGGGGGGGGAAGGGTGGTGGATTCAACGCCAACCGATA
TTTTGCATAAATGTTGAGGAGCTTGGGCCAAATGTCTAATTATGATTTGGCCCGCGGGGA
ACGGCGAACAGTAAACGGCAAATGGCCAACTTGGCGCCAGCTGAAGCTAAAAACAAGGCT
GGACGTTTTCCATTGGCTTTTCCTTTCGCGCTTCTTGTTTGTTGTTGTTGTTGTTGCGCA
GCTCTTTCGAGTTTTCTTTCGCTTTTTCTTTTCGCCTGAACTTGCAGTTTGGCTGGAAAG
TGAAATAGTTGCAGCCGCCCGAGTCGCTTGTATTGAATAATGAAAAACGAGTTTTCCGCC
GCGCATGCGCATCATAATGGCAATACCAACAGCAAAAGCAACAACAACAACAACAGCAAC
AGCTAAGCTGTGGAAAACCCGAAGAGGCCGAAAGAAAAGTGGCGATAGGTAGGGAGAAAG
AGAAATGATGATGACGCGGGTGCCAGGCAGCGCAATGTTGTAATGTCTGTGCTGCAAGTT
GAATGTGTTGCACTGCGGCCATTGATGTTGCTGCCGTTTCTAATGCTCATAATGCTGATG
CTGCTGCATGTTGCATGTTGCGTGTGTTTGTTGCTCGTGTGCCGCACACAAAGTTGCTAT
TGTTTTTGTTCTTTCGACTTCTAATGCTAATATCTACATGATATACTGCTTCTGCAAAGA
TGTTTAATGCTTTCCTTTATTTATTGCTTGTATAGCAGATGTAATTTCTTTTATAAAATG
CTATGGATTCAGATGAATTTATTAGAGTTTTGTAATTGGGTTGTTATTATTTCTTTCGGC
TCTTTACTCCTCCTATTTAGTAAGTCTCGTATCTCTTAGCTTCTTTCAGTTCGGATAGTT
TATTTTCACTTAGTATAGACTAAAGAATTTGTTTAAGGTAACATTTATAATAATGTTATT
CTCATTTTGCTTAGTTATATGTAATATGTAATAACAGTCATATTTAACAGCTGAGATAAT
AAACGAAAGATCTGTTTTTTTGTTATTGATAATAGTAGATATCTTATTTGTTCCCACTTT
TTGTGCTTTATTTAGTCGTAAACTAATGATGTACAAATGTTTTGAAGTTGAAACAATGTT
TCTACATATTCTTAATGCCATTTTGTATAGTCAATGTATAGAGAACTGTATTTAAGATCC
TTACTTTCTTTTCTAAATCAGACCCTTGCTTAAGTTTAATTATATATTTTTTATAAAATC
TAGTGACTTAGCTGAAGGTCTTTAAAACTAATTGCCGATACTGCTCCTTGTCTGAAGTTA
TTAAAATAAGATTGCAAGTCTATTGTTACTTTTTTACGGCTGCATGTTTAAGTATAGCAG
ATGTTGTTGTTTCTCCAGTCTCCTATTTTATAATATGTTTTTTTTTCAGCTAACGCTTGC
ACCTAAAGCTGAAAATGTTGTTGTTGTTGTTGTTGGCGAGTGCTTTCAAGTTTGCTGCAG
TTTTATTTTTTCCTATGCGCATTTTTCTCTTCGTATTCCGCCTCGTTTGCTTCGTAGTTC
AATGTTAACGAACTTTTTGCGCCGTGAATGCAGATTGTTGTTGCAATCTGCAGTTGCAGT
TGCAGTTGCTGTTGTTGTTGTTGTTGCAAATGGTGCTGTTGGTGTTGCTGTTGTTTTTGG
ACTTTCACTTGTAATGAATTTGGCGAGTGCAAAACTTGTTGTTGCTCCATGCTGTTGTTG
TTGTTGTTGCCGCAGTTCAGTAACATGTTATGTAAAAAGCGTTTTTCCAGCTTTGCTTCT
ATTTTCGTTTTTCTCCTGCTTTTTTGCACACTTTTTTTTTTTTTTGATTATTTGTATGCA
GTTTTCAGTTTTAGCTTGCCACAAAATTTGTGCCGCACGTCTTGCCCCGCCGCCGTGGAT
GCAACTTGCCCCGATCGCCGAGTTTTCTTTCCGCTCTTGCTTTTATGTTGTAATTCGCAA
TTTCTAATGTTATTGAACTTTAAACACAAACACAATCGCAAAACCGAAAAAAAAGTTGCG
GCGCGCGGAGGAAAACTTTGATTCAGAGGAAAATTAGTTATAACCGGAAGCCACAAGGCA
AAAATTGAAACAATGCAACGAGACGACTTTCTATATTTTCATCCCCTTCTCGCCTTTTAA
CTATGTATATATGTCGGTATATATATATATATATATTGCCTGCAGATCGGATCGGCTATG
TATAAATGTAAATATTTTAATGGATGCCCAATGATGCGGCATTGTTGGGATGCAGATGCA
AATTGAGATGGGCCGGAATTTCCCCAAGAAAGCAAGTTCCCTGTGCAATTAAAACGCCTT
GATTTTAGATAAGTTGGTGCGAAATTGAAAAGAAGGGAGTTGAGCATTTGATAAATGTAT
TATGAACAGCTGATGTTTGAAATAATTGCATGAGCACTCAATGTATAATGTTATTTAATG
AATAAGAAAAGGTTTTGAAGGTTTACAGATTTGATGTTGTTTTCTATTATTATGTATTTT
ATTACTATTACTTATGTATGCCTTTACTTATTGAAATTCTCTCTTCTTTTTTCAGACTCC
AAAACCAAGCCAAAATAATATTAAAATTAAAAATATATATACAAGAGGATTTTAATATCC
CTACACTGTTAAGTGCGTCGAAGAACTAACAACTTTTACACATCCACAAGGAACCTAGTA
TCTTCACTTTTCGTGTGATCTAATAAACAGATGCGAAGTCAAAACTCTATACAAATTTTG
AAGAACCAAACCAAAACCGTCTTAAATAAAGTGCCTAAAACAACATTTTCACACGAATCT
TATGAGAAAATTGTAAAGCGAACGGAGATCGAAATTTTATACCAAGTGTGATAGGTATAC
AAATCGAGGTATTGCAAGTTCGTATCGAGCAGTGTTTCCGCAGCGAAACTAGAAAACTAG
TGGACACTAGATACCCTTTCCTGGTTTGAGACGCGAGGAATACCCTGGACCTGGGTGGCA
TCAAGATTGAGCAGAACTTTCGCGACTGGCAGGGGTATTCAGGAAACGGCTACACGCTGG
CAGTTAACAGTGTTTGCAGTGCAGGCTTTGCCCTATCAGCGATGCCCTTTATCGACGATG
CACTGCTCTGGTGTCCAGATAACGATGGTCGTCTTGTTGGAGGTCTAGACTTGGGAACAT
GCATAGCCGTAAGTACAAGGACATATGTACCTTAGGAAATTTAAATCGTCGATAGAAATA
GAAAGAGATACTTTTATACCTATGAAGTGGACATGGACCCTTAATGATTTTTATATAATA
TGTACTTCCAATTAAATTTTACATGTGCCAAGCTATTAAACAACATTTATGACTCGTAAT
GAGCAGGACATCAAGAATTTGAAAGGTGGTGGTTTTTGAAAGCATTTTTGTTGCATACTT
TTAGAGTAGACAATTTTACTTTATTCCTTCGCTTCTAAGACTGATTTCATTCTTTAGAAA
AAGATATATATAACATTTTTTAAAGTTTTTGTTAATATAAATATATAATTTTATTCAAAG
GATGATTCTACGGCTAACGGAACGGAAAACTTGAACCCCTCGATCCAATCAGCTGGCAAT
CCGAACAACCCGCAGCAGAGCGTCGGTGGCGAGATCCTGGGATCCGTGGAGTCCGCCGGC
AACGAACTGAATGGAGCGGCGGCCCGCAACGTGAACGTGGTGGTGGAACCGCTCTGCGGC
GGCGACTCCTCCGACGAGCTGTTCCGCAGCTTCTCCGAGAGCAACTTCGAGATCGAGAGC
CTGCTGTCCGATTTGGCCACCGTCGAGGTGAAAGTCGAAAATGTACATCCGCCAAGAACA
GAACAGAGAAGTTTACAAACTGTCATAATACATTTCTACATATATATACTACATATCCAT
ATCATATTTAGACCCACAGATTCTATATGGAATTTTCATCATTGTTTTGTTTTCCCTCTC
TGTTTTCCGCTCATCTCTCCCCCCCCCCCCACACCGCTGAAACAACTCCTGCTCCTCCCG
CTGCAACCAACTGTTTCCCAGGAGGAGAACAACAACAATGTCATCACCGATGATGACTTC
GCCAGCGTCGCTGCCGCCGTGGTGGCCAACGATGATCTGCTAGCCAAAGAGAATGCCCAG
CTGAGTGCCCAGGGTCTGGTCGATTCGGTGGCCGCCAGTCTGGCCGATTCCGGCGATGCC
GGTGGTCAGCAGGCGCTACTGGCCTTCGGCTCTTCCAGCTCGGCAGCCTCGGCGATTGCA
GCAGCAGCTGCCGCCCTCTGTGGCGATTTGATCAACAACAACAACAACAACAGCAACAGC
AACAACAACAGCAATGGCAATGGCAATCACGGCGGCGGGGGAGGAGGAGCTAGTTCCGGC
GGCGGAGTAGCCGGCGACTGTGCCACCAAGCTGGAGTACGCCCTCATGGGCGGACAGCCG
CTGGCGGAGGAGCCGCGCTTCGTGACCAGCGCCGCCGCCAATCCCCTTCTCGTCGAGAAG
CTAATGTCCAAGTGCCTGAACATTGAGAAGCGAATGGACAAGCTCAGCGGTAAGTCGACG
ATTTTATTACCTTTATGCAAAACGAAAAACTAAAATTTAACGAGTACATTAAAGAGTATT
TTCAAAAATCTACGTGAGCACAACAAAATTGATCCAAGAGTAAACAATTCAATTCCAAAT
AGATGTTTGATTATTTAAATTGGCTCAAATAAGATTGCTTGGATAAAATGTTTCAAGATA
TTTTCAAGTCTATATTTTAAATTTGGCGCCATTGCAATTTGGCGCTGCCACTATTTTCAA
ACTTTGGTAGTGAAGCCACTTAGTTATTTCGACGTTATTTTTACATGAACAATTTACAAC
TCAAACATAAAATGGTGGCGCCATCTACAGCTAGTACGTTGTAACTATTATGATAATTGG
GTATATCTACATGTAGCTGACATGAATCTTACATGTATCTTACATTAATTTACATAAAAA
AGCTAAACGACCGGAGTACAGTTTTAGATGCATTGAACACATGCTGAAAGTTTTAGGTTC
ATTAAAAGCTCAAGTATATTGTGTGCTCGCTAAAAAGCTTTAAAAGCTCTTGCTTTCAAA
TTAATTTAAAATTTGGTTTCTAAGAATTCTACTATATCGAATTTATAAAGAAGGGAATGT
TTTTGATTTAACAATATATATTAATATATAAGGGACAGAGTTGAAAATGGTACATAGATT
AATGTGTGGAAGCATATTGCAACAAATTCAATGCTTTAATACACGACCTAAACTTTAAGG
TCTGAAAATTTTCATTATGAAAATATGTATTTCAACTAATTGAATTTCCCATCTGGCCGT
ATTAAAACTCGTCCTCCAGAGACCGAAACTGTCAGCCAAACAAGTGCCCGAAATAAATAA
AAAGGCCAGTAACTTGTTTATTAAATCCCGACAGGATGTCCTCCTCGCAAGGCGCCGCCC
CCCAACGGCCACCCAAAAACAGTCAACCACCTAACGACTGAGCCACCGTGCCACTCAACC
ACTCAAAGTCGCAGACTAAAATATAAATGTCGACGCTCGGGTTGTTGTCTCGTCGTTGTC
GACGTCGTCGTACCGCCTAAAAAAATGTGCTGTAGGTGTAGGTGTAAGATGCCACCCGCC
GAGTGGTAGGGATTTAACAAGGGGCTGGGATTTCCAGGAGGCAGACAAATAACAGTCTAT
TGACACGAAAGGCAGACGGAGCCCCCGGTTCTGGGAAGCGTCTGAATGGCACACCACACC
ACACCATACTTCACCACAACCACCCACAGTCCTTGGGCGCCGCCGCCCTTTTTTGCGGGC
ACCTACTTCCTTTTCTTGGCAAAAAAAAAAGGGAAAACAAAAAGACATATATATGAAACC
CAGACAGGACCCAGCGAGGAGTCGTGGCGGCCTGCTACTTTTCGCTGCTCGTTTTTGTTT
TCAAAAGTTTCCGAATGCGGCGAAGCCAAGTCAGACAGTCGGGTCAATAAATTTTGCGTG
TGGAAATTGTGCGCTCAAGGTCAAAAGGATATTCGCCTTGCTGCCTCTGTGTGTGTTTGT
GTGGGTGGCGGCCGGGTCGCTTGTAGGAAATGTCCGCCGTATATGTGTGCATGTATTTAG
GCTGCCGTCTGCCTATCTGTGCGCTTGTATTGGTATTTCGGGCCACAGACAAAATGGCTG
CTCACACTCCTTTCCGTTTGTCGGCCATTTTGGTGTGCGTGTGCGTGATAAAGTGTGCGT
GTGTTTGTGTGGGCGTGGGTGTGTGCGTGCGGCAGACAAAGAGCCGACTGTTTGGGTATG
GGCTTTGGGTTTTTGGTTCGAATCGGGCTTTCCGGCAACCTTGAACTTGAACAATTTGGT
TGAAGTTCAGCCTGTAAGCGAGGCGCTAAATTTTGGGTCCTGCGCCCTGCAGCCACCCAC
TTTTATGGATGCACGAAAAGAAAAACTTTGTTTAGGTTTAAAATAGTTAAAGCTTCCTTT
AAGCATGCACAGCATTATATTTTTCTACTTGTTACACAATTAAAATAACTAAATAATAAA
TTCGTATTTTATATATATTTATAAAACTCTTTGTGAGCAGTGAGATCTCACGGTTCAAAA
GGGTTTTAATTTGGAAGTATATTATTGCATACTTTGAGGCTCAAAGATCTTTGAAGCTAA
TTTAAGATTTTAAAATGTTTTAATTAATGTTTAAAATGTTTTAGTAAAGATTTTCAAATT
TAGGATTTCTTGTTTTGCCTCAAATGTTATTTAGAGGCGGAAATTGATATCCTTTTTGAC
AACTTGACATTGGATCAGTAATTTACAAGAAATATGAGCGATCTCTGCCATATTTTTTCT
TCGACTGAGCTCGAATTTTTTTTTTTGTGTGACAGAAGGACGAGAAGGTCCTGTCGCTGC
CCTTTTACTTTGGTGGATGCCCCGACTGGGTTCAAGCGCCGCACGGCCCAAGCATTGAAC
TCTCGATTTCAAGGATACACCAACGCCCCGGACTCGGACTCGCAGTCGGATTCAGATACA
CAGATACAGCTACAGATTCTGAGTCGGATTGGAACTCGGATCCGCAACCCAGTGGCAGTG
GCAGGCATTGAAATGCTGCTCGAGCCGTTGACATTGCGAGCGGTCGTCAACGCTACCGAC
GCGTCGTAGACGGGCTAAGATTGTTCACTTTGCAGCGAGTTCAGCGACGGTCCAAGGTTC
TTTTGCGGCGGCCACAGCCAGCCCCCTACCCCGTAACCCCCAAAAAACACCTTCTACCCC
CCTCCGCCAAAAAAAAGTGAACCCCATCTACTCGTAATGCCCCTGCAGCCATATCTTGGG
CCTCTCTTTGAGTCAGACTTTGCGACTCGCTATTAATGTCAAGGGGTTCCACACGACCAA
GCCGCCGTTTTTGTTTCTGTTCTTTTTGTTGGCATTAGATTTGAAAAGTGCGTTAGTTTC
TGCGTTAGTCCGCTCACTCGAGGGATGGGTGTTGTGGGAAAATCGCTGGCTGCGATCTAT
TCAATCGACAGCATGATTGCTAGCCAAGAATTGTGTTTGATTGGTGATAATTTCAGCAAT
TCATTTGCAAGTGCTCAGTTTGCATGTCTATTTGTGTGTCGATTGTTAACCACAATTAGA
GAATAATTGTTAGTTTTGATGCCGGGATTAAATGATTAAGTACTACTATTCAGTTGTAGA
TTATCTCAAAACTGAAGTCTGATTAACCATTTGACGTTGGGCTCTTCTCTATATTAGTGG
TAATAAAAAAGGATTTCTTGCCTAAGTATACAACTTGTGTCTTTCAGAGATCATAGAGTT
CTTTAAGCTTCCTTAAAACTGATTAATTTAGTTTTTATTCATATTCATACAAACTGAATA
AATTTTCAAGCAGTGTCTTAATGGAAACTCTTGAATTATTTTGTTATTCATTGCTGCTCA
TCAATTTTGTTTATGCATTTCATTCAACTATATACATACATCAAATTCAACTTAATTTTA
CATTTCACTTGCAATGCATTTTCCCAGCCCATCGCAATCACGCGTTTCACTTTCTTTGCA
TTGCAATTGCAGTTGCAGATTCAGTTTCACTTTCGGCCAACTTCTTCGCCATCCCTGGCA
GCACTTAGCCAGATTATTTATTTGATTACTCCGGCTGACATTTTCTGTTCTACGACTGCG
AGCGCAAGTATGTAGCGTTTTAGCCACTACTCATGGCTCATGGCTCCACAGCTCATGGCT
CATGGCTAAAGCTCAGTGCACGCATTTCTTGGCTGCCTTTCGGCTTTGGATTTGGATTGC
CAATTTGAATTTGAATTTCAAATCGTGCTGCTGCTGCTTCGTTGCCGTTTCTTACTTTTT
ATTTTGTCGCTTTTCAAATGTGCGTTGTTATAACCAAATCAGGATTTCTGCGTGCCCCCG
GCCAGCAAAGCGTCTAACAACAATTACAACGACGCAAGCAGCAGCGACAACAGCAACAAC
AGTTGCAGCAGCAACACAACGCGCGCAACAACAACGACAACAACAACAACAACAGCAACG
AGAACTGCAACAACAGAAACAACTAACGATGTCAGGGGCGTTCATTTGTCCATTGCCAGC
CAGCAAACGAACTGAACCGAACCGAACCGGGCCGAGCACGTCACTGTCACCAGCGACAAC
CCCCCACTTGCACCCCACTTGCCACTGCCCACCCCCAAAGGCCCCGCCCGCCCCCCTCCC
CACCAACTCTGAAAGCCCCCTCTTGCCACCTAAAATTTGAGTGCCAAACGTTGCAGTTGC
CACTGCAAAATGCACTTTGCAATTTTGTTGATTGCTTTGCCATTTGTTGTTACTGTTGCA
TTTGTGTTTTTACCCATCTCTAGGGGTACTCTTGATATGATCTTCAGTTTGTTACGCGCT
GATCCTGGAAAGATAGTGTGTTCTGCACCAAACATTCTAGGCCAAAAGCTATTATTATTA
CTATTACTATTTTTATTCATTTTAAAGAAACATAATTGGATTTAGCATACATCTTTACCC
ATTTTTAAGAATATCTTAATAACGTTCAGTAGATCAAAATTCTGCTTGATAAGCACACAA
GGAAAAATCTAGATTTTAAATTTACCAGAGCTGCTTATAAATAACTTGCCATTAGCTGAT
ATTCTTAGAATGCTTGGAAATTTGCATGCTTATGATTGCTTTGTCTTGCGTTATTTATAA
ATCGCAATCTATTATTATGATGTTAAAAAGCTAATTATATCATAATATCCAATTGAAGCA
AGTTAAGCACATATCGGGCAAGTGTATTTAGCTGTCGGCTTGATCGTTCCAACTTCCTTT
CTTGTTACTGTTGTGTTTTCCCATTTTTTGTTTTATTTCTTAAATATGTATATTTGTTTT
GCGACTTATCTAAATGCGCTGTTGCTGTTGTTGTTGCTGCTGCTGCCGTACGCATTGCAG
GTTGACCGCCGAGTTCAAGTTTTAACGGATATCGCTTAGTTGTTGCTGTTAGCCGCTGCT
AATGTCTTTGTTGTTGCTGCCGTGTTCTCGTTTTTTTTTGGCAGGAGCCTCGCCTTAGCC
TCGTTATATAAGCGGCATTATGGCTCCGCGCTCTTTTGTGCTGCCAATGAAGTCATTCCG
AGCGCCATTTTGTCGAGTTGCAGATTGATTAATGGTCCAGTGGCACTTTTGAGCTCACAG
ATGAAAACGCTTAATTATTGTAGTTTTTGGGACGGGCTTCGATATTTCGCGACGAATTCC
TTCAAGTGGAATGAAAACTCAATTTTAGGGAACCTTAAATGTAAATGTAAATATGTAAAT
GTTTATTCGAAAATTCAAAAATATACATCCTTGAAAATTTTTGAAAATAATTGATTTAAA
TGCTAGCCTTTTTGTATATTCTCTTATTATTCCAAAGCAAATCCTCCAAACTGGTTGGCA
TTGTGAAATCTTTAATCACAGGACTTTCCTCTTGGGCGTTGCATACATAAGCGCTCCCAT
TACATATTAATCAGATTCAATATAAAGCACCCACAAGCACACACACAACTGCTGCCCCCT
TTGCTGTCCTAATTGCACTGTAACCCATTAACACAGCGGCCGCATGCAACCAGTTTGGCA
TCCCTATTGTCTGTTTTTGTGTTTCTGGGACCCATAGAAAGGGGGCCAGCTACAAATTTT
CACCTTCACCTCATCAGTCACAAAAACAACGGCAGCCGCATCGGAAAAGCGCGAGTGAAG
AGCGAGAAAAACAATAATGCAATAGGACAAAGATGGGGGAAGCGAGATACATATGTTTGC
ATTTTCTCTGCGATTTATGTGCAGTGAATGGTGACAGGGAAAATGTGTACATAAGCATAA
CATGTTCCCTTATTTAACTGGACAAATTGCATTGATTCGATATAAAGCATTTAGGAAATA
TTACTGTAATAATGGCAAATAACATAAATAACTTAATTATCATACATACATAACATTTAT
AATATTTCTTATGCATACATATACATACATATGTAGTTAGTCATTGAAAGTAAAATTACA
ATTTTCAAGATCTTTGATAGTTCTTACAACTTTCGTATTTAGTAAGGAATCAAAATAAGA
GCAATCAAGAAAAGATTTATGGTTTAGAAATTTTATGAAACATTTTTTATATACACACCG
AAAAAATGGTTAATATTAAAATTCAAGAAAAGATACAAATGTGTTTCAAGCTAGGAATTG
TATTTAAGATAACATTTCCATACAGATAAAATGGGAGGCTTTAAAATTAAAAAAAATGCA
TATAGTATTTATAGACTTATGGCCCGGCTTTAGGCCCTTTGGGTCTTTAAGACCGTCCCT
GAACTAAACCGGGCTTCGGATCCAGTTTGCGCTGGCCCTTTGATTGCATTAGAGCGTGTG
CCGCCCGTCGCATCTCGTTAAAGGCAGAAATGAAAACAAAAGCAGCGGCAGCAGCAGCAG
CAACATCAGCAATGATGATGATACAACCTTACAAAATTCTCAGTCGCAGACTGCGGTGCG
ATCCAAACCCCCAGCCGCACCACCCCCTCCAGCCACACCACCCGCTCTTGCCCATCGCAG
CGACTTTGAATGTTTAGCGCTGAACTTGTCTTGCACACGACCACAGATGCAGTTCGCGCG
AGAGAGCGAGAGCGCGCCGCAGAGAGATAGACGGCGAGATAGTGATAGAGAGTGGTGGGG
GCTCAAGCAAAGGCAATAGCAAACACACGGAGAGGCGCAGCGAGAGAGAGAGAGAGAGCG
CGACAAACACAGTGATAGCTTTATTTTTGCCGTAGCGTGTGTGGTATGCAGCCTTGAATT
AGTTCGCTGCACCCGCCCGTACATACACACAAACAAACAAACGCACACACGGCGTATATA
AATACACGCGAACCCCACACACACACACACGCACACATGGGAGCAGTGCCATATAAGCGT
TTCGCAGTGTGCGAAAGCTCTGTGTTGCTCTGCTCTGCTCTGCTCGTTGCTGCTTTGCTC
CCCTTTTGCAATGCTCGTCGATCCCCTCGCCAACCCCAAAGCCCCTCCCCCTGTCACGCC
AAGCCACCCAACACCCCATGTCATCCCAATCGAAATCGTAGAAGGAAAGAATCTACTGCG
GCGCTATAAAGTACATATATATTTCGTGAACACACGAACATGGGGCATCCGAGTTGTCGC
TTCTTGTTTGCATATCCCATTTTCCGACTTTGCCAAACAGATTGTTTGATGCACAGCGAA
AAAATTTGACGATCAATTGGGGTATTTACATAGTGACAAGCTGATTGCAAGCTCAACTTT
CTAGGATCAGGAAGGTATTGTTATATGAGAACAAAACCTTTTGACTCTTAAGGCACATCA
TTTTAATGAACATTTTATGAACAGTAAAAAAAGTTTATGATCAATGGAAAATTAGTTTCT
TTACACTTGATATGTTGAAAGTGGTATTGCATATGTTACATATGTACATATATTAACCTT
TTCTATAATCGATTAAGATAGAACTCGTATTCCACTTATCGCCATCCGTATGTCCAAATG
TTTCTTACATTTATTTTTCAAAATCCGATAAATGTTTTATTAATATACTAAATTCTCCCA
TTTACTAAGAAATTATGTTCTCTCTACCAGTATCCTCAATTATGAATATGCAACTAATAC
TTTCGATATAATATTTGTAATATGCTTAGGTTTTTATATTACCAATGTAATAAAAACACG
ACCTCCCAGAGGTTTCTATATGCTAAAATGAATAACATTTAATGGGCGGGCGCATGTCGC
CATTCTGTTTCGAGACATGCTATTTCGATATCCTTACCCAAATAAACAACATGTCCGATT
TTTGCATATTCCAATTGATCACCGTGCTGCCCCTAATTATTTCCTCCTGTCAGTCCGACG
CCCCCACCTATGGACACGATCCGTCATCTGGTGCGTCTAGCCTTCTGATCGTGCCGACAC
ACATCTGAATCGAAGCACTATATGCAATTGTGGCAGCGGATATGCATGTCTCTTTCCACT
CTCCTTTTCGCTGTGGCGAATGCGAATTAGCGAGTGTCGGGAAATGGGGGAAAACAAGCG
GAAAACCGTCTCGCATCGTATGTGTGTCATAAATGCAAACGACTAATTGGCTGTGCAATG
GCGAATTGAAAGCACTTTTCAGAAGGAAAAACTAAATTCTTTTTAAGCTGCAATATGCTA
TGGCATAATCCTGGCAAAGGGAGAAAAGAATGAAATATTCCTATTAGAGATGAAATGTGT
AAAAGTCAAGGTAATGTTTTGTTAGCTAATTGTGAAACTCTAGATGGAGTTAAGTTTTCC
CGCAGAAAAGTGTGTGTTTAGCGCTGCGAAAAGTCCCACCTATAGGGAATTTGCATCCAT
TGCGTTCTCGTTAGGCGACAACATTGTCTATGCGTAAATAGATTGTTTTTCTGCGCTTGT
TGCCGCTCGGTATGCAGATCGACACCCAGACACTTCGATACACGGGTCTTGTCCTTCAAA
ACGAATAAACAGACATATACATGCATACATATGTATGTATGCATACACGTAGTGTGAAAA
GCGAAAGCGAGCATTTTATGCGTAAGCGATGCACAAGAACAAAATGCAGTGCAACTGCAA
TGCCAGCAGCCACTTCGATTGCAGAAAATATTAGGCGGATGTCTGACTACATTGTGTGCA
TCTATAATCCGGCCACAAATACGTGTGCCCCCATATATTAATATTTATAGGTTGCAGGAA
CTGCGAACGAGACCAGCGCAAGTTGGTGAATAATCGCGGATATCGCATTGTATTGCATTC
CCCGCAACTAAATGCCCATATGCAGTAAGCCGATATAATGGGGAAGTCAAGTGGGGGCCC
TAAATCCCCAAGTGCTGTCATTTCGGTTACCTGTTGTTGCTGCTGAAAGCAGCCGGAGTT
CCAAGCGTCAGCAACATGGCTCGCTCCACACCGATTTATATATATATATATATATATTTA
TATATATAGAGAGAGATATACGTATAGACACTCAGCTGTGTGCATATTTTAGAATGTAAT
TGTGCATCTGGCCTAGACCTAGAAAAGGAAAATTTTGTTGCTATTATTATTTTGCCCGCA
CTCGTGCATTCGCGTTCGTTTCGCTTGCAGTTCGCATTTTGCAGTTTGCAGTTCGCAGAT
TGCAGTTCGCAATTCGCTCACCAACTAGATACTCTTCCGTCTCTTTCGCACCGTGTGCCA
TTTTGTGCGGCACTCATTATTTGTTCTCCTTCCTCGCAAATTAAAAATATGCCTAAGCAA
ATAAAATGCATTCAATGTGTTTATATATATCGCTGTCCATATAGGAGCACTGCTTTTCGT
CCGACTCTTGGCATGCATTTTGTGTCTATGGGTAATTGTGCGTTAGTTCGCACTGTACAG
GGTGCTTTTGGTACAGGGATCACTAACAGAAAGGAAATGTCTTCGAAATATTTTGGTTAT
AAATTTATTTCAAATTTTAAGCAATAGTATTTAGCTATGTGTAACAGCTGGCTGTTGTGA
TATGTGCAGAAAATTAAACATTCATGCACGCTTTTAGTTTTTGTATGGTTTTCAAGGATT
TCGGTTGGGAATTATTCCATTTACAACAAATTTGCCACATAAGCGCTTAAATATGCGGCA
TTAATATGCTAAACTCCTAATTTTCGGCCCTATAAGCTAATTAATAGATGCTCCAAATAG
GAAACTGATTAACTCAGAAAAGGTACCAATATCTGATGTTCAGTCATTAAAATGTTATTA
TTTTATGATACTTTATCGCAGTGCAGCTGAATAACCGGAAGTAACTCATCCTTTTACTTG
GTTTGCGAATGATCCTTGAATTTTGTGCCTTGAAAGATAGCCTATTGAAACCATAACCAT
AACCATAATTCCTGATCAATCATTGTGCTTGTGGCACCCCTTATCCTTACCAATCGCCGA
CTGGCAGAGACATTGGCTTCTGAATACACGTACAAAAAACTGCGACTAACACAGTAGGAA
CAACAGCAATTGGCTTTAACTGCAATTGCAACGCAATGGGAATTCAAAATTCGAAAACAA
AGCTGATAGAAAAACAAACCGAAAGAAAAAAAAACAGCGATCGAAACACAACCCAGAACA
GCAACAACAAACAATTTAAATTGAAAAAATGTTATTTTTTTGTTTTGCTGCTGTGTGTGC
TACCGTCGGACAAACGGCCATAAACGCAGCTAACCGCGCCACGCCCCCGCCCCCAGCTGC
ACCGCCCCTTTTGCCATTCGATCGAACGCCGCGATTTAGCTGCAGCCCGTTGCAACATTT
TGCGGTGGCAGCGTTCGATACGCGCAACATTCTATCTCAAATAAAATGCGAAATTACAAA
CAAAAAGTGCACTGGCAGAAAAAAAGGTCACCTGCTACTTGTTTAATTAGAAGAACATTA
AGTGCAACAACATTAAAAAGTAAACCTATATATTGTATTTTTAAGAACATAAAAGCTGAT
AGATATATTTAATGTATTTAAAACTACTTTCAAGGACACTCCTGTTCTAAAGTAGGCAGT
GTTGAATGGAAAAAAAATCAATGAACTAATCTGAAAATCTAAGATAGTTAAAGAGAGTTT
TGAAAATATTTAAAATAGACAAAACAGACGTTAGAATACAAACAGTAAATATAATATTTA
AATTATCTTACTATTATTTTCTTAATCAATTACTCCAAACTAGTTAAAATCTCCAACTCT
AAATCTGTGCACTCTAAATATGCGATCTAATTGCTGTGATATTTTTTGAAGTGTGCCTGA
GATCTATGCGAATGGCCCTGATTGGGGGTAATGGCGGGGTGGTCAGGGGGGTACAAGGGG
GCCATGAGGGCCAGGAGAACCCAGTGAACTGCCCGTGGGGTAATGGCGAAGCTAACGACA
ATTCATTGCGATTCTCGAGTGGCAGCGGCGAGTGCCGGACTCGTCGTCGTTTTCGCAGTC
GTGGTAGTTGTAGTTGCTGTTTTAGTTGCAATTGCTGGCGATGCAGTTGTTGTTGTTGTT
CCTACTGCTGGCGAACGGAACGGAAGGGGGCGAACGGGCTGGGGGGAGGCACGCATGTTG
TCCATGTCCCCATTCGAGTCAAGTGACGTGTTATCTGTCGCCTTCTCTCAGAACTTTGAC
TTCTATCGGTTGAATGTCGTTGCAGTCGTCGGCGTTGCAGTTGCTATTGCAATTGCAAAA
TTTGACGCTGCCGCTGCGCTGCTTTTGTTGCTTGCTATTTGTTATTTTCTGTTTGCTATT
TGCTATTTGCTGCTGGCTATGATCGACGATGCCAATCGATCTCACTGGGGCTACCGTGTT
GGCAGCAGACTCTGTCCGTCTGTCTGCCGCTCCGCTCCGCTCCCCTACCACCACCCCTCC
CCCCTTCACTCCCACACATACAGTGCGCCGCGTTTCAATGTCAGTGTGTCTATTATGCGC
CATTATGATTGGTATTATTAGCGGCATGCCATGGAAAATGAAAACTGCCAACTGGCAGCG
GCAACACTTTCCCTCTCGTTGCTTTCCATTTGCAGCAACAACTTCATCATCAGCATCTGC
AGCATCCACATCGACAGCAGCTTGCTGCAACAGCAAGTTACCAGTTGCAACTGAACTGGC
TGCTATGCAGTAATTATTGCACGATCAATTTGCCGGCCATCCATGTCGGTGAAAACTTTC
CTTTGGCAACATATTAATAAGACCCGATTAGCGGTAGCTGCTGGGTGGGGCAAGCAAAGT
GGATGGTGGCACATCCAGAAACATCCTAAGTCGATTGAAAAGGTTTTAATTAGCTGCATA
CTAAAAAGTAAGAGGTGGAAAATAACACTAAACATATAAAAATAACTTTTAAACTCATAA
AAAAAAAACGTTATTCGGAAAATGGATAATGATACGTTGACCTTTTGGAAACTACAACAT
TTTGATGCACAATATATCACATGTTTTGATTGCAACCTACCTCAATTCTTGATTGCAGTT
GCACTATTTTGTGCACTTTTCTTGATCTGACCTACCTCAATGGCTTTTTAAGTAATTTTC
TTAGCCATAACCTAACCCAACATTTATTTGTTCTTAACTTATTTGTACATACTCTAATGT
GGCCTAACATAGTTAAACTAATATAATATAGTATAATATAGGTGTGGTAACATTTAACCT
TACAAATGAAGGTACATATGGATACCTAACTTTAAGCTAGTAAGATTTAAGCAAAAAAAA
TGGAAAAATATTTTGATTTTGGAACAGCATTTCAAAAGGAGTAATGTGCTTCAAAAAAAC
CAAAAATAAACAAGGGAATATATTACAAAAGGTCCTTGTATTGTTAGGAAGTTGTTTAAA
ATTGAATTTACATACAAAGAGATAACCGCATATTTATAATATAAAATAATAATTAGAATT
TACTAATCTCTGGAACGTAATATTCCGTAGTAAATGCAACTGATAAGATACATTTCCATT
TCCCTGCGACCCTCGTGCAAATTCTAGTAGTAGTCACTAGCAAATCGTCTGGCGGATGAG
CAGTGGCAGTCGACGCTGTCGTCGCCGTGGCCGTTCGCAGCGCTGCTTCCGTCGACGTCG
TCATGTACGCCCCAACCCCTGCCGCTGCCCCTCCCCCTCCCCCTTCCCACTCCACACTAC
CATCACCAGCGCTAGCAAAAGCCCCGTACCGCCTTGCCTCTAACGCCGCTGCCCCAATGG
CTGCGGTTGACGGCCGTACAGTTAGACGGACGTTTGCTTTGCTTGCGTTTACAACACACG
GACACACAAACACACACACACTCAGACAAAGTGCATTATAATGGCATTGAAAATCGTTTT
CAATAAAACACGTAAACAAACAACAAAAACCGAAAAGCCAAATGAAAATGAAAACGCACA
AAAAACACAGGCAAATGCAATGGCAAAGGCAAACGCAAAAACAACATTTATGTGTAAGAT
ACAAAACAGAAGAGGCTTTGAGTTTGCACTTTTAGTTAATAGTTTTTATAAACAAGCTCG
TCGTATTTTCCACTTTTCGATGGTAATCAACGCTTAATAATGTGTGAGAATTTCGCTTGG
GATTTATGTTGCACTTGTTCGGCTGTGCAAATGTAACTTTTTGCTGCAAATCCCGCTTGG
TTGGCTGCTTTCGATTATAAGTATGAATTATTTTGTTTTTCTTGCTTTATTTTGTGTTTA
TACATTTTTTTTTTTTGGGAATTTTCCAGTCGAAATGCTCTTTTGAATTTACGTTTGTAT
CTGGCGGACTCACAATAGGTTGAACTTGAAAACGGCCGTTGTAGTTGTTGCTGCCGTTTG
TTATTGTGCAGTTTAATCAACTTTTGTCTGTTTGGCGACTGACACTGAGCGAGACAACGA
ATCCGGAGCGACGGAGACGGGAGACTTCGAGAAAAGTGTTTCCATTGAATTTCAATATTC
ATTAGAAGCCGACCATCTACGGGGGGTTCGCACTGGGAAGGATATAATTGTAGTGGGCCG
GGTTGATACGGGGTCAATTGTTAGACTTTTGGACAAGGTTGCGGATATACAATGGAGAAA
ATCGAGAATGCATAAGAAGAATGCTTTTGGCATGTAATGTGACCCTTTTAAAATAAAAAA
GTTGTCATATTAAGTTTGTTATCATAAATAAAAAAGCTCATTGGAAGATCTAATATTCGT
ACAAAAGGGCTTTACTCCAAACTGTACAAATTAGTATTCTTTCAAATGCTTTCGGTACTA
AGCAAAACAATGAAAATAAGTAGTCAAATAAAGTCCCCTTCTCAACAAAAGCTATACCAA
AACAAATTGATCTTCTGTATTCATTAAAGAATTTATTGAAAATCACATTTCTGGCGAACC
ATTGCACTGAGTTGACATTTCAAATCAACTGTCAAATGGGCGAAAGTAAAAATTCAAATT
GATAACTTTCGGAAATCAATTGAAAGTCGAGCAACCAACTCTCGGCACTCCAACGCGTTT
TGTTAATTAAAATAAATACTTTCCGCCACGGACGTGGACATTGCAGGCAAATGATTGTGC
CAAAAAAAATCAAATATAATGTAAACAAAATAAATGAAAAGAAAAGAGCAGAGGAGAAGA
GAAGAGAAGAAAAGCGGCGAATGTGAAACTGTTGGCCATTCCACATGTGGCCAGCTGCGT
TTTCTTTTCGCTTTTCCTTTGATTTTTCTGCATACGCTCGTTGCATGACCAAGAAGTCTG
TTACTCAGTTAGTCAGTCAGTGTTACCCGATCCGATCCGATCCGATCCAAGACAATCCAA
GACGATCCATCGTATCCATCGGATCCGAGCGATGACGATGCCAAAAGCGTCCTACTAAGA
CACTTTTACCCGGCCAACACTGCCAACTGGTTTTGCCTTGCTCTTGGCCAAAAGACACCG
AGCCATGCCGTGCATCGTACAGCATTAGAAATTGGCCAGCAGATCGATGCTTGGCTTCAC
ACAGAGGAGAGCCACCGAGGAAAAACCATACGAAATTCACTTTCATTATGAATGGCCAAA
TGGCTGAATGGTCGAATGCTCGAGTGGCGCTGCATACAAATGCAGCTCGAGATTCGCGAT
CGCTGGCCACTGCATTTGCGGCTTGGTCATCCAACCTGGTGGCCAAAGCCAAATCATGGG
TTTTCCTTTCTCTCACATCTGCGGTTGTCGCTGTTTTTTTTTTTTTACCGCTGCTTGTTG
CTGCCGCTAATTGACGGGCTCAACGGCAACATTCAGTGGGCCAAGTTCGCTGCAGTTGAC
GGTGATTATGATTTGATCGGCTAATCGAGTTTTGGGGGGACTCAGGGGAACTTGATTAGA
GATAAGCCACATTTATTTAATAGTCCGTTATTGGAAAATACTTTTTATAGAAATTTTTTT
AAATAATTAAATAATTTCAAAGCTATCTACATGTTTTGACGTGAATTAGTAGTTGCTAAC
TGATTTTGGTTTGAGAATAGTAATGCATTCCTTTAATTTTATATCTTAAATTCCGATTTT
ATTGAATTTAATTAGTTTTCCACATCAAAGAAACTGTCTGGTTTTTGATTACTCCAATAA
AGTTAAGGACAATATAACCCAAACTGGTAACTATTTATCCCCTCGAGCTGCTTCCTAAAG
AACCCGATCTACAGATACTTCCATCCGTATCCCCATTACGTCCGAGCTTCAGCTGTTCCA
TTAGTTTTCATGACGCTGCCCCGAGGGCCTGTCTACATGGACCTGCATGTGGCACTCAGT
TGGAGCCCATTATGCTTGCCACATCAAATCAAATGGCCAACTGCGCTAAGCATAGATGTT
GCATGTTGCTGGTGTTGGTGTTGCTGTTGCTGTTGGTGCTGTTGCTCTTGTCGCTGCCAT
TTAGCGCAATTGACGGCAGGTCCCAGGCCAAGACAGACTGCAATTGGAAGTCGCCAACTA
ACACATTTCAGGTCTTCAGCTTTAGCTGCAGCTTCAGCTTCCCTCCTTGCCCAATCGATT
GGCCTGCTTTTTTCTTGCGCGTTTCCATTTCGCATTTTCGCTTTCATTTTCTTTTTCTTG
CCAAGCGAAATATTTTCGTGCTTTTTTTTCACTATTTTTATAAGCGAGAAAATCGAAAGT
TTTTCCCCAGACCATAATGCAAAAAGAAAGTGCAAGTGCAGCAGCTGAAGCTGAAATGGC
GGGACTTGAGGGGGTGGCTCACAGAAAGGAAAAGCAAAACAATGCCAATGGGGCGTATGA
GCAACTTGTTTTCGGGCCAAAATGTAGGATGAATGCCATTGTTTTGCGGCTGACGACAAC
GACGAGTTTTTCCAGCTACCACTTGGAGTTTTTCATGCTGCTGCTGATGCCGCTGTCGAT
GTTGTTGTGCCATTTTCGTTGTCAAGTGCAATTGTAGCTGGGTTTGCTGGTCAAATGAGC
AGTAAAACAGTTACTGCGATGGCGAACAGCGGAATAACGTTCGTTGCATGCAGCACAATC
AGCAATTTCCTTTCGGTCGGGTCCGTCCAGTCCGTCTGGTCGGTCTGGTCTTTCTGTCTG
TCTGGCGCTTTCGATTTCGTTTAATTAAAACGCATAAAAGTTGACTCCATCTTGGATGTA
GATGTCATTGCCTAGGATGGCATGGGATGGGATTTTGGATGGCCCCCGCCGAACAACAAT
CTCTTGCCTCGTTATTGGCAGTGACAGACAGCCAGCGAAAAACAGTGGTTTTCTTATCAT
TGACATTGGCTGGCAGAAACTTGCCAGCATCAGCGCCAAAAACTTGTCATCATCATAATT
CTTAATCATGATGAAAAGTCTGCACTGCACTCTGATCTTTTTGCTGTGTTTCATTCCATG
TGTCTGCTTCTTGTACGTCATTTCAATAACAAGTTAAGAACTCGCACGCCTAAGTCGCGG
TCAAGGTTTTGGTCTACTGCTGCTGTCGGCCCGAAACAGTTGACACTTGTAATGGCCGCT
TTACATGCAAATTAAACAAGCGAATTACTCATACGCCCCGTGGCTGCCGCCATTAAAGAT
GAAGCGTTATACACTTGCGGCTACTTTTTGGCTTCTGCGGTCTCGGTGCATAATTCTTTT
TGCTTCTGCTGATGGTCAAGAGCATGCTGCACCTATTGTGGTTTTATTTTCGCAAATTTG
ATGGCTGATGGCTGATGGCTGAAAATGGGGAAACAATTGAAACTGGCTGAAGGCCACGGC
GGAGTGATAATGAAAAACCGCTGAATTGAGATGTTTCTGGGTTGTTGCTTTAATTTTCTG
CACCAAAGGTCACTCTTTCTCTTGAGGGCAGTGGAAACTTCCTGAAGATTTGTGGAAAAC
TTTGAACGGCAACCGAATATGCAATTCGTTTCAATTTTAAAGTTCAGTTAAGACTCAATA
GAGCTGCAATTTATAAAACAGAATGCATGCTTGTATCTGAGTCATCAGTTAATGTGGCCC
ATCTATAGATTCCTCTCCAATTTATCAGAAAACGCTCTTTGACAATGTAAGTTTCCCATC
AAATCGAGCGTTAAAGTTCCATTCGACAACAGGTCACGAGTTTGCAGTTGATATCGGGTA
TCCATCAGACTGCAGCATCTTCCTAATCTCGTCAAGCATCAAAGTCGCAATCATCAATTC
GACGACATTATAAACGTCGCTCGTTTAACCCACAAGGATCCCTCTGCCCCGCAATCACAT
CCCATTTTTCTGGAGAGACAAAGAAACTACGTGGACAATTTTTCGGCAAGATTACGAGCT
ATGAACAAAGAGATGCCCCCACTTCCCCCAAGCGAAGCCGTAACAATTACAAAGTCTGCT
CTGCTTCTATTTCTCCACTGAGCCAAAACTCAAAAATTAAATACAGAATTAGAAAGCAAT
TTAAAGGATTTATGAACTCATTAATAAATAATTAATACAAATTGACTGTGATCTTAGATG
CAACCACAAGAAATGTAACTTAGCAAATCATGTTAAGTAGATTTTAAATATATATATATA
GTCAAATATAGTAGTTCCTTTAAACTCAGCGAATACATATGGATAAGTCAGAGATAGCTG
GTTGATTACTCAAGATCAGCTTAAAATTGATTGCAACTGTTGGATGACATTTCGCCTTGT
GTACTTAGACTTCTTTGGTGCGAAAGCGAGGAGGAGCAGCAGGTTTTGTCGCCCCGACGT
TGCCATCGTAATCTGGCGATGCGGAGCGGGATGGGGAGGCGCGGCGATTGCGATTGTGAT
TCTGTTTCTGTTCCAGCTTTTAGCTCCAGTCTGCAGGTTAGTCAGTCAAGTCGGTTTGTC
AGTTAGTCGCTGGGTCGTTCGGTTCGGTTTGTCACTCAGCCAGTGCGACAAAATTCGGTG
GGTTTGAGTGCTCGGCGCGTGTATTAGATGATATGAGGTCATTCACTGCTGTTTACAGCG
AACGCCGAATATCCCGTCTCGCCGACGCTGCTGCGCTGCTTTTCTCTGCTCTGTTGCCGA
AATTTCTGGATGACGCTGCGCTCCATACCATATACCATATACAATATACAGTTGGTTTTG
TCCAGTATGTGTGTGTGTTGGTGGGGCTGTGCTGAAAGCTATACCCGAACCGAAACCCCA
AACTGTTGCCCTGCTTATACATTTCCGACATCCTCCTTGCCCATTGTCCGCCTGTCTGGC
GGTAGGTGGCGCTTGTGTTGTCGTCCAGCTTAGCACAGTGGCGCCAGGATCATTTTCTTC
CCTCGTCGAAATGCTAGGAATCTAGATCATATTTTACTTAGTTGGTAATAAATATGTTAA
ATTTCATTAAAAATTAACTGTTGTGCGCTAAAAGTAATCCTAATGTATTTTAACATTTTA
TTTTATATGGTTTTGGTTTTAATTCATTTAATGCCCTCACTCCTTTATCACGCAAGGTTA
ATTACTTCACACGATAAATTTATCTCTGGCTTATTACTCCAGCACACTTAACTGTCTTAA
CTGCCTTAGAAGATTAGAGCGCATACCGATACTTATCTTTAATGCCATCTATTGCTTATT
TCCAACGCGTTGATTAGTTTCCATTCGAATCAACCAGTGTGCAGCATTTGTCGTTAGCTG
TTCAATGACTTCTGTTGAAACATGAATCGACTACACAGTCAGCACCCAAACCAAGCCCGC
CTATTCCGATGCCGAAGGAGTCAAGGAGCTGTGGCCACGGAGCAGCAGAGGTGGAAGCTT
CCAGCAGGAGGAGCAGAGCCACCTAATGCGCTTCCTCTTCAACAAATTCTTTTACGACTG
GCTGTCTGTCTGTCTCAGTCTCAGTCCCCTCGCTTTGCTGTTTCTTCTGGCAAAAGGAGC
CGTCGGCGGCAGTCAAGCCCCAAACATTTCCCCCAGATCCATTCTACTAGTCGCAAACCC
TTTCCTTTGTTACTAAATCTTACACGGAGAGAATATGATACGGAGAATAAAAAAATTTTT
TGAAAACATTTAAAACAATTAAAATTCCCATCATAATAATTTAATATATTCTTCACGAAA
TCTCCTTGGTCAAATTGTTTTTTGTTTTGTGCTAGAAATATCAAATATTTGATGTGTATA
TGTGATAGATTCAAAAGAACTTTCACAATGACTTATGCAAGGAAATAAAATAAAATGAAT
AAAATATCAATATATTACGAGGTCATATTAGAATTCTAATCTCATACCTGTTTTCTGTGA
GTGCACCCCTAGTTGTGGGTACATTGGACTCATTTCACACACACACTTTTGCACTTAGAC
GGGCGCACACAGACAAAGAGCTATTGCAAAAGTATGTCTGTGTCGACGTCGCCTCATTTA
GCTTCTCCTTCTTCTGCCTGCTGCCTCCTTTTCCGCCCCCTGCCCCATGCCCCCTAAAAT
CCGCCAACCCACACCCCTTGCGTCTACGCCCTCGCTGTTTCTAAAAACAAAACTCTTCCT
TCTGCCGCTCCTCCGTCTTCTTCTTCTTCTTCGCCGTCTACTTGCTCTGCTTCCTTTATT
TGCAACATACATTATATGCCAACGGAGGGAAGAAGAGAGAGAGAGAGGGAGAGAAAAGCG
GCAAGCGGAGCTTCCTTCCCACTCGCACACTTGAATTGCAATCGGCAAAGTAAATGGAAA
GGCCCCCAACAACACTAAGCAAACGGAAAGTGAAAATTTGCTCCACTGACAGACAGCTAG
AAGAGAGTGAGAGCGAGTGAGTGAGAGAGAGTGCTGCTGGCACTCTCACAAAGACAGAGA
AAAGTGCTTACATACACTTGCATTGAGTCATAATCGTGTCGATTGCAGCAGCGACGTCCG
CTCTCCTGCACCTCTTCCCCTTCCTCATGCTCTGCAGCCACCCAATCTGCTCCCTCTTGT
CCTTCGTCCCCTTTCGCTCATCCCCCGTTTCAGTTCCTCTTCGCTGTGCAAAAACACAGA
CCAGATGATCGCTTAGCCCTTTTGACGGGGCCTGACCCATTTGGCGAGCCACCGATAGCC
TTCTCCAGAGAATCGCGGAGAAGCAGAGAGGACGCGATAAAGGAGAGCTGAAGAAAGGCG
GAGGGGGGGGGGGGGCAGTTGAGCCCTGAGAGTGGAGAGCACTGGGTCTGGGTCGCTGAA
TGTTGTGATTGTTGTGTTACTTTTAGTTTTAATCGCTCCCGATGATGTGTAATGATCTTT
AAGGGGAAATAATCAGCCTTTGTTGGGGCATCGGGGAAAATGTGGTAATTCCGTTAATTC
ATATTAAGATGATCGTATTTCTTAAAATAGGTTTTAAAACATTAATAAAGAGGTTTTTTC
CATTCACAATTAAACATATTTCTGCCATGCAAATATTTAGATATCATTGTTTAACATTTT
ATTTTTTATTCTTAATTATTCAATAACTTTACATTGCGAATTTTTTTAAATAATGCCTAT
ATCACTATATAGTGTTACGGATGGATGTAGAAAGGTAATCTTGGGTTGCTGATAACCCCT
TTTTAGTGCGTTGACTTGAAAGAGTTTCCAGAGACTTCGGATAGTTCGGATTGCATTGTA
AAACTTTGAGATTTCAATGCCTGCAAAATCAGTTAGTGACAACTTCTTTTTGTCATATAC
TAAAAACATAAAATGTTTCAAATACATTCGATTAAGTCTCACAAACGGGAATGCATTTTT
CCCTGTGCAGCTGAAAGTAATCCTAACTTGACAACATTCTTGAGGGACTTGCTACTGTGG
ATGTCCCTCCTCCATCCCCACCCCGCAGAACCCCACGAAATCCCCTCGAGAATTGCATGC
AAATGCGCATGTGGCACACAAATCCCCCAAACATGCACACACACACACACACATACCGGT
GCAACAACGAGGTGGTGGGGGTGAAGAGGAAGACGCAGCAGAGAGAGCTCCAAACATTCG
CGTGCTCTCTCGCTCTCCCCCTGTCTTTGCCCCGCGATTACGTTTGTTTGCCATTTTTGC
GCTCTCTCGCAACGTTTTTCGCAACACCAGCGGCAGCGGCAGCAACGTCGTGCCGTCGAT
TCAGTCGTTCAGTCGGCGTAAGCGAGTCGAGCGAGCGAGCCCCATTCAGTCCGGCGATTT
GGCTCTTTTGCACCTGTGCAAGTGTGTGTTTCTCCCGCGGTGCGTGCGTCCGTGTAAGTG
TGTGTGCGTGAGCGGTGGAACTGGTGCACTGGTATTGGGGCATCGGTGAGTGGGGCGCGC
GCGCGCTTTTGCAGCCGCAGCATCGCAGTCGGCGTCTCTGCTGGCGCTGACGTCGAAGCC
GACGTTTGTTGTTCGGTGTTTGCGCGTAACAAACACTCGCAGCGGTTTTTGTGCTGACTT
TAGATTTTAGTTTTGCTGATACCGTAAGAGATAAATGACGTGCCGCGGCGAGCGACGAAT
TAGCGGCCCAAAACAGAGAAAAACTCAACAGCCAAAACACACACAGAATACCAGAGAAAC
AGAAGCAAGCAACAAGCAAATGTTTGACCCGCGGGAAAACAAAATGTAATAGCTAATGTA
GCAAAATGTGTTTAAGTTTAAGCCAGAAAGTTAGCATATAAAACGTCCACAATTAGTGCA
AAAAAGTTCAAAACCTGATCAATTTTCGAAATCAAACAAATACCTCAAGCGTAAAGAAGT
AACAATAAACCAACAAGCAAACAAACAAACAAGCAACGAACCGAGTGCAAAAACTTAGTG
CAATTTCTTTAATAAGAAAATTTGAAGCCCCCAAAAAAACAGACATAATAATCATGTCTA
GTGTGTAGAACGTTGCGTATACGCAATATTGCCAAACCCATTAACGCAGACATCACGCAT
ACGCCGCGTCGTGCAAAATGATTATGGTGCAACATTTGGTGGCCGCCTCGGCGCACAACT
TCGCCAGCCAGGCGGCGGCATCGCTTGTCAATGTGTCCAGCTCCAGCTCTAGTTCCAGTT
CGAGTTCCTCGTCCTCGCTGTCGCTGTCTTCATCCTCATCCAGCTCCTCGCTGTCCTCGG
CCACGCCCACGCCGGTGGCCTCGCCCGTGACGCCCACATCTCCACCGCCGGCAGCCGCCG
CACCCGCAGAAGCCTCGCCGCCAGCAGGAGCTGAGTTGCAGGAGGATGGGCAGCAGGCTA
AGACTCAGGAGGATCCTACTATGAAGGACCAAGACATGCTGGAAAAGACGAGGCAAGAGG
TGAAGGATCCAGTTAATGTGGAGGAACCAGGTGCCATAGTTGATACCGAGTCAGTGATGG
CGCGGCAAAGTCCAAGTCCAGTTGCGTCCACCAAAGTCCCCGAGTCACTAGAAGAGATTT
CCAACAAATCGCCGCCCGTTCAAGAGGATGAAGAGGAGTCTGAATCCGTAGCCTCCGACT
GTCGCGAGTTCAAAGTGCTCTATAATCACCTAAGGCAGCAGCAACACCACCACTCTCCCT
CCTCGCCAGACAAGACGCGCAGCACCCTGGACGATGTGTCCAAGATCCTCTGGGAGCGAA
AGCAGCAGCTGCAGCGCAGCTCAGTGATTACCGCAGCACCCACTCTGCAGCCGCAGCAGC
ACCAGCAGCCCATGAGCGACATCGAGGACGAGGAGACGCTGGAGGATGTCGATGACGCGG
ATGCGGACGTGGAGGCAGACGCCGAGGACGAGGAGCTACTGGAGCAGTACCAAAACGGCT
ACGACTCGCCACTGGATCTGTCCCTGGGTGGAGCCACCAGTGCAGCCGCATCAGCTGCCG
CTGCCGCCTCGGCGGTCAGTCGCCGACGGGGACGCACCTACTCCGGCACGGAATCCGACG
ACTCCGCGCAGTGCGAACGGGCGAGGATGCGACTCAAGCCGGAACGCAAGGCGGAGAGAT
CGGCGGCCTACAAGAAGAGCTTGATGAAGCGATATTGTAAGTGGCAAGCATTTAAACTAA
ATTGTTTTGATAGAGGAAATAGATCATTTATCAATTGTGTTACTTTTCTAAAGCCTTTCG
TTGGAATTTTTGAAATACTCACAAAAGGATAACTTTATGATTGAAAAAATAACAATCATC
TTTGATATGCTCCTTAGGCATTTCGATGTTATAAAATATTGGAGATATAAGCATATTATT
TTAGAGTATGTGTAACATATTCCTCGTAACCGTTCTATTTAAAAATTTAATTCATATTAA
ATTATTTTTGAACAGCTCCTTTGAGTAGAAGAAATCCCTTTAGATGGTTTTTCAATTTAA
ATTCTGTATCGATTGCTGGTGACTATTCATTTTGTTTTTATACAAACGGGCCTTTGAGTG
GCAATGAATCAGCCTCGACTGAAACTCCCCCATCTTTCACTGGCCAAAATTGTGAAATGT
CAATTTGGCAAGAGCCAGAAATGTTTATAACGAACAACAATGCACGGAAAAAGAGTTGGG
CAGCCAGAGGCGAAATAAACATTATTTAAAATAGCGCAATTTCCGCCGCCGGCGCTGCGT
TCAGAAGCGGTAGAAGCGACAAAGGCAGCGGCGGTAGAAGCAGCGAGTCTACGTCAACGG
CTTCGTAACAGTTTCCTAACCCACCTCAACAATTTTATTGATTACTTGAGGCGGCAAACG
CCACACGGAGAGCCGAAAAGAGAGCGGCCCGTCTATAAACTATTGCGCTCAGCTGGCTGG
GTTTCTGATTCGGCCTGTGTGTGTGTGTATGGGTATGGCATGGGTATCCGTATCTGGCTC
TCCGCTCGCTGCATTCGCTGCTTTGTAACGCGTATCTGTGTGTCTGCTTTTGCTTTTCGA
CGGCAGTGTAGTGGTGTGGAATAGTTTCCCAGTCACTTGCTCTAAAACTGCCACAGCAAC
TCGCCAACTCGCGACTGGCAACTGCTAAATGAGCTGGAGTCTCCGACTTGGTCTTCTGTA
TCTCTATCTCTAGCAGTATCTGTATCCCTGTGTTTGTGTGTGTCTTGCACTTGTTACATA
CCCACCTATATATGTGCGCATATATATACATATATCTGGTAACCCTAGCCAACAACTTGT
TTCCTCTATTTGACTTTTACACGGGGCGTCGTCGTCAGCAAAACGACTCCCGGGCTGCTG
CTGCTGTTGCTGCCTTCACTTTTGCCAAAGTTTACCCCACTTTAGTTTGGGTTTTCGCTT
TGATTTTGGCTCTGGCTTTGGCTTGACTGGAGCCCTGGGCTTTGGATACACACTAAACCG
CCACAAAACGCTGCCTGCCAATTGCAGTTCTTGGCCAAGTGGCTGGCGGAAATGCTTCTC
TCTCGCATCTCACATCTGGCCAAAGTGGTCGTCGCCAACAGATTTATGCAGTGTGGGAAT
GGGGATTGGGGAAAAATGTGCAAGTAAAACTAATGTTCTTCTTGCACATGGCAAAAAACG
AAAGTAGAATTCCCAATCCTAATCAAGTGGAGAATATGTAATATACACATTAAATGTAGT
AGTAAATGTTCTTAGTATATGTATAAAACAATTCGAGTTCTAATCAATTAAGATGGTTAA
GCAAATTTACATGTTATTAGCAGTACATCCAATGCAAATATTATCTAAAATAATATTTGA
TTAAGGTAAAATTGAAAGGGGCAACTACTTTTCCCAGCCAGATGGGAAGCCATAAAAAAA
AGATATATTTTTTGTGAGCAGGTGTCGTTTAATAAGTATCTAGTTAAAACTTTCAACAGC
ATAAATTTATAAATATTTATAAAGAAATGAAAAGTATTAATAATGGAATATACAAATTTA
GGTAATTACATGATGTTATAATGGAAAGTTCAGCTTTTCTTAGAACACATTGGAACTAAC
CCTTTAATATGGATACAAAGATATTTAACTCGATTTCCCACGAATTGCTCGGCTTAAAAT
GATTGGTAGTACGCAAAATCTTCAACTGGAACCCCACTTGACCGCCTCGCTCCAAAAACT
TGCAACTTCTGTCGAAACATTCCCGTCAGTCAGTAAATCTCTCGGCTTCCTTTTCCTTCG
TTTCGGAGTTTTATTATTTATTTTTCGCACACAAATTCCTAGATGATATATATTTTCCGC
TTGCGACACGACGAGCATTTTCATCTTTTATTTATATGGGTTTTAACCTTTTTCTGCTTT
TTTTTTTTTCTTTTTTTGTGGCTGTTTGTGTGCTTTCCTCATGACTTCATTTTGTGGGGC
TTTGTTTTGGTTTCTGGTCTTACCTTCAACCTTTCGACGGCAGCAATATTGAACCACCCA
CACATTGAGGCAGCGGAGGCAACTTTCAATTGCGACATGCGGCGGAGAGCGGTGTCCTCT
CTTTACCGCTGCCACTGCCCCTTTTCCGCGGCGTTTCTTTACATGACAAACCAGCTTGGA
GCGTCTGTGTTTGCTCACTCGGCGTCTCTGTGTGTGTGTGTGTGTGTTCGCGTGCTTGTG
TAAGTGCGCTGTGGGAAATAGTGAAAAAGAGCGCCCCCTCCGAATGCCGCCCACCGCCCG
CCACCCAACTCAGCGCTCTGTTGCTTTTTTTTCAGGCCTAACGCAAAACATTTTGAGGTA
GGTTGGGAATAGATTGGCAACAACTGCGCGCACGCACACACTTACATGCCATCGCACACA
CACACACACACACACACAGAGCGTGCGCGGAAAAACTTAAATTTCTCGTTTCGTGGCAAG
AAATTAGCAAATGATTTTCCATTTTTTCTCTTTTTTCTGCCTTTTAACCCAAATACGGCG
GTGGCGATTTTTTCGCATTAGAATTATGTAAGCCAATGCCCCATATATGAAGTAGGCCTA
TGCGATACTTACACAAGTATCTTTCTCCGGTTTAGATTTTGTAATCGCTTTTGCTCTCCG
CATAATTGGCCAATGGAGGTTCTGCTCACTCGCAACTTATCTCCTTATCGGTAGCCAAGG
AGAGACGCCGAGTCCCCGATTCCTAGTCGCAGGGATTATGTCACTAGTCGGGCAACGTAA
CTCAATTACAAAATCGGATTAGCAAATGCAGAAAATCCGAATTCAGCAAATATCTCCCGT
TCGCAGTGCAGCTGATGTGGTGTGGCCATATGGTCACTTGATAGCCACAGCCGAGTCCAA
TAGGTCGGGTCAAGGCCCAAGACTTGTTGCTGGGAAATTCGCGACAACGAGTCGTATACG
TAATGCGGCTACCTAGAACTTGCTGCGCTAGCCGAAATTTCCGTTTTTGGGGCTGCGGTC
TCGGATTCTTGGTAAACCAGCTGCAAAATGCAACGAAAGCCCACACCATTCCGCATTTAA
ATATATTTTGCTTTTACAATGAGGAAACTTATACTTAAATTTAAAAGTCTATTGATATAC
ATGCCACTCTTTTCGAATAAATTACATTTTGAGGTTTAATCATGACAGCGCTTTTTCTTT
TATAAAATTATAGTTGTAAACTTCCTGATTAGCAATTTAAACACAAAACAATTATCTTGA
CAATATCGGAGCAGAATTATAGTATTCACTACCAATTAGCACTTGTAACCCCCCAGAAAG
GTTGGCGCGTGACCAAAAATGTTTATTTTTTCACGCATAGAAAGTGTTAATATAAACAGA
AGCTACGAGAATTTAGACAATATTCGACTGGTAAACGAGAAAAAAAAAACTTGAAGTCAA
AAATATAATATAGCCAAGCAGGAGCCATTTTTCATAAATTAGATATACTTTATAAAATAC
AAATATTAAACGAAATCGTTGATACTAAATTATGCAAATTAAAAAATGTTTCAAACCGAC
ACATTTGTTTATAAAATTAAAAGAGTAATTGCCTGCTCAGAATGCGACATATCATTAACG
TATCTCTTAAAACATAACCCAGTGCATAAAATAAAACGCATTACAAAATCTCATTTAGGC
AATCGCAACAAATTAGAAAGGCATATAAAACCATCTTGTCGAGGGGCAAATGCGTCAATC
TATATGCATATTATACCACACCATAAAACAAGTAAAAGTACTTAATGACAAATTAAAACG
AAAGATTCAGCCGAAATAAAAACAAATCATCGGAAAGTATATATAGAATTACATTATATT
TCCTTTTGTGCGATACGAGAAATTTTCGAGTATAGAGAAATAGCGGTCATAAAAAATGCA
AAAAACAAACGAGCGCAGCAAAAACAGAAAAACAGAAAATCACACAGATCGCAACCGAGT
CGCGTATCATTTCTTAATGCGGAAATATTGAAGAAGAATTTCTGTTGTCTATATAAATAC
GAATAATGTGCGTTTGTGTGTGGACTTGTATTAACTGCATATGTAGCCCTAATAAACACA
CATTTTCGTACGACAATGAGAAATTGCCTGATATGCATATGTCTCGCTGCCTGCGCCTGT
GTGCGTAAACAATGAGAATCCCGTGTCCGTGTGAGCAGTGTGTCTTTGCTGGTGTGCGTT
ATCCGCGAGACCTTGAACTTGAGACTGAATTTCCAAAAAGCGCACACACACACATACGCG
CGCACCGAAGAAGCGAGAGAACAACAACTGGCTTTTATTCTGGCCACCAATACACAGGCA
GTCGTGAAAGCAGCGAAGTTGGCAGCGGCATAAAAGCCAAAATAAGGCGGCAGAACAGGA
ATTTAGAGAGCAGCAGAGAGCCGCCAAGAAAGAGAGAGAGAGGAAGAGAAAAAAGGGGAA
TGGGAATGGGAATGGGAACGGGAACGGGAATGGGACTGGGAATAATGGGGATCGTGCAAA
AGCGAGGCAGACGGAACCCAAAAAAAATATATTTGTAGTACGTACACATAAAAAATTGGG
GAAGAGACATTCACACCAACAACAAATACTACAATTGCCAAACAAACACATAAATTATAA
TATTTAAATATAGAACTTTTGCGTTGTTGTCGCCCGTTCCTGTTGATTTTGCTTTCGACT
CTTTGTGCATTTTACTTTCGTCTGTCGCTGCTGCATTCGAATTAACTTGAATTTTGCTTT
CTTCCACACCCATAATTCTGTTTGCTTTTTTCGCTTTTTGCACTGCCATAAATTGTATTA
TTATTATTATTGAAAATAAATAAAGAAATAAATACATATATCCCAGTTGGGGAACATTTT
GATTCCGGTTTGGCGCATTATTGCGCCGCACAAGTGAAATTATCGATACAAAGCAATTTC
TAGTGGCTGTCGTTTTTGGCTTCAGCTATTCGGGGAATTCGCCTGGCATCCGTCACTGGT
ATTTTTTAATGGTTTTTTGTTTTGCTAAATAGAATTTGAATATGTTTTTTGCGGGCTAAC
AATTGGGGCAAGGCTAGTTTTATGATTGATTATTAAAGGAAGGGCGCACATTTAATGTAA
ACAACATAAAAATGCATGATTAAATGTACTAGGAAGATTTGCAAATTGATTTCGGTATCT
AGAAATCTTTAACGCCTTAACTGAACACAGAAAGTTAAAGATAGATATTTATCGAAAATA
GTTAAAAAGTGAACTTTCATTTGGCCATAATATGCCTTCAGCTCGTTTCCCCCGTAATTC
GATCGGCCAAAACCAAAGCAATAATTTCAGCCAACAACTCCCAAGTATACAGTTTCATTT
GCCTACTTTCCACTGATTAATGTCAGATGAAAATACTGGATAGGTGATAAAGGCTGAGCT
CAATAGGTAAATCCCCCTTCAGCTGGGCCCACACAGAAATCACTTTCCGTTTCTTACAAA
ACCGCCCACAACTCACAAGCTCACAAATGTCGGTTGTTGGGCACATCAAAAATAGGCCAA
TAACCAAAATGCCATAAACAATTACAAATTGTTGTTGCTGCTGCTGCTGCTGCTGATGGT
GCTGGTGTGCAATTGTTATTGCTGTTGTGGGTCGGACAGACAGGCGGGCAGCTTCTACGG
CTTTCGGAAATGCTATGAAAAATTGTAAACAAAACTCAAGCACCACGGATGACGCCTTAT
CCACCGCACAGCCGAAAACAAACCCAGCCAAACTGAGTATAAAAAACAAAAAGCATATCG
GCTCTATAAGGCGAACTAATCATTTAGAGGTAACAAGCAGGCAGCGATGGCTCGTACCTA
CATTGACCTACTATTGCGGCAAATGCTGCGCTATCCGCCGGAATTGTGATGTAACTGTCC
CAAAATGCCGCGCACATATCAACGAGCCAGTTCGGTTCAAGTCCAAATTCGAATTCAACA
AAGAAAAATAGCAAAAACCCACCAGCTCACATGCACATGACTTTACCGTTAATTTCTTTG
ACATGTCTCTCTGTGTGTGTGTTGTTTTTTATTATTATTATTTTTTTATGTTGTTTGCCA
ATTTTGCTTTGTTTTCTCGTAATATATTTAATTTTTTTCTCTTGTATTTCTGTGTGTTTT
GTCGGTTGGTTAGTTTCTGCTGGTTTTATTAGACCGCATTTTTAGAGGTCAGCGCACATT
TGGCGCAGCATTGCAATGTTTTGTAGACTCTATTACCACTGGCTATTTGTCTTTCTTTCT
GCCGTGTTTGTGTTTGTTTATGCACCATTAACGCTGAACCTCTGGCGGTCTGATTGTCGG
CTTCTATAGCGTTGTTTTCTTTTCCATGGTGGCGCCACAAATGCGGTACAGTGAAAGCTC
GGCGGAATAAACGGGGGAAGACCGATGAACTTCTTCCAGGAAATCTAAATTCTTCGCCTT
CCTTCCGTTGTTCACCTAGGCGTATACTTAATTTGAACGCTCGTATATTACCCATACGCC
TAATATGCCGCACAGGAAGTAATCGCACACGTTTCGTTTGCGCAATAAACTATTTCAACG
GGAATAAATACAATAATCTACTTTTGAATTCTCAGGAATTTTCTAGAGTCAATACACATG
TTGCTTACAAGTTGCAGTTTACGATCAAAATACAAGCTGTTGACACGCGGAATATGTGCT
AAAAGCACGGTTTAAATACGACTTCCAGCTTTGAAGTTGCCCAACAACTATTTCATTTAA
CCATTATATATTAAACTTTTACCTTAATTTGTAAAAAATCAAAAGTAAACTATATGCACA
TGAATGTTTTCATTCTGCTGTAAATTGATTTAGACATTTCCATGTCAGTCGTTTACCATT
TAGAACTTTAACTTGTCGGCGGCCACCTGCAACAAATTACGCATACGCCGCGTTGGCCGC
AGTAAAAAACAACACGTGAGCACTTCCCCACGGAAAAACTAAAAGAAAAACGTAGACAAG
CGAAAAAAATCGAGGCAAGTGACGGGCATTTCCGACATTTTCACTTCGACAAGCGATTAA
AGCACCAAGTAAATAGAGGGAAATTCTCGCAACGAAAACTTGGCGAAAATAATATTTATA
ATTTCCGTTAAAAAGCTGCTGCTGTTGCACCAGCAGGCCAATTGTCGATGGCCGAGGGGG
GCGAGGCGGTGGGTGGTTAACCAATGCAACCGCACAGCTGTTTTGTTGCCGCGCGATTTC
CGTCACGACTTTGGTTTTTTATTTTTGTGCTGCGGCTTTTGAATTTCTTACATATCAAGA
AAATATATGGGTATATACATTTATATATATGTATATTTTTACATGCTTCTCATTCACCCA
CGACGAGTGGAGCGGCAATCAAAACGAGACAACTGCGTTGCACAGTGGGTCAAATGGCCT
ATAGGACAGAGTAAAATAATAAACGTTTTTTACAAGAAAAAGGTCAAAATATATTTATAT
ATTTTTTTAGATTGTATTGCTTTTGAAAACAAAGGGTATTCAAGTACTTGTACCTGCTAC
TTTCTCCTATACAGTGATTACCACTTCCACTTTTCTTGGTGGAAATGATATATCTGCAAA
TATATGGAAAATGGTTAGTTTTACACCGCTTTACGAGGCATTATCGGCCAGTGTGCGAAG
TCGGCCGGGCTGCCGTGTATTTAAAAAGCTGTAAAAAGCACTCGCACACAGCGGCAACAT
GCAATAATGCAGCCAGCAAAGCATAAATTGTAAACTCGTCGCCGTTGCCGACAAGCCTTG
ACCTGATTTCTCTTCCTCTCTGCTGCCACTCGTCTGGGCTTGTGTGTGTGAGTGCTTGGC
GTGGCTGTGTGTGTGCGCGTATCTGTGAGAGTGAGTGTGCTTGCAAGCTTCATTGCTCCG
CTGGCTTTGACGTTTTCCTGCACACTGCAGTTGCCGCGGATTTGATTCGTGTGAATGTGT
GTGTGTGTATGTGTGTGTGCGTACCGCTTGACATTCAATGCAATTTTTTTTGCCTCTGCT
TATTTTCATGCCGCTGCTGCCAGTGCTGCCGCTGCATGAAATAAGTGAAAATGCACTTTT
ACTTTTCAGCTGCAACAACAACGGCCAAAGGAAAGTGAGAAGCTAATTTTTGTTGCCTTT
CCTCTGGCGTTGTTTTTAACGGTTGCGAGTTCATGGCTCACCAAATTGGGGCATTTCAAT
TGTTTCATTTCATTTCGTTTCGTTGTATTCGTTTTCCTTTTTGCATATCTCGCTCAACAT
GACATTTCTATGAAATTATGATGCGAATTTTTGTATTATTAGCTCGTTGGATAGGCATTT
TTGACAGCTGTGAAGAGGACAGGGGCGTAGCCAAGTGGTTGGTGGGCGGATTAAAGGGGA
TTGAGGGGACTGAGAGCCCTGCAAAGCATTCCGTGATGAGGCCAAGTATTCGTTTAATTG
GAACAGCAACGGCATCTGGGGATTCGAAAGTATGCATTATTCTGGTGATTGAAGCAATCG
CAAATTTAAACTGATGTTGCTGAAGGATGCTTAATTATTCAGCTAATACCTTTGTGGATT
TTTTTTATATACATACATATATGCATAATTAATTTCCAAAGAAATGTATAATTAATTAAA
TTTTGTTAATGAATTCATAATCTAGTGAATTTGGATATGTTTTATATTGATATTTTTACG
GTTTTTCTGTAAAAGCTAGCTTTATATATCAAATCACATCAAGGATAGGATAGGAATTCC
AGTCTAATGACATTAACTTGGCAATAAAACCTTAGATGCATTTTCAACATCTTAACTTAG
AGATGTATTTTCAACCACCTCCTCCTTTGCTCCTTCATTTCAGACACCGAAATTCCTATT
GTCAAGCAATCGACAAGTCCGGCACCGCAGCAGCAACTGCAGCAGCAGCACCACCTGCAA
CAGCAGCAACAGCAGCAGCCGCACAACGGCTCCACCTTCGCCGGCGCCACCGCTCTGCTC
CACATAAAGACGGAGCAAAATACGCTGCTCACTCCGCTCCAGCTGCAGCAGCAGCAACAA
CAGCAGCAGGGTCTACACGGTGCGGCAGGCAACGGAGGCAGCAGCAACGGCAACAATGCC
CACCAGCAGCAACAGCCGCTGGCCATCCCACAACGCCCGCTGCTCCACAATCTGCTTAGC
GGCGGTGCCATCCACAATCCGCACCACAGAAACTACACGACGGCCACAACAGGTGATTAT
ACACAAGGCAAATTAATGTCACATTCTAAAAGCAACTTGATCTTAAAGGATATGTGCAAC
AATTTGTTAAAATTGATTCAAAAACTTTTTGATTTTGATTTGAGAACTTTTTAAAATTTT
AGAAACTACAAATGTAATGTTTACTTACATATGTACAAAGTTGTAACCCTTAATATGCAC
CAATCTTTGAACTAACTTTGCTACTTTAAATTAATCTCGAAAGTCTTTATTAAAGTAACG
CTGCATTTAAAATGACATTTAATAGATAACTTAACGTCCGTATAGTTTCGAATGCATTTG
TTATAACAATGCCAGTTTCAAGTTGAAAGAGATCTTGTTTTTTCGAGTGCATTCAGTAGT
GAGGCGAGCGTGTCCAGCAGCAAGGTGAACCACTGCACACGCCCTCGACTCGATTCGAGC
CATATCGATTGCTAATTGCCCCTTTTCTTGGCTCGTCCTCGCTCCGCGCGGCTCTATCCC
GTTCGCAGGTTCATTTCCGCCCAGTCCCGCGGACAGCGGCGTCTCCGACGTGGACAGCTC
CAGTTCCGGCGGCCAGCCCTGCGCCGACGAGCTGAAGGCGCGTCTCGGGATGCCACCAGC
CACCTCGGCGTCGGCAGCGGCCGCGGCAGCAGCGGCGGCGGCGGCAGCGGCACACCTGCA
CACGGGCACCTTTCTGCATCCGAATTTATACCAGAACAATGCGGCAAATTCGCTGCGGAA
CATATGGAATCGCAGTGTTGGGGGTGAGTATCGAGTATGCCTGAGAAAAACGCAACCAAT
TCCAACTGTGTGCTTAAGTTTAGAACTGAGTTTAAGGGCTAGACTTATAATACATTTTTT
ATACACATCAAATTGGGAGTGTGTGAAACAAGACAAGATGGTAAAGGGACTTAATGACGT
CAACTTATAGTAAGAATTTGAATTGCAATTTTATTTAAATTTGCCTTTTTAAGACTGAAG
TTTTGCACACTGCTGCCTACTTACCTTAGTGCAGTCAATGTTTACGATTTAGACAGGTAC
TAAGGATTTTACACATAATTGGCAATGAGCTAAGATTAAAGTAAATCGCACAATTATTTC
GGGGATTCGATCTAAGCTGAGAACGGTTTTATCTCAACCAATTAATCATATGACCTAATG
GGGAACTTTGCATATTGCAATCAATTTGAAGTTGGTATAATCTGTTGCATACATAATGCA
CTCCTAATCCAGCGTACTCTTTCCTACAAAATGTCAGGCAAGCAAGGCGCACGCACACAT
ACCCATGTACGTACAGCACAATCAATTGCAATGCGAATGTGTTGCACTCGCTGCTTTTAT
GCTCTCTGCCAACTGAGTGCGTGAGTGTGTGTGTGTGTGAGTCCGTGTTGCTGTATAAAA
TCTGTGGTCATCGACACATTGCCTTTGCGCAAATTGTGAAGGTCACAACGACAACGACAA
CGACAGCAACAGCAGCAGCAGCAGCGCCAATGTGGCAATAATGCTGCTCGCGAGAGTGCT
CCACTCTCTTTTCCTCCTTCTCCCGGAGAGGCGGAAAAGAGAGAGAGAGAGAGAGAGTGA
AAGAGTGCCAAACACCAACGCAAATGCAACAGCAACACGAACGTGACACATGAGCAACAC
ACGAACAACACAGCGTGCGTTGCTCTCTGTGCGATGTGTCTGTGAGAGAGTTGGTGAGAG
AGTGGCGCTGCTTACTTTTGTTTTTATTCAGATTCAGCCCAGTCTTTCCCCACTCTCATC
CTGTCCCATGCCCCTGTGCCCCCCAGCCACACCCCCCGTCTAAAATGGTCCACCGAATCC
AAAGACGACTGCGAATCCAAATCCACTGACTGCCAACTGGCTGAGCCGCGAAATTGGGCA
ACGCCAACGCCGGATGTAAAAAAAAGAAAAAAAAAAAACTTACTAAATAGCATACAAAAT
TATACCTGTGCCACCACACAGAAACAGAAACAGTGTGAAATAGTCGCAAGCGATCTGCGA
TCTGGGTACAATGGGACAGAACGGGTTGCCACCAAGCAGATTCATTTGGGTATATTATTT
CAATTTAAGTTTAAGTTTAGTGCACGTTCTTGGATGTTGCATATTTGGGTACTTACCTTA
TGATATTAAGCTGTAACCTAAAAATTTAAATTTTAGCTCTGACCCTTTTTTATACTAATG
AGTAAATAACTTTTAACGGAGTCTAAAAGTATGCTACAATATATGAACATATGTGCATTG
AAAATCACAAAAGTAGCATGTCTGTAAGCAACACGAATTTAAAAAATTTATTTGCAATGC
ACACAGCTAGAATGATGGTTACGAAAATAGTTTCAGGAAAACTTTTAATTTGATGCACGG
TGATTAGTTGATTTTAACTATGAACTGGTATGGAGAGAAAGGACAGGGCACGTGGTGATA
ACGTGGGCTATGATGACATTATAATGTGTTATTGCACGTAAAATTTAATATATAACTAAA
GTGGTCAACTTCAAAGTTTTTAGCGGAAATTGGTGGTTTAAGTTGGGGAAGCTCACCAGT
ATATTCGTTGGTTCAGCAAGCCGCTTTTGTTCTCAAGTACTCATTTATATATTTGACTTT
GTTCTTGCAGTGCCCGACAACTACTACGGAAGCAGTGGCGCCGGCAGTGGGGGCACCCAG
CCAGGTGGTCCGGGAAACCCCCAAACGCCTGGCTACCTGACAACGTCCTACTTCAACGCA
CCGACAGCGGCAACGGCAGCGGCGTCCCAGCGAGGAACCACAATCAATGGCTATCATTCC
CTGCACCAGCAGCAGCAGCAGCAACAGCAGTCGCAGCAATCGCAGCAGCAACAGCAACTG
GCCCACCAGCAACTGTCGCACCAGCAGCAGCAGGCGTTGCATCAGCAACTGTCGCACCAA
CAGCAGCAGCAGCAACAGCAACAGCAGCAACACCCGCACTCCCAACTGAACGGTCCGCAT
CCGCACTCACATCCGCACTCTCATCCGCATTCGCATCCGCACGCGGGCCAGCACACGCAT
TCCACAATCGCTGCAGCGGCGGCAGCGGCAGCAGCATCTGTCGTCAGCAGCAGCAGCAGC
GCCGTTGCAGCGGCAGCCATGCTGAGCGCCAGTGCAGCGGCAGCAGCAACGGCGGCAGCT
GCGGCGGGCGGATCCCAGAGTGTTATCCAACCGGCGACGTCCAGCGTCAGCTACGATCTC
TCCTACATGCTGGAGCTGGGCGGATTCCAGCAGCGGAAGGCGAAGAAGCCGCGCAAACCG
AAGCTGGAGATGGGCGTAAAGCGGCGCAGCCGGGAGGGATCCACCACCTATCTGTGGGAG
TTCCTCCTCAAACTGCTCCAGGATCGCGAATACTGTCCGCGTTTCATCAAGTGGACGAAC
CGGGAGAAGGGCGTCTTCAAGCTGGTCGACTCGAAGGCTGTGTCCCGCCTGTGGGGCATG
CACAAGAACAAGCCGGACATGAACTACGAGACGATGGGCAGGGCGCTGAGGTACTACTAC
CAGCGCGGCATACTGGCCAAGGTGGATGGCCAGCGGCTGGTCTACCAGTTCGTGGATGTG
CCCAAGGACATCATCGAGATTGACTGCAACGGTGTGTGAAGTGATGAGGACGAGGAGGAC
GACGAGGCCTGTAAATATAGTTCGATCCCAGATCGCAGACGGATCGAGCTGGAATGGCAA
TAGGTTTTGGGTGGGGTATAAATCAACCGGCTAGCGGCAATAGTGGCTGAAGGCCACGCG
AGATAGGGATTTCTTTGTACATGCGTTGAGTTTCTTGGTTAGCCAGCGATAAGCGTAGGT
TACACACATAGCTGATAGTCCCAATACGCGTACATATACTTATATATATATATACATATA
TATATAAATATATATTCACACCCTGTGTCCTGTACCCTATACATACACCCAGCTAAATCG
ACGGTAAATAATGATCTATTCATGGGCGTTAGTGTTGTACTTGTAACTGTAGATTTAACT
GTAAACTGTAACTGTAATGAATATTGTTATTATTGGTTATTATTATTATTATTATTACTA
TTACTATTATTAATATTATAATTATTATTGCTACTGCTATGGCGGAAGGAAGAGGACGAA
GGACGACCGAATTGATTCATATTGATATTCGATAGATGTGTGTAATATGTAAATGAGTAC
GAACCCCTATAGCTGCAAGAATTTCTCTATCTCTATTGATCTAATGCTAAATCTAAATGT
ATATGAGTATGTATATGCCTAGCCTAATGACCTTTCAACTGTCCCCTAGCCCAACCCGCT
GCCCGAGGACAAGCTCAGTGCAGATGCAGATATGGGTCTATGTATGAACATATGTATACG
GAGATCTGAACGATCTGCACGGGTGTCTGTGCTTGGGCTAATTGTTTTTGTTGCTTATTT
TATAAACGAAGAGAGATGGAAATTTATTATTTCATAGTTTTAGCTATTTGTACGACTACG
TTTAGGATATTTATTTAAGTGTTTCTCCAGCTAATCCCCCGAAACTTTCCCCAAAACAAC
AAAAACACACACATCCTAACTGGAGCTAAGAACCCAGCAAACTGGTGGTCTAAACTTTCT
TGTAATTATTATTTGATAAGTTTTGTATATTTACAACATCAACAGCAGAAAAGCTCACAG
GATAAACCCGAAGAAGGCACTTCTTGAGCCCTCGTTTAAGCAGTCTTAGAACACCAAACC
AAACTCAAGTCTCTCGATCTGAAGTTTATTTATAAAGCATAAAGTTAAACTACCGTATTC
TTGTTAACGTCACACTGCCACAAATCGAAACAAGCCTTACATAATGGAACAGATCTGGAC
ATTTAATCGAACCAAACCGAGATACTGACCCATAGTTTCAACAATACTGCAACCGCAATC
CTCAATGCAATATACCGACAACTTCTACAACAATTTCCAAACACTGCCCAAAACGTGCAA
TCTCTTGAAAGGATACCTTGAATAGGAAAGAGAATAAAACCAACTCCTAGTTCTTTAATC
TAATTCTTTAATAGTTGCGTTCTCTAAGTACCTTTATCTATTATTATTATTATTATGTGT
ACGTGAAGATGAAATCTACAATATATCATTTTGTTTATGATGATTGGTGATTGATGATGC
AAATAAACAAAGTGAGTCTTGAGTTCAACTCTGTTCATTGTAAACAATTTTTTATGATTA
TTTTTTATTTTTTAAATAAAATTATTATTTCAATTTGTGCATGCGTTTTATTTACACATT
CGCAAACCAAACACACCAAAAAAAAAACAAACCAATATAAAAACCGAATGAAATATAGAA
CGTAAGCAAAGATATGATACAAATATATGGAACCCGCTACAAATTTGGAATCTAGATATA
CCTCCCATGAAAAGTACATAATGTTGCATAAGTTACAATATATTCAAAGTCTATATAGGA
TAGTCGAGATTCGGATTGACGATATTTGAAGTCGAGATCACATATTTTAGATAAAGTCCA
GTCGGTGTATTTTGTAGTTCTAAGACACCATTTCACGAGGTCTCAGTTTATGAGGTTTCC
CCCAGATCATGGATTTATATGTATGTCTATTTATTGGCGTAGATCACCGCATCTACCATT
ATTACCTAGCGTAAATCAGTTATTAGTTGTTAGGGAATGAATATTTAAATGTTATAAGAC
CTTAGATATAAGCACACCCACAACAAGAGCAGCATCGAACCAGATATGCAAAAATCACGA
GTCGAGTACAACGAAATCGGTAAACAAGAATCTGAGCCACAACCCGGATAATGCAGCTTT
AAATCGAGATAGTACATTTAAATTTCAATCTCCTATTTCCCAGAGAGCTCTCCTTTCACT
TCGATAGCCTAAATCAGTTGGAGACTCCAACCCGAAAGCATTTATACATGCTAAGCACGA
TAATTGTACATATACAACTTCTGGACCTCATGACTCCACTCGATTATAAACGTATTTTAT
ATGTATACACCAATTATTTGTTAGATTGGATAACCCCGAATGGCTGGATAAGACCAACTA
AATTATATGCAATAGAATATCGATGCCGTTGGGCAAGATTTCTATGCTAGGCTAAGGCTA
AGACAAGATATCTTTCTATTGGTAACTCAAAAACGAAACGAACTATATAGCTTTTAAATG
GAAACGTGCGATTATTCAAAGGTATTCTATGCCGCCTGAGAATAGTAGAGATATGGATTG
GCCTAGATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1657, 16925..17633, 20875..21487, 21840..22121, 22341..22848, 54583..54951, 55448..55702, 57550..60150
21401..21487, 21840..22121, 22341..22848, 54583..54951, 55448..55702, 57550..58535
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved