Drosophila_melanogaster Locus CG12316
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG12316
Drosophila_melanogaster
CG12316
3L
snoRNA:MeU5-U42
2698..2808
6850
TTCGATAGTTCCAAAAATATCGATACTAGATACCGAGGACTAGCAGCTTGTGTAGTGCT
GTGTAATTTAGAAAATTATGTATTGTTCTCGTATTTCAAATTTCCTGTTTATACAGTAGC
TTATACTGATTAAGGAACTTACAAAATTTTCTTTAACAAAATTAAATATTTCGATGAATA
TGGTTATTGCGTTTCGAATAAAAATAATAGAGTCCTAGCTAAAAAAAATACTGTGAGAAA
TTACATTTTATATATATTATAAATTTTAATATAAAATATACAAAAATGATAATACTATCT
TGTAGAATGTATTGTAGTAATTTGCTTGTGCATCGGTACGATGAAACGTCCAATTATTAT
TACCGAGTAAAATTCGTGAATTCGTGTACATGTATCGGCAACAGGACGACGCTCTCCAAC
ACTGCCAAAAAAAAGACGGCATCTGCTGGCTTCGTTTCCACGTTGTCCTGAATTACGCAT
TGAGATGAAACCATTAAAAAGTGCACTTGAATATTTGGATAATTACGTACGGCGAGCTCA
TGAAACACACCTGCGAATAAAGCACATATTTCAGCTGATTAGATAGTATTTAATTCAGAA
AGGAAAACAAAGAGCGACGAGTCCTGCACCACATCATGAAAAGTGAGAAATCACGATGTG
CGATTAACGGCATCTGCGCACCGCATGAACGCAATATTCATCCGACGAAGCTCTTAATCG
GTACTGCTCCTGCCCGAAATACAAAAAGTATATATAAACAGTGCACATATTACAAAGATA
ATATGTTTGGACCCGCTCAGGTGTGCAGTGCGTTAGTAACTTGCCGCGGCACATCGAAAT
TGCCCGTGTAGAGCGTTCCTTCTTGGAAGAAATACACAATTTTTGGTAGGTCTTTCGGTT
TTTGGTCATTTGTTCGTTTGGGTCGGGAGTGGTGAAGAGGCAAGGGGGGCGCTCCGACTT
TCACTGCAACAACAACGAGTTATTTCGGCCCTGTTCGATTTCATCAATTTGCATGAATAC
CTTTCTTCAACTGTTTTTCCCCTTTGGCTGGTAGCACCATGAGCTGCTTGGTCGGGAACC
GAAAGCGGAACAGCGGCAGCACGGCGGACGAATTCGACAAGGTCAGCACTTTGGCCAATG
CCGATGATACCGAGTGCGTATCGCCGGATCCGGGGCGGGAGCCGGAAAGCAACAAACCGG
ATTCGCAGACGGAGCCTGAGTTTGGCCATTTGAATGAGACGCGGAGGAAGATTCTCGATG
CCATTGCTGCTTTAAATGATGATAGCTTCGATAAGCGCATGGCCCGGTTGCTCATGCAGT
ACGAGGGGTAAGCACAAATATACATGCACATAGAAGCAACTAATACCAAACGTAATTAAT
CTTTTAGCGCCATTCGGGAAGAGTTTCAGCGGGCACAGTATTTGCCCCAGAAGTGCCGCA
AGCTGGCGCGAATCCTAACCGGCCTCACTGATGTCATCCACACTATGGTTCAGGGTCGAG
CGCTGCAGCGGGACGAGAGCTACAGGCAACGCATGTGCAATATTGTTGGTTTCTACATAT
CCTGCGAACTCTGTTCCGCTCAGGAGCCGGTGGAGAAGGAGGAGACCATCATCAACAGGA
TTAACAGCTGCCTGAAGCTCTACGTGGAGTACGGAGATGGTGGCGCCGGCGTCCACCGGG
AGCACGTGCTGCGCACTCTCCTCGCTGCACCCAAGCTCTTCAACAGAGCTAGCATTTTGT
CCATGCTGTACAGGTGGGTGGCTTTGTTCAACTCAAGTGAAAAAGATATATGGCAACTAT
TTACTATTCAATTTACACTTGTATGGCATCTACGCATTCAATGAGTCGGATACATACATA
TGTAGTATACAATTAAATAGTTTACAACTTCTTATCGACAGATCTCTCTTTGCTTTGTTT
ATAAGAGCTAATTAAAGAACCGATAAGCCATTAGTTTAAAGTGAAATGCTGAAACGCGGG
GCATGATAATTATGCCATGTGTTCTTTAAAAAAGTATAATTGGTTTTTTTTTCTTAAAGT
ACAGTTAACAATTAAACATTAAAATGGTTGTATTTGGCTTAAGTGGTGCCAAAACGTTTC
ATATATCGCGCTTCAATAATCTTTTCCTTATTTTGCAGCCGCCTCTTTCCCCACTGGTCC
GTTCCCAGCGTTATGATACAAGCAGAACTGCCAGATAAACTCTACATTGAATACATACTC
ATATTTTACTACTGGCAGCGTCTGGAGTCGGATGAGTCAGTCAAGGAGCGCATCGTGCAG
TTCGCCGAAAAGTTCATGAGGCCCTCAAGATCACTGGCCATAAAAAGTGTCTATGCTCAT
TACTTGCCAAAGTTTACGGACCAGAATGCCGCCACGCGGACCATATTGAATCATCTGCGA
ATGAGCAGTTGCACAAGTTTGCATGTGGTCAGCAAGGTGGACAATCGACCGCCCCAGTCC
AACGAAGTGGTTAGTTTGCTACTTTCACTTTCATGCAAATCTTCTTTTGAAAGATTAACT
TAAGTTAGCAACACCGTGAAGAAGTTAACATATTTGGTCTTATAGTACATACTTGCTGTT
GGGTTGTCGAATTTAGTTTTTAAACCATTACTATTACCCCAAAAATCTAATATTACACAA
ATGTAGCCTCACTGTGTTGCTCGTATTGGCTTAACTATGATGTCTTAGTAAAAGGTCTGA
TTCGGACAAGCGAGTGGGGCAAAAGCCACCGCCGGCGCAGTTAGTCGCGTGACGAGCAGT
CGCTGGCTTCACTTCGCTGTCCCAAAATGACTACAACCTCAACTGAGTGCCTAAGAACAC
TTTTTTATATGGGCATTGATTTCGAACGAATATTCTAATAATTCTTGATGATCTTCTTTT
GCACAGGTTCTCAGTTCTGATGATGAGGACAGCTGCCCGATGTGGGACATATCGGGTACG
CCGACATCATCAATTTACAATCATCCGCCCGTTTTCCTCCAGAATCTCTGTCAGAATGCT
CGCCAGTTGGAGCCGTGCAAGCGTGCCAACGTTTTGTTTAGCGGCATTGACAACTCCATG
GAGATTGTAGAGCTACGCGACTCTGACGATGACGTAGAGATGTTTTCGGTGAACTTTAAT
GTGCCTGCCAACGTAGATGGCATCAACTCGAACTCCAACTCAAACGACTCAGCTAATCAG
ACATCGACAACGATCCTCTGCGATGACGACTCCGTGCCCGTCACTCGAATCTATCCGAGC
AATCTGCGGACTTATGAAAGGACTGTGCTTCCACCCACTACCTACACAGTTCCGCGGATT
GTGAACAGCTATAGTTGTCGCCGGGATAGTCTCCATTTGGTGTCTACCACGGCGCCACAT
CTTGTCGATCAGTGTGTGCAAACGTTGGACGACGAGGAGCAGGATCTGGTAGAGGAGGAC
CAATACTCAGGCGCCCACAGCCACGGCTTCTTCCCACGAAGCAGTAATGCCAGCTATGCC
AGCGGACAACGAACCCCACTTTACCACTGCCGTCAAACTTCTAGTCAAAACAGCAACTGC
AGCGAGTCTTCGCTGCTAAAGAAACAGGTTACCTTCAGTCCCCGGCACTTGGGCGCGGCA
ACTCCGAACGCCAAGACAGGCACATCCAAGAAGCCATCCATTAAGCAGTACAAGCCATCT
TCGTCCAATGCCACAGAATCACAACGATGGAAAGAGGGTAAAGAAAAATAAATATACACA
TATACAATTACAGTATTATTAATCTGCATTTCTTATCCTTTCAGAGCACCGAAAGGCGAG
TGCGAAAATGTTTGCCAAACTGGACGCCAAGATCAAAGCCAGAAGTGAAGCTGAAAATGT
GTCCACCAGCCAGTTAACGCCCACCACTAGCAACGCCTCCAGTAGTACACCCACAAAGAT
CTCGGGCACACCCACCCGCATCCGGAGTACGCAACGAGGACAAAGAGTGGCGTTGCCCAC
GCCGCCAGCTTCCACGCACAGTTCGAGTAGTCCCTGCCAGATACGAAGCGCATCAACTGA
TAACCATAACTACAACGTCGATTCGGATTACAGTCGCCGCTGTTTCTCCAAGGCAGCTGG
CGATGAAGTGAGCTACTACAATCACCTGCTAACCCTGCAGCGCGAGAATATCCGACGACG
TAGGTTGAATAATCAGAAAAAGAAAAAGAATCGAAAAGTCAGCCAAAAGGTGCAAAAGAA
GGACGATAAGCTTAATATGCTGAAGCAGGCCACAAAGCGATGTCGGAAGCTTCGCGCCTT
AAATGCGAAACGGAAAAACGAGGTACAGAAACTGGAGCAGGATCTCGACACTATTCGGAA
ATCTGCACCGCATAAATTGCCTATAATAAGACTGAAACGTTGTAATCTCAAGACCCAGAA
ACGGTCACTCAAAGCTGAAGAAGCACCCAGTGTCCAAGAGGATATACTTTCTATGAACTC
TGATCGAGAATTACAGGAACAAAAAAAAGCGCAGAAGCCTAAAAGAAAGCGATACAAAAA
AGTGCAAAAGGAGCAAGAAAACGAAAAATATTTGCGGGAACAAGAAATTATAATATCGCA
AAGCCAAATGGTTGAGGAAGATAAAGTGGAGGAACACCACGCTCACGAAGCGCCAAGTGA
GCAGCAACGAGAGCTCGATCTGGAGCATCAACAATTTCTGGAAGAGCAGCTGCTACAGGA
GGAACATCAATTGGCGATGCACGAGGAAGAGCATCACCAAATGGATGATGAACAAGAGTC
ACACGAAGTAGCTCGTCTGCTAGAAGATCAGCAGCCGGCGGAGGGAACACATCTTCATGT
TGAGAATGAAATGTTGGCAGAGAAAGAGCAACCTCTAATAGAAGATGATGACCAGGAAGC
GGATGATCAAAATCAAAATGAGCACTTATCGGATGATCAGCAACAGGAAGCGGATCAACA
GCTGTCTATAGAGCAGCCTCAGGAGCACGAAGAGAATCAGTCACTCAGCCAAGATCCGTT
AGACGAACAATGTACGCCCACACCGAACGGCAAAAGGCGCAAGCGAAGACGGCGATTCAA
GCGACGTTGTTGGACGCACGTAAAGAATAAGAAAAAGAAGCAGTGGCTAATAGATTACCC
ATTGGAGTTTGAGGCAGATCCCGCGTTAGATACCCCTCCTATTCAACCAGAGCCAGCTCC
AGATGAACAACAAGCCGAGCTAGTTACCGGGCCAGTTTCCGAGTCAGTTGCTGAGCCAGT
TGCTGAGCCAGTTGCCGAGCCAGTTTCTGAGCCATTTGCAGAGCAAATTGCCGAGCCAAT
TGCCCAGCCGACACCAGAACCCGCCTACGATTTCGATCAGGACTTGGTGCCCGAGGTGGG
CAATGAATTGGAGATTGCTGCTCCCATTCGCGTCGCCGAGGACGAAGACAGCACTGCGAT
ACTCTCGCCGTCCCACAACCTGGAACTGGTGACCAGCCACGTGCCGGTTTACTTGCTCAA
TGGAGAAAGTCGCGATGTCAGCACACCCCTGTCCAGCAGCTCTTACAGTGCCGGGGGGTC
AGAGATATATGCGTCGTCGAAGGATTTAGTTTAGGATCTCCCCACACAGACCAGTTGTAG
TTCCAGTTGCCGATCCAATCCCATTGATCTTGGCCTGCAATAGTATTTGTATTATTTTTT
TGAAGAAACGTCTGTAAAACTGTTAAATCACTGTAATACTTAGGTTTATTGTAGTTAATT
AGGAGTTGTTGAACGTTATGATTTTTAGCTTACATATATTTTGCAATACCCTTATCCCAT
TCAAGTCAACCCGAACCAAATCCATGTCAATTTTAAGAAATAACACGAAATTATTAGTGT
AAATTGTGCGTAAAATAATAATCTAAACAACATCTTTTTATCTGTCTGTTTTGGGGAGTG
GTTTGTTTCATTTCTTCAGAAATCGTTGGCAATTCACGTTATTCGTTTTGATCTCGTCTT
AGAAAACAATTGCATTTGTATAACATTAAATCAAAAGGCACAGCCTTAAACATCAAAGAA
AAATACCGATGAAATCAAAACGAATATATTTTCTGTGTTCATTGATTGCGAGCACGCCGA
ATAAAGTCTATGGAGAACAAGACCGGTGAATGTAGGCAAACTATTTAAAAGTTGTCGAAA
AGTATTGTATATATTTCACAGGTTCCAGTTACTTACTGAAACGACAGGAGCGAGTCTCGG
TCGAGGAACACCAACGGATCTACATAAAGAACACTCAGGTAACGCAGGTAAGGGAACTCT
TCCGCCGTCCGGTGGTTAGAGTTTCCGGTTCCACCTTGATAAAACCAAAAGCGACGGGTT
CATTTTCCTCTGGGAAAATCCAACAAACTCTCCAGAAGGTGGAAGTCCTAAACGTGAGGA
TCGGCAATGAGTTAAATAGGTTAGAGCGCTTTCGTAATCATTTTCTGGAAGTCAAAGAAG
CTATGAGCCGATCTCCGCGTCCAGAGGAGGCGAAGGAAAAAAACATGACTTGGAGCCAGA
GCTTGAAGGCGAATCAAGCGAAAGAGAGTCCTCTGTCCGTCAATAGGAGTCCTGCATCCG
GTTCTCAGCAGAAAGTTAAGTGGGCCAAGTGCCGGACCATCGCAATCGCAGTCACGGATA
ATTCATCAAACGCCAAAAGAGCCAGGGGAGGTTACTGTTGTAATTGTGATTATTGTACTC
AAGACATCCGAGGTGTGTACCAAAACAGGTATGGAACTACTCCCTGCTGCAACTGCAAGG
GCAGCTGGGACATGGGGTATCATCAACAGTGCTGTGCTTACGGTGATCTCTGTGGAGAGA
CCCCATTACCCCATCAGGGTACACAATTTGGAATATCTTATAACATGTATCCGCGTCCAA
CTTGCAGAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1326, 1387..1752, 2138..2468, 2886..3696, 3764..5850
1058..1326, 1387..1752, 2138..2468, 2886..3696, 3764..5550
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved