Drosophila_melanogaster Locus RpL10Ab
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL10Ab
Drosophila_melanogaster
RpL10Ab
3L
snoRNA:Psi18S-920
1133..1273
3360
ggccatggccaatggaaaatcaatgcagtcgcggctcaaatcccttatataatccgcga
attgcaacgacaccacgcacttaatttttatctaacgaaagcgaaaagccgactaaacac
tgatatgcagactaatcggcgagatggtgaaagcaatgttttcatttccacgcactctcc
gttttaaggagagagcgcaagagagtttctctttgcctctcttgaacacactatgatatc
acctagaaagaaaagaagaaagagaagaaagcctataatcaacagaatcttcagacacac
agtaactaactagttgcatatatagattttatagagatcaagtgcaaattttaatcaagt
gcaaattttaataccaatattctcggctacaaacaaagccgcagttccagggctggtaaa
ctaatagtgataaaaaccagttggcagcccacaaagcatcgccaaataaatggattttgt
tattagggtgattcctgctattcaaacgccttcaaataatatatatatatattcttaata
ttcttaattagcaatttgtattattatgatttgtgacattggcagctattaatttaggag
ctcccactaactactgtcagttatacattaatttgtaacaaaaataacaaaaaaaaaata
agctgtgacacataaaaagtaaaaaataagtgtattgaaacgtcattgtctgccgacatc
cctttattattttccattatttctgttcgttcctttgatttttgcgtaacatattatatg
aaattctaaaaatatgccactgtgtatgtgtactccgttaacttataaaaaagggggtat
tagatttaatatttttataaacaattgaagaatttataattctttattaaccagcatttc
tcgtgaatagccctattaatgaatatcgatatatattcgcacaagcacacgcgcccacga
aactatcgccagaggtttctcacctctaaaaaccgattttcACTTCCTTTCTAAATCGCA
CGTTGAACAGAAAAGATGGCgtaagtgtaaatccagattttaatatgtaaaagaaagcaa
ctaaacattgggtacattaatgaaatttgaattctaagcgatcctgtgatcagtggcaat
cagaaaccagctttttagaccttttccatgtccatatcagtttggaaatgattgcaaaag
aaaaacgtggttttatgtgccaaataagcaactaatatgtgggctgccttcatttgcgca
ttagtccgacagtcaaaaaaagataaacagccaatgcttgcagtgttcatttgccttcca
tttgtttgataattggttcaatcttgcagGTCGAAGGTTTCGCGTGATACGCTGTATGAG
GGCGTCAATGGACTCCTGGAGGCTTCGGCGAAGAAGAAGCGCGGCTTCCTCGAGACGGTG
GAACTGCAGATCGGCCTGAAGAACTACGATCCCCAGAAGGACAAGCGTTTCTCCGGCACC
GTCAAgtacgttggctaagtcacctgcgcacgtgcttggatagaagctcccatgggagtt
gagttcatcacgtcatcaggtagtcgaggacatgtggctgtcacatctcgacggacctgc
actcagggtctttaaaatttgagtaggtctccagcaatggacaccgaacccccattttct
taataactatgaaaacgtgctcctctgagagccttgtaagttttccatgaggccccactt
atatctacatctatttgaatccacaaagcactggctaatttatggttactttcttgtcat
cccacagGTTGAAGCACATTCCTCGTCCCAAGATGAAGGTGTGCATCCTTGGCGATCAGC
AGCATTGCGACGAAGCCAAGGCCAACAACGTCGACTTCATGGATGCCGAGGCTCTGAAGA
AGCTGAACAAGAACAAGAAGCTGGTGAAGAAGCTGGCCAAGTCCTATGATGCCTTCCTGG
CCTCTGAGTCGCTGATCAAGCAGATTCCTCGTTTGCTTGGCCCTGGCTTGAACAAGGCCG
GCAAGTTCCCTGCCCTGCTGTCGCATCAGGAGTCTATGATTGGCAAGATCGAGGAGGTTA
AGTCGACCATCAAGTTCCAGATGAAGAAGGTGCTCTGCCTGTCCGTCGCCGTCGGCCACG
TTGGCATGAAGTCCGACGAGCTGGCCCAAAACGTCAACTTGTCGATCAACTTCTTGGTGT
CGCTGTTGAAGAAGAACTGGCAGAATGTGCGCTCCCTGCACGTCAAGTCCTCCATGGGAC
CGCCCCAGCGTCTTTACTAGATGCGCATACTTCATTTTTCTTACATCTTGAAATAAATAA
GATCCTACATTTTTGTAATGTaacttaatttggttttattttagtccttatctctacagt
atttatgtatatgagaagtcggtggttgcacatcgatttctatgccttatatttcagtgg
agcttatagttctggctaggaaatctctcacttctagcgccgcatgagactcggcgtcct
cgctgactgaatctgacagcggctctgcccggaatttggacacgtccaccgagttgcccc
actcaagcatgtgtggttcgctcagttcttccagtagattgtgcaatactgcggctgctg
tgatgatgcacgaggccgtatggaagctaatgtccaggggttggctaaggaagctccagc
gggacatgaggcgatgcagtgcgcagtcactcaattcctgcaggtgctcggcaacctcgt
tgaagtcgtgctcgtgcggagctgtcggatcagtatagcgctgcaaaagccagggacgca
gtggataattctggtacaccggggccaagacaaaggccggaactagtcgggaattaatgc
ggaattcagggattgcggtaagagtattgggtgcgtgggaaaacatgggtcccagggtgg
cacgcaagccacatcccaattgcagctcccgaaagagcattcgatcgtcgagcagatact
ccatgcgcagtatcgagttcttggcctcgccagtggatcggatgggaatggagcagacgc
caaggacgccgacgagtgcggcgggcatgttgctttcacgctggaaccccttggccacac
tattgcagtccactggattctggggcaattggcgaagcgcccgccccaaagtggacataa
cggcgttgcaaaagacctttaaacacttgatggtccttggacggggcagagaaaatctct
cggcaatcaaagagagccgctcgccgctggccaggaagttcagagccagagccacacact
tttcggtagaaattgctggctctctttgagtcagttcatctgacgtccgcagagtgggag
a
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1349..1504, 1807..2360
1035..1039, 1349..1504, 1807..2299
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved