Drosophila_melanogaster Locus RpS12
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS12
Drosophila_melanogaster
RpS12
3L
snoRNA:Me28S-A774b, snoRNA:Me28S-A774a
1225..1297, 1871..1943
3407
gcacatggtgcctatttttttatagtcttcttacacttttctatttggttaataatact
aacccactacacttgcaacttactgtagcgtgctcgtcattctcctcgtgtgattgttgt
tgttgctgctgctgccttcttatgtaaacataaacaaggtattgcacttcaggtggccgc
ctgcgctctcaactcgtataagtcgctatccggcgtagaatcgaatcgggagatatagtc
acgtatatttatatttataggtgatttaccacgggctgctgtcgtcggaagcgcgagttg
cgggcgtttgggaattcggtattgtttatctcagtgttaccaggtgccgcaggtgacgca
tctgtggctaatgcgtggtaactcgcaaaacggtaactctgtgcactgctaaaagagcga
aagaacttttcatcgcaattgtattgaaatatatttgtacgatagcaatgatgttactct
taaatatataaatatttttaattagcattccacagaaggttgttaagttcaagtttataa
caaagagattaaatgtacttcatgtgcactgcgcaaaaattgcacgaattagaatagatt
tctgtagaatataattgctttccaaatataaatctttaaatttaacacttttacaaaatc
atgtaaaaacaaagtaataactggaacaagtggcaaggacagattatagatgtatagata
gatttctgtagcaacattctttctcttaaagatataatataatatataccagaaaactgg
gaaacccactcaagcttattgggataaaaaaaaatcatttaattagaaaaagttcatcag
aaaagttaaaatatttaagaaatctaagttaagataatgtcatagcaagtaagaaattgg
cataaatttccattgcacaccactatcgatcgcgtcactatgcagctctgcgaaactatc
gatatttgtaccaatagctaaaaactcacatctccagcgccATGCCGATTTTGTTCTCTT
TCTTTCCGGTTGTCAAAAGgtacagatgcttggattttatttctccgaaatgaagaggtt
ttcttatcgaaaatgtaataaatatgaacaattaactatcttttccagTGCAGTGCATCC
TTAACCGCAGAACAATGGCCGACGTTGATGTgtaagtaattgtttcatgggcgataaacg
cattttacgccttgctcggaaaaacctcttgttgatgaaattaattggtccgtgtttatg
aatttccattgattataaattctccaattactgaccaagcaaggctaagtcgagttttgt
gtaatgcggcatggcatgtggcgttgattgctaatagtatatgtttttccgatctagTGA
TGTTCCCTCCGCTGCCCCTGTGCTCGATGGCGCCATGGACATTAACACTGCCCTCCAGGA
GGTCTTGAAGAAGTCCCTGATCGCCGATGGACTCGTCCATGGCATCCACCAGGCCTGCAA
GGCCCTGGACAAgtaagtagtcccacaatctggcggtcaacgtggttattcacttgggct
cttagatgcaaaatgcgaaagggtaaaagctatagtaatatatttcaaagtcgaccattc
tatagttgaaagcaatctatatgattgatagaaatatatatttcagttcaaatcatttga
aatacatagaccacgttttaaaaagtgtgggtcttcattcaacttaacctattttcagga
aatgaatcttatttcctccttgaattttttaatcgtttattaatcgtaatgatatttata
ataatccactaagtgcattaaagataaatcccaagtgtgtttccacattaaatcatcttg
attttgctgttctgactgtgatgaaattaattggtccgtgtttatgaatttatattgatt
aaaaaccttccaattactgagcaaatgacagcgtatcgagttgcattgtatgaaaaaaaa
ccattcctaattacaatatattgttttaccaacagGCGTCAGGCTGTTCTGTGCATCCTA
GCCGAGTCCTTCGACGAGCCCAACTACAAGAAGCTGGTTACCGCCCTGTGCAACGAGCAC
CAGATCCCCCTTATCCGCGTGGACTCGCACAAGAAGCTGGGCGAATGGTCCGGTCTGTGC
AAGATCGACAAGGAGGGCAAGCCCCGCAAGGTGTGCGGCTGCTCCGTGGTCGTGATCAAG
GATTTCGGTGAGGAGACACCCGCTTTGGACGTGGTTAAGGACCATCTCAGGCAGAACAGC
TAAACAGCTGCGCACTGCCTGCTGAATGAGAGACTACGTGAAAGTTCTTTTTAAGCTATT
CGCTAATTGAAAATAAAACGTATTGAACCTGAATCCAGATGAAAAAATAAAAGAAAGTCG
ACCTTTTTacatttttggaatgttctattatattgaaaaaattattttgtatactagacg
ctgggtcacaattaagttttaaggcagacgagcttgtgctgtggccaatccttgagctga
caatcactgaaagaaaaaatattatagaagaagcgaactccgcaaaagttgcgtccaacc
caccgggagcagtagtgcaccttcttgcagcaggcacacttctttttggccttcgcctgg
caagtggcgcaagtatggtccgtatctccatcgccaccagcgccggcatcctttgcttcg
cccatcttgagatcatccatattctgctccagttcacagagcaagtccgtgccgtaggct
ttgctgaggcgagtggccaaagcgcagatgttttccttgttcttgctaaggaaaaccgag
tcctgatcctgggcaatctgatagaagccgccattttcctcgacatccttgagcagttcc
tcctggatctgcggaatgtcctccagcaagagcggctgtgtcttggccgtattgccgctg
agcgtcaggcggctgaggaacacctttagctctataagtggcggcagctggtccagcaac
ggctcgtgcatgagacccaaaagctaaggaagtcagcttggtaagtcagcgcattaatca
tagatatatgtaggtggcaactaaccttgtgtaactgcttgcagcgtgcctcgttgaaag
catagttctccatgatctgaggattaaggagcagctgacgcacacaaaaccaggcctgcg
cctctggcttgacaatcttggtgacgtcgtccacattggtccacttctcgtcgatgaact
tctgaatgcccttgctggtctttctctgccacggactaaaacgaggagaaatgtgtaaaa
tataaaaaaaaactcacttatccgtgctgctcaccggaagctaagcacatctgccatgag
ccacggaatgtcatgggtcaccagcaaacggcgtgcggcgcttagatg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1128..1170, 1377..1511, 2015..2407
1154..1170, 1377..1511, 2015..2282
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved