Drosophila_melanogaster Locus RpS4
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS4
Drosophila_melanogaster
RpS4
3L
snoRNA:Psi28S-3327a, snoRNA:Psi28S-3327b, snoRNA:Psi28S-3327c
2012..2151, 2189..2328, 2616..2755
4157
AAATTAAATGCATAGATTCCCGTATACAAGCATAACAAAATCACATTTAAAACATAAAA
CAAGCAAACATAAACAAGCGCGTAAATCCGATTGGCAAATTGTATTGTTGCCGCAGTTTA
ATTTATAAGTAGGTTTTACAGAATGTAATTAATAATGCCTAAAGAGCAAATTGTGCGTTT
GAAGGGCATTAACTAAATGAGAAAATAAACAAATGTAAAATTACCAAACCCCCAACTGAT
GTTTCGTTTAAATTTCGATTGCTTGTGTCTTTTTCAAATACGATTAATTGCGCACAATGC
AGCCCTGGCAATTATGGTATTTCTTTCAGGATGTATCCAATGTTTAGACTTTAGTAAGGG
TATTTTTTTTCGACGTAATTAAATGTGCTATTTTAATGAGGGTTGTCCATAATGTATTAA
ATATAACTTTGTTATTACTAATAAGGTTAATACTTATTGTTAAAAAAATTTTGCAAAATA
TAATTATATTTGATTCGGAACGATTAATTCAAATGCTGCATAACTCGAAATCGATTGAGA
CAATCCAAGGGAAACCAAACGTTCATGGTTCCAAAACTATATTATGGTCTATTGTGTAGT
CCCACCTTTGAAAATAAACGAGCAGCTTGTTATATACACACTGGCGTTCAAGTGTTCTTT
TAGCAGACCAGTTTTAATTACTAACCCTATATTTGAGAGACTTCTGTGTAAAAATAACTT
TACATTTGACTTTATTTGACATGACTATATAACAGTGATAAGACCTAATTGCGTGTATAT
AAATTCATATGAAAGTAAAATATTGTATATTTAAGGGTAGCCGATTCTCTCTATTAGAGC
AATCATCGGTTTATAACAATATACTTTATTTATATTCTCATTTAAGCATTAAATCGCGTC
ACAGCTGACAAAAGCTAATTGATACAGGGGCTGAGGAATACCCCCGATAATAAGGCATCC
TCGCAAAAGTAACCCTGCGCGGTAACCGCAATCCAGTATTTAGTTATTCGACGCCAACTG
CCCGCTGGCCACACCGCCCGCAAATCTGCCTTTTCCTTTTCCTGTTGTATTGCCCGACGG
ACGGTATGTGTATTTTTTGCAGCTAGCCACGTGCTAAGTTTTGTCAATGGAAGGCCCGGC
ATTGGGGATTTGCTGGCCACGGATGCGGCACTGGCAGTGGCGAGCGAATGCTGGCACAAA
ACTAACGTTTGATTGTTCTATTTGCAGTGATCGCCCGTTCAATATAGTGAATCAAACATG
GTGAGTATCTGTTGGTGGTGGAGATATGGTCACGATTGTTTGTCTTTGCCTTTGGAATAC
CTGACTAACGGCTAAAACCCACTTACACTTTGCAGGCTCGTGGCCCCAAGAAGCATTTGA
AGCGTTTAGCCGCCCCCAAGGCATGGATGTTGGACAAGCTGGGAGGCGTCTTCGCCCCGC
GTCCCTCGACCGGTCCACACAAGCTCCGTGAGTCGCTGCCCCTGCTGATCTTCTTGAGAA
ACCGCTTGAAGTACGCCCTCAATGGCGCCGAGGTCACCAAGATCGTCATGCAGCGCCTGG
TTAAGGTCGATGGAAAGGTCCGCACCGACCCCACCTATCCCGCTGGCTACATGGGTGAGT
TGTGTGCTCGGCAAGAGTGTGCTTCAAATGTGCTCCATACTAATGGGCTCCATTGCCCGT
TTTTTAGATGTCATCACCCTCGAGAAGACCGGTGAGTTCTTCCGTCTGGTCTACGACGTG
AAGGGACGCTTCGTCATCCACCGCATCTCCGCCGAGGAGGCCAAGGTGAGTTATCTAGTC
TGTGCTTCCAGAGGTTCCCGCTTTCCAACCATGGAGTTAAAATCTAAAATTATTAACTGA
GGTTTCATCCTCAACTAGGAATTCTTTTCATGCAAGAGCACTTGAATTAGATTCATCTAA
CTTCATCTTTAAAACATAAATAGTTCACCTATTTTGGAATACAAAATCAATCTTTATGCT
AATTACCGAAAGTAATTAACTTAAATATCGAAAGGGCTTTGTCGAAGACCGTTTTGCGTG
TAGAATAGTGCGCCGATTGGTTCAAAACGAAGCCCAAAGCAATTTTTGATACGACGGTCT
CTGATTCGACAAATCCCAGTTGATTCAGTAACTTTTACGTGCAATTACAAAAGAAACCAA
GGAGTATAAAGCATTATATTGTAATTCTGTGGGCTACGTCGAAGACCGATTTCCGCTTGT
TGCCATGTGTCTATTGGTTCAAATCGAAGCCCAAAGCAATTTTTGATACGACGGTCTCTG
ATTCGGCATTCCACAGTCGTCTGAGTAACTTTTACGTGCAATTACAATGCAATTAAATGA
AAGTGGTAGTGCAATTGTGTAGAAATAAAACGTCTTAAAATTAACCCACATTTTCTTTGC
TTCTTTTGCAGTACAAGTTGTGCAAGGTCAAGAAGACCCAGCTGGGAGCCAAGGGAGTTC
CTTTCCTGGTTACACACGACGGTCGCACCATCCGCTACCCGGATCCCCTGATCCACGCCA
ACGATTCCGTGCAGGTGGACATTGCCTCTGGCAAGATCACCGACTACATTAAGTTCGATT
CTGGTAAGCATCCGCTATCGTAGATCATCGTGTTCATTGGCTGGTTCGAAGACCACAAAA
CGCTCCTCGAAAGTTGCGTGGTTCAAAAACAATAAGCCAAAAGCAATTTTTGTCACGACG
GTCTCTGATGCGGCATTCCAAAGTCGCTTCAGTAACTTTTACGTGCAATGACAGTCGCCC
AATATTATTAACCAAGTCGTATGATTCCAACTAACTGGTATATTTCTCCGTCTCCACAGG
CAACCTCTGCATGATCACCGGAGGCAGGAATTTGGGACGTGTCGGCACCGTTGTCAACCG
TGAGCGTCATCCCGGTTCCTTCGACATTGTGCACATTAAGGACTCGCAAGGTCATGTGTT
CGCCACCCGTTTGACCAACGTGTTCATCATTGGCAAGGGCAACAAGCCCTACATCTCCCT
GCCTAAGGGCAAGGGTGTCAAGCTGAGCATTGCGGAGGAGCGCGACAAGCGTCTGGCCGC
CAAGACCCACTAAGGCGCAGGAGTTTAAGGACTTTTACCTTTTAGCATAACACTCTGTAC
GTTTAGCTACGGAATTACAAGCCGAGAACGTAACACATGTGTTTTCTTTTGCAATGGAAG
TGGTTGATCTATTTGTTGGCCAAGAGTTTAAAGAATCAGATGTTTGCTTTGAAATGTGTA
AAAAAAAAAACATGGGACATGTGTGACGTGACTTAAAGCTATTCAAACGTGACTTTATAG
GAACTTTAAAATCAATTCACAATGCCTTAGAACTGGACGTAAAGTAAAACTACCCTCAAA
ATTGACATTTCAGAGCTTGAAAGACTAGTTTTATCTATGACACGAATTCAAAAGTTGCGT
TTGTTAAGTAAATATTTCAAAAGCAGATTTTAATGAGGACTTAAATTTCAATTTATGATG
ATGATTGTGTTATTCTTGTTTACGTCTTCATCTCACTTATTTCATTCATATCATAAAAAA
AGGGCAATAGATTATTGAAAAAAGGAATTCATTTATTTTACGGGGGGGGGGGGGGTGAGT
TTTAACCCCTCTGTGGTGCGTGGGGGCTGGAGTTGGCGCCCAAATAATCGATAACCCGCC
CCCAGCATCGATAGAACGGCCGCTGCGAAAGCTCCGGTCACACTGCTCAGTGGGCTGCTG
CTTCTGCTGCAGAGAATTATCATTGTATTTCGTGTGGTGAAAGGCTTTGTGCGCGAACAT
TGTGCGTCCCCGGATCAGAACTCGCTTCGAAGTAAGTACCCGACCATCCCGGTGGCGCAT
TCCGCCGCTGGGCGGAAGCCCTAGCAGAGCCCCCGCCCCCAAAAGCAAATCATATGCGAA
GAAGAAAACACGAAAATGCTGGCCACCCATACAACGATGCGCTGCACACACCGATGCACA
CCGACACATACGCACACGGGCGAACATCATATGTTGATAAGTTGGCGACAACAACAACAA
CAGCAGCAGCAAGAACAACAAGAACAACAATGCATGTGAATCATTTGTAGGGATTTGTCT
GTTTGCTCGCGAGTGGTATTAAATGTCGGCCTATTTAGCAAGACCCCTGCTTTGAACTCA
CAGCGATACATATGCACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1082, 1227..1259, 1355..1613, 1687..1784, 2411..2582, 2819..3157
1257..1259, 1355..1613, 1687..1784, 2411..2582, 2819..3072
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved