Drosophila_melanogaster Locus klu
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster klu
Drosophila_melanogaster
klu
3L
snoRNA:Me18S-G962
8336..8416
29099
AGAACTCAAATGAAAATGAAATGCTGTATTAAGAAGAAAGGGCTCAATTAAGTGACATA
TATTGCTCGAAGGATGCGAAAAGTGACCTAAAAGCCGGCCAACTTCCCAAAGGATTCAAC
GAGCGCTGCTTCTATTTGCCTTCGCCTTCTGCAAGACAGTGGAAAAGACATCCGCTTGGA
TTCGGATTTCGTTAGCTTATCTTCGCATTCGATGTTATATAACGCCAGTCGGTGGAAGTG
GGAGGTGCCTATTCGGAGCTCGACTCGCAACTGGCGACCCAAAAGCGCCAAATGCAGCCG
AGTGCCCCCATTGGCATAGAGTTTTGAGCAATTAGAAGCCCACGCAGCCATAAACAACAA
CTGCTCGGGCGGGCGGAGAGTGGGAGGAGAAGCTCTTCGAGCAGCTCCCACCGAGAAAAG
CGGAACACAAAAAAAAAAAAAAGAACTAGAGAAATCTCCACTGCACGTGCTGCTCTTTCT
CGCTCTCTCGCGACTTTATCCGGCGAATGAGAGGCCAACAGTCGGCACTAACACACAGAT
ACCGCCGCCTGTTTGCCTCGGTGTGGGTGTCTCTCGGTGCGATGGTATTGGTGCCTGGTA
TCGTCGCTGTACGAGTGGCGACTCTACTCAGAAGTCAGTTTCTTGCTGGGCAGTGTCGGT
TCAGGTTCATCGACGCTCCGCACGCGCTGCCGCAAATTCTTCAGTGCTGAATAACCAAGA
CGCGTCTTTTTCGGACCCAAAAAAAAAGAAAAATATATAGAAAATATATCCGAACGTAAC
GTAATCTTCGCAGTGCGCTTACAGACTCCCCCTCCAACCCGCCACACAAAAAACTCTCTT
TCTCTCTCTCTCCGCGAAGAGAGTTTCAGTGGTTGGTTTGGATAGGTCTTGGTGGTTCGG
TGTTGCCGTCGCTGCTGCCGAAGCTCTGCCGACGCCGACGACGACGCCACGTCGGGAAAA
CCAACCTCTTGCAGTGAAAATCTTTTCGTACGTTTTCGTTATTTGTTATTCGCACGTTGA
CGCGACGAGACCGCGAAACACGACAGCACGAAACTGCAGCCCAAAACTGCAACTGCAACT
GCAACTGCAACAATAACGATCGCGCGTGCAACAACAGCAATTCGAAATCTAATAGTGGCA
AGCTGCAAAGTATCTAAACGCCTAGAAATCCGTAAACTAAACTCGCCAAATCATTTAAAA
TCAAGTGAAAAGTGTGTGTCTTAACAGCCCATTAAGTAATATAAATCAATTAAAGCCGCA
AAACACACAATAAGCCAAACACGCAAACGCAGCATAAGCACAAATAATACATAAAAATAA
AAGAAGTGTGATATTTTGATATTAGCAATTAGAGTTTACACAACGCAGCCTAAAAAATAT
TTGTTAAATGTGTTTTGCCACCCCGAAGGCAAAAGCTACAAATTGGATAATGCTTGGATA
ATTCCCCTCCTACAAAAAAAAAAAAAAAAATTAAAGGTGAGTTCGCGAGATCGCTCAATT
TGCCGACGGCTTAGTCATTTGGACAGCCGAAAGAAAAAAAACTATAAAGTGCCATCTCAG
CTGTGCTGTTTGGTTGGTCGAAATGTGTCAAAAGCTGAGCTCCAGTTACGAATAGGATCG
GTTTACCATAACACTCAGCGTAATATCAGATCGGCGGCTATATGCTATATACATATGTAC
ATATGTATGTGTGTGCTGCAATCGATTGCACCCATGAATGATGGACTGATGATGAGTCCA
TATCAGCACGGGCCCCCTCCAGTGGCATCATCCACATCATCATCATCATCATCATCATCA
TCATCCCAATCTCATCTCACTCCCATGCCATATTGACTCTATCTATATTGACGTCAATCG
CAGCAGCAACTTGACATCGCCGATCTGCAGATCGTGTGCCTGGCAAATTGACGCACACAA
AAGCGAGTGAGATAGAGAGCCTGGTAGAAAGATAGTACTAGGACCCTTAGCCCCAGTTTC
CTCACATCCAGTTGCAGCTCCAGATTCCCACTTCCAGTTTTAGCCAGTCTCGGGGAATTT
TAATTGCCCATCTTGGCCAAAAGCAGAGCTGGGCTGCACTCCCTCTCTCTATCTCTCTCT
CTCTCTCTCTCTATGTGAACTATGCCAATTGTCTACACCTGAGCCGAAGAACTGCCCGTC
TGGCTGACAAATTTGTATGCACGCGCTTCAAAAGTGCAATATTAATTAATTCCAGCAACT
CGAGACACGGGCAGCAACAACATCAACTGATCTGTATGCAACAGAAGTTGCAAGTTGCTA
GTTGCTAGTTGCTTGTTGCAAGTTGCTGGTTGCTAGCGGTTGCTACTTAGTCGAGGCAAT
TAAATCGTATGTCATTCATTGGTAATTTATACCATTTACAGGCATCTGCTCGATGTGGTT
GGTTCCTTAAACAACAGTTCTGCGATAATAGCTCCGCGATGTTTTACACTTGCCCATTAG
CATAGATTACTGCATCAAGTGCTGGACCAAAATCCGTTTGCTTTGCTTTTGACCTGTCTG
GCAAACGCCAAACGCCAATAGCCACAACGCTTGATCGATCGCTCTAAACCGATTTCGATT
CCGATCCGATCCGATCCGATCGGCGATAAATGCAACTTGCCATGAAAAGTGCTGCCTTAA
ATGGGCATTAGGCTATTGCACATTTCTCAATATGTCGAGTGATTTTTTCTCTGCTCCTCC
AACGCGGCTGACTTATACGCACCGCACCTTATATGACGAACGGCGACGTCTGCCGCTGTC
CCACTGCATTTGGCATATAAAACAGACGGAGCCACTCGGTGGCTTCCATCGGTGGTGCAG
TTGGGGGGCAATGGTGGCGATGGTGTCTCAGGTGGTTCGCTGGTTGGAGTCTCACCCGCA
CGACGCCATTTCTCAGACCCCGATGTCAATGGCAATTTGCATTTTCCACACAAAAGCACC
TAGGTGCTCCTGGTGGCGGCTCCCTTCCCTAGAAACAGGGCGGAATAAAAAAAAAAAAAG
AAAATAACGCCATATATACTGTGTTTGGTCGAGTTAAGGTCCCTGGTTCAGTGGTTAATT
TATTTCTGACACAGCCTTAAATTAACAATTTTAATACAAACAACAAAAGAGCGCGCATTG
AAATTGAGACGTTGAGCGAAATACAAAAAAAAAACACAAAAAAACTCAGAAAAAATACAA
AATAAAATAAAAAACAGTGAAAATGCACACAATAAAGGGAAAAAAAACAAAAAGCTTAAA
AGGAAAAAACATAAAATAAATTTACAGCAAAACAAAAGCGTGTTACAGAACAAAGGAGAC
GATTTTGGGGAGCAGTGAAAGAGGAATGTGTAAAGTGAAATAAAATTCTGGCGCGTTAAT
TAACTTTAAACGATTGAAAACGAATTGATTTGGAGAAGCCATTTGATTTGGATTAGTCGT
GCCCGATTCAGAAAAAATGCCACAAAAGGTTGTGGAGGTGGACCCCCAGCTCAAAGGGGT
CACAGCTTTTGGCCAAGCTGCTGGGCTGAAAATTAAAATTCAATCATCACGTGTGCGTTA
AAAGAGACACACCATCGGCCATCTAACAATCAGACAGATCATTGGAGTTGTTAATTGAAA
TGCGTTAAACAATAAAACAAAGACTGTCATGTCTGTCACAGTTGCCAAGTGACTTAACAC
CTTTGGGATCTGCGGTTAATGCCGATCCCCGACAACGGTGTGGATACTTCGACATCTGAT
AGGGCCACATCGGAATCGGAACCCTGGACATGCGTCGTTATCATGCATTTGATAAACGTT
TTGTTTTTCATTAGAGCCTCGCCGCGGAGGAGGAGATATCAAAGATGCGCTCCTATCCGA
TCACAACCCTTTAATTAGCAGGGAGTTCAGCTCTGGTTTCTTGGAACCTAAGATCTAAAT
ATTACTAGATCTATTTCATGTGGAACTAATGTGCTTGGTCAACTATTAGGAAGTGACCAT
TCATAACTTGAAGCTTGAATATAAGTTATTGGAAATTTCTTAAAGACTTTACAATTCAAA
GTAAATTTCGATTTAAAGTAAAATTTAGATTGCGAAACACACAGCAAATGTGTGAAACAT
GAAGTCATCTTCCTGGATATATTGATTACTTAATCATGTTTTGAAAATTCCGATTGCGAT
AAACAGAAAGAGGAAATGCTTTCAATCAAAATTCCTACAACCACAATGGGATGTCATTTT
TTGACATTAAATTTTAAAAAATAGTTTATCTCTTCGGACCTTGAGTTATCCCAGACTAAC
CGCCACATTCTCGTTGGTTTTGATAGTCTGCGGGTTTCTTTAGATAGTCGAGTTCCCACC
GCGGGCATTTTAGTTTTATAATTTTTTTTTGGCATATCAGACAAACGCACGCAGTCCTCA
ATGAAGTGAATTATTTTTTTTATTTCGGTGGGGCCACCGCCGCAGCACGTACTTGAAAAC
AACTTTTAATCTCGAGTAGTTTCAATTAACGTCATTAGACTACATAGATCGCTGATTACG
GATTGAATGAGCATTAAAAGTATATATGAATAAGTGCGGAGTGTTTGGTATGAGCTATGA
CTATTGAAAATATAAACGAAAACAAAGTTAAAATCGTGAGCAAAGATTGCGCGATTGCGG
CCACCCACCGCACATGGTCGTCCGTTATCGGGGGGAAAAGCTATATATATATATATATAT
ATATATATTTATATACCATATACGCACATATAGCCCCCCGATCCGGTGGGGCTATCTGTC
CTTCGATTTACGTCACAGCTCGCGTCGCAATTCATGAATTTCTCGCCTCGAAAAAAAAAG
CGAACCCAATTCTATTTACCGGACGCCCACTTTTGAGTGGGTGGCTGGTGGGTTGGCTAC
GGTGGATGATAAGGCGCGTTTGATAAGCACTTGGAGTGGTCAGTGGGTGGGTGGGATCGA
GTTAGGAAATTTACGGGTCGTTGCATAAAGCCACCTGATTATTTCTGAGTCAGTCCAAAA
GACACTCGCAACGTGCGGATCTTTCGATTGTTGTCGCAGTTTTTTGATTAGGCCAACTCA
TAAAGTGAAAAACCTGTTGTTGCTCGACAGCCAGTTTTCCAGCTGAAAATTTGCAATTCG
CTTTTGCCTGGGCCAGTTCAATATTTTCGCTGAGTTTATAAGCGCAAATGTCTGTCACAT
AAAACTTAATTGTAATGTTTGTTTACGAGCTCCACATGCCAGATTTTCAGACAAGACCCA
AAAACCACACACCCCCAAGCTAATGGCGTCCATAAATCCAGCGTGTATCTCAAATATGAA
TTGCACTTTAATTTCGGATCTCGAATCGTGGCGAGTGCCTAATTTATGTAATACCCCCCT
GCTGTTTGTCATTTCACTTGGTCGGATGAAAGTTCCTCCAAATTGTTTTAAGTAAGCGAC
AGCGTTAAGACAAAAAAAAAAGCGGAATAATAATAATAAAGAAATATCTTCATGCCAACA
AATCCATTACACTCAAGTGTGCGACAACAGCAACAGCAAATAAATAAAAATATACGAGTA
TGCATGTACATATGTATGTGTTTACGGACGTACAGACATTGCGATGAGTGTGTGTGTGCG
TGTCGAGTTAAAAAAATTAACCGAAATTTTATTAGTATTTGCGCAAGCGCAAGCCAAAGT
CAACCTCAAATATTTGACGACCAGCGTTGACCAAAAGAGCCCGACTTTTTGGGGGCGGGG
GCGGTGATGGTGGTGGTGGTGGTGAGGCATCTGCATTCCCGCAGACTCTCTTCTGGCGGG
AAGAATTGGACCTGGTCCAGGGAGCCCTGCGCACAAGCCAAGCAAAAGGCAATTAGAGTT
GACACTTTGGGATTTTCGGTCATTTCTTCTTTTTCCCTCTGACGATACCTGGCAGTCGTG
TGGTGCTAAGTATATATATTGTTTTATTCCGATAATTTAAATATAAATACATAAATTCAT
TACTTTATTAGCAAACTGTCTGAAACTTTGCTTGAATGATGAAATAACCAGTTTATGGTA
TATCAATTGTTAATACACCCCCACATACATTTCTTAAGAATAACATTCGGCATTTACTCT
TATAAGTAATATTATTTACTGGCTTCTCGTAATTCACAGCAATAGATAAGATGTTTCGGT
CTTTTCGAATAAATGTAGATTTATGGCTATGTTTCTAATAGTGGCTAGCTTGACTCGATT
AGGTTCCATATTATAGTAGATAACTTTTTGCAAAAACAAACGTTTTTGATTTATAGACGC
TGTTTAAATATGATATATCTCCCTATTTTCCGCCATAATATATTATAAATTTCACACTAC
AGGGTGTCCGAGAGTTCTCACAACATATTCTTGCTTCTACCATTTGGATTTTAGCGACTT
CTCGGGATCCCTGGGATCCAAGGGTCCAAATGATGATGTCCGCTGGTCCAGCTCATCTCC
GCTCAAGTCAACTCTGGTCAGTTTTTGGCCAAGGCTTAGTTGTGATGATGGCGTTGACGT
GCCCAGGGGACAGTTTAATTTTCACTAGACATTGCCCACTTAAAAACCATTTTCACTTGA
GACGTGACCGCTTGGCCAGATCTTCTTCCTCTTCTTCTTGTGACCGTCTAATGTTCGAAG
TTGGTCTTGGGTTTTTTTTTTTTTTTTGGTATTCGCTCTTGGGCCCCGGAGTTTTTAAGC
CTTGGTCCGGGGGATCTGTTATTTATGGATCAATATTGACGCAGCAGCTGGAGGCGGGCG
GCGGGGAGTGAAATATCTGTAAAATAGCCAGGCAACATTGTAAACAAAGTGTAAGCCGCT
TTGTTGTTGCCTCTGGCAACAACGACACCTTCCAAAACTCCCCATCTCTAACTCTAAAAA
AAAAAATCTGTAGAAAAACTGTCACTAAGGCATTTTTCAAATCGGATTTTTCTTACGATC
GAAAACAATGCAAACCGATCGATGACAATCACAATGGGGCTGGCAGTTGGATGAAATGCA
GGGGGGTGTGTCTGCCGCATAACACACATTTAATCATAAATTTGTCGCGCGATTATTTTT
ACAGTTTTCGTCTTTCTACAAATATTAAGTATCTGGCGAGTGGGTCCAATAAGTTTAGGT
CTCAATGCCTGACTTATGGTTTTAGGCTTCAATCCGTTGATGTTGGATGAATATGTAAAT
GACTTGTTATTATTATGTTTATGCATATTTCCAGCGGCTTTCGTCTAACAAATGTGTTTC
TTGTTTGTTTATTTGTTTTCTATTTATTTCGCTGTTTTTTTTATTTTGGTTGTGTCTTAT
TTTTTGCTGGCACGTGTGTGCTTAACTGGGACTAGAATACATTTCCACCGTTGAATTTTT
AAGTGACTACACTTGACCACAGGAAAAAAGGGAAGCCTGTTGAGTTCTTTGAGCTGGTTT
CCGCTTGCAATTTATTCGACAACAACGTGAAGAAAAAGAACGCAGAGACCCAGGAACGCA
AAGGGCTGAGGTCTCGAAATTCCAAGGCGTTTTACCTTCCCTGTCCGTATTTCTTTTATT
TTTTTTTTTCGCTGAATTCACTTGGAGAATTTGTGGCAGCGGCAACAAGAGAAATGCATT
GCCACAGAAACCACAAGGAATTGTTTCTCACGCTCGCTTAAAAAGAACGGGAAAGGATCT
CGCAGGGAAACGACACCCACGACAGGCGACAGGAGGACTGAGGTCCAGAGATCCACGTAT
CCAGAGATGGAGATGGAGAATCGCACGGAGACAACCATTCCACTTGACTGAAAGAAATTC
CTGAAAGCCGCTTTCCGACCAATAAAGTCTTATTATATACTCATCAATTCAGCAGCAGAT
AAAAGTCAAAAACTTTGAGATACGCTCACGCTGGATGTCGTCGATGCCGACTAAGGCACA
AGTCAGATAAATTATAATTAAAGCAGACGAAGAAAAGGAGAAGACACGCCAGAAGACACA
TGGATGGGGGAAGGGGGAGGGGTTTGGGTTTGCTGGGGCTCTGATGTCAGAGCGTATTTA
AAATACGAGTAGAACCGCTTGCATTCAAAACGCCGACGACGCCGACGCCGCCACACGACC
CGAAACCCAAACCCAAAGCCAAAGCCAAGCCAAAACCAAAAAACCGAATCTCTGGGCCAA
GTCGAAAAGCCAGGCTAAAAACCGACGGTTAAACAAAACAAATAAACAGCCAAAGAGGCG
CAGACGTCGCATAGAATCGGGCTTCAGTCAGCGGCAAGAAAACACCTGTCAAACTGGTCC
AAAAGAACAAACTGCGAGGGGCGAAACAGAAAACAACTGAAACAGAAACTCGGGAAAAGA
CTGGGGATAATGACTTGGCAAAGGATGGATCCCAATTCCATATAGCCCATATGATGACAA
TGATGATGATCGTGATTTTCAGGCACGGTGCCCCCAAAACGGATATGCAGCATGAAAAGA
GGCCCGAAACTGATTAGCCGATTATTGATTTAATTGAAGAAACAGCAGAACCTAAAACGG
AAGTTATTACGCAAGCTGATTTTATTAGATTAGATGATGCTGCGGATTTTCCCTTTCTTC
CAGTCGACTAATTGCACCCGAAGGTCTTTTCCCAGGCACGAGAAAACTAAGCAGGAAGTG
TCGGAAAAATGGGAGGAGTGCTGGAAAAACTAGTGTCAGTCGGATGGGGGGGAGTGGGGC
CCTAAACTATTTCCCACAAAATCCTTTCAATTAGCAAGCACGCAAAGCCAAAAAACCGAG
TGCAAGGACAAAGTTTAACAGCTTAACTCAAAGGAGAGCGATACAGATACTGGCGCAATC
AAATTACCAAACTAATCGCATGCAAAAAAGGCGAAACAAGTTAAATGTGTCTATGTGGGG
ATTACTTTTGGGGGTAGTGTTCTCCGCTGGCAAGAAAGTGAAATGCGAAATGGCATGGAA
AATGGTAAAACCAGGGGAACTTGGCGCAGTTTAAGGCGTTATGCAAAACAACTGCAGTGC
GTGCGTGTGGCAAAAAAGTTTCACAAAAGTGGGGGAGCTAACTGGCTGAGCCATATACAC
GCACATACATACACACACATGCAGTTGGAAAAGGATACAGAAGGAACTTTGGTCGACAGG
CGACAGGAAGTGCGCAAAATGCCACAACTTACGACCGCATTGTGCTGCCAATGTGCTAAG
GAGTTCTGGCCTCTTAAGCTATCTCTTTCACGTTAGATTTCCTTGCGTTGTTCGCTTGTT
TCGCTGCATTTGTTATTTTGCCGTTTGGGCCAACAACTATTAAAGTTGTTGCATGTTTGG
AGCTTGTAAACAAGCTTGTCGCTTCGGGCTATAAAGTAACAAAATATTATTAAATTAAAA
CTGAAAGCAGTGGTAGCGTGAGGCTGAAGGCGTGACTCCACCCACCAAAAACACCATAGC
CTAAGCTCAGCTCTCTGTGCTTCAGCATATGTATACGTGCTCATATGTACGGCAGCATAA
TTATGGATTGGCCAGGGTATGGCGATGACCACGTCGACTGGTCATTAACTGCCTGATGAG
CCAAGAAAAAAGGGGCTGGGGAGTGGCACAGTAGCCAATGCCAAAGTGGCAGCCACTCTT
CTCTAGGAGATACTTGCAGCAAGCTGCCCCTGGGCCGCATAAATAATTATTAGCAATTGT
CTGCAGGTGCAACAGCAACTTGCAACTTGCGGCTGGAAGTGGCAGCAGCAGTAGCAACCT
GCTTGGGCCACTCGAATTGCACACTGCAATTTGAGCATTTTTCACATTTCCTTGCTGCGC
CCGCCAAATACAAAAGACTCAAGCAACGAACTCGACAGGACCAACAGCACTCTTTTTCGT
TCTCTCTCTCTCTCTCTCTTCTTCTATTCTTCTCTGCCACTGCCTTAATGCCCCAAATAA
GGTCAAGGGATTGGAGGTGGTGGTGCTGTCTGGCCACCCACAGACACCATCTTCATTGCA
CCAGGTAGCCAAACAAAAAAAAAAACATCCGAAAACCCTTTCGAATGCTGTAAAGGCACT
CGAAAAAGTTCAGACGGGGCAGTAAGGGGGTTTTGAGGTAGGTAGAAATTATTAACTGAC
ATTTTAATGATGATAATGATGAGGCCCCGTTGACGTTGCCCCTGCAACTGCGTCGGTGGC
TAGACATAAAGCCCCCCTATCCCCCCTCCACACATTCACCCCCCCCGCCACCCACAAAAG
AAATAAACAGGTAAGGCCGAGTGAAAATCTTGGCCAGTTTTGTTGATGCTGCATCGGCGT
GATTTTTATCAGCTCAACTCGACTGGCGCCAGCTTCATTTTCAGCCAGCCGCTGTCCCTT
CGTTTTTGGGCAGCAGAAGCCACGGCTCCCCCAACCAGTAAAAAGTAAAGAGTAAAGAAT
AAATAAATAACAAAATTCGAATGGAAGAGTGCATAAAAGCTATGAATTTTAATTGATTTT
TTTTCGCTCTAAACAAAGCGCGGGAATGCCGTAGAAGTTGTAATTCATTTCAGCTTTCGT
TGCGCTTGTAAAGATTCCCTTTTTTTTTGCTTTTAACTTATTTTTACCGCTCGCCGTCTG
CTGCTGCTTCAGATGAAGCATGAAAATAAGTTTCGAGCTGCAGAGAGAGGAAATTTGGGT
CAATTTAGGTAACTTTCTGCAGCTAACCAAGAATCAGCTAATGAAAGAATCATTTTCTTC
AGTCAGATAACCATGGCTTTATTTTGTTCAGTGTATCTGGTTTCCTCTCCCCTTTCTATC
CGTTCTACCTTTGTGGCTAATTTTCGAGGCACCCACAATTCGCTGCAGCAGGACTCATTG
TCAGTTTGGCGTGGCAGCGTCTGTTTGCAACATGCTTAATGTCATGCAACAACAGCAGCA
GCGGCAGCAGCAGCAACAACAACGCACTGTCACTGTCATGCATCATCATCGTGGCGGAGT
TACTCGGAGTCTGCTGTTTGAAAATTATTGCATGTCTCCGGGGCCAGCAAACTGCAACCT
GCCAGAGGAGCAGTCTGCAAAGGAGACGACTCCCAGTGAGTGATGCGATTATCTGCAAGA
TTCGCTTATCTACGGTGATCCATCAGACGCAGTCTGCAGTCTACAGTCTACAGCTTGCAG
TCTTTAGTCTGCAGTCTGAGATCCTGTCCAGCCTTTTGGCTTTCGTGCAGAAATGCAGAT
CCGCAGAGGAAATGCGTAGCCTGCGCGGGCGTCCGCCTTATAAATTAGAATGTGTGCTGC
GTATGCTCAGGTATCTGAGTATCTTAGTATCTGAGGAATACCACTCCGCGTGTGTGTGTG
TGTTTTTAATTTACTCTTTATGGCCAGGCTCCCACGGTTGAGCGGAGTGAGCAGAACTTG
ACCACCTGAGATGGCCAGCACCCGCTAGCCAGAAGTTGTTGCCAGTGCTTTTTGCGGTTG
CTGCCAGGAAGCTGACTTTGGGCTTGGTTAAAGTAAACCACAGTGGGTTGCCACTTTTTT
CAGTCTTACTTTTTTTTTTGTTGACTTTGATTGAAAGTTGACACAGCCAAGCGTTGAAAA
CCACATCCGTGGAAGGGGCCTACGCAGCAGCAACATCAGCAACAGCAGCAACATCAGCAG
CAGCAGCAGCAACTCTTGCATCTCTATGCAAATGCAATTAGTTTTTGATTAAGTTGTAGG
CTGCCAAAAAAAAAGTAGAGATTCGCCAGAGACACTGCACCCAAGGTACACTTAAGCGCA
GAGCCAAGCGACAGACCGTTAAATTGTTGCAATTACCATTGCGATGTTGCTGCCGTGCCA
CCGATGCTGCCTGCTGCAATGCCGCCATATTGCTGGTAAAACAATATGCAAACTCGACTT
TGGTGTGTGCCAGAGTGGGTGTGTGCCTTTTTTTCTAGTGTTTTGTGCTATGTGGCAGCT
ACTGTTGCTTGTGGCAATTGTTTAGCACGCGCTGCTAATTTTGCGCCGCTGCTGTATTGT
TGCTGCAGCTACTGATGTTGCTGCCAGGCAGCAATTTCTACGTTGCATGCACGCCTCGTT
GATTGTAGTAGGTGGTCACCCTCGCCACATCGCTGGCAATCATTTTAATAGCAGCTCTTT
CGCTGGTCAGTCCGAGGTTCTATATAATTTATGCCCGCAACTAATTGCATTTGAAAGTTA
AACTGCAAAAGTCAAACGGTTTCCAGATATGTGCATGCCATAACCCAAAAAGCTTCGAAT
ATAAAAATTCCCACCGCAGCTCTGAAAAAAAAAACTGAAATAGATTTTCCCTGTTGCGTG
GCTCATTTGAAATTCGAATTTCAATAACGCACACAAAACGATGTTTATCTGGGGCTTCAG
TTCGCTTAGGTTTGGTTTTTTCTTATGTTTTTTCTTTTTGAGTAGGCGTTGTCGAATAGT
TTCGAGTGCCCTGGTCCAGTTCACGCACAAAGATTCAGATTTAAGATTGAAGAGGCCAAG
GTTCGTGAGATAAGAGTGGCTTCTGGCTGTTGTTGTGGGGGTGCGATAAGGCGGAGCCAG
AGTTTATCAGCGATTCCAGTTGTGGCGCAGCTGTGGCACAGATATACTCACAACACTCGC
AGTGTGCCAACAAGTTTTCGATTTTGGTTTTGGTTATGGTTTTGGGCCGCATATTTGTTA
AGGTCGGCACAGCTGCTGGAAGTTTGAAACTGGTCGCATTGCTGCTGGTCATATGCCACA
TGCAACCGCAACACGTCGTGCTGCTGCATGCCTAATTGCAACAGGTGGCAATCGAATCGG
CTGCACCCGCCTGCAACATGTCGCAGCTACGCCAGCAACATGCCAATTAGCGGCCAAAAC
AAAGCACCCGCACTTTGTAAGCCCCCCTCACTTCGATGCAAATCATGTTGACAATACTTG
TTATAAATTGCTTAAATTGCTTGCAAAATTAGCAAATAATAGCCGCAATTGTCAGGTCCA
AAAAAGGCAGTAGCCACAATTGCAGCCTGACATTTGTTTGTTTTTATCGCCGTTGTTTTG
AGCTACTGTATTAATGAGCAGAACTAGAGAAAACGGTAGAAATTATAATTTACTGAAGGC
AATCGTAAACGCTTCCCCCATCAATCAGCTGCCGCGGAGATTGCCTTCGATTGCCAATCA
GACGGCGGCATCTAACTCCTTCTGTTTGATATCTCTTTCGCCCGGCCAATTTTTTCGGTG
GCCGACACGCCCACTTAATTTTGACCGTGTTTGTGGGTGGTAACCGCTCTTTTTCGGGGG
GGCTAATTTTGTAACTAATATTAAAACACTTCAATCAATCAATGTCTTTTGGATGCTGAG
AAGGGGGAAACCCCTTCAATATACATAGGTAGCTCCACCAAAAGTTGGCTAAAATTTTCA
TTAAATCGCCAAGCAGTCTGAGAACCAAGCGATCGGTATTTGCCTAGACCATTAAATATT
TATGAGCTTGCCGGTCCGAGAGTTTTGTCCAGCCTGCCAACTATTTCCAGCTTGATTAAT
GATCTGCGCGCTCGTCTGTGTTCTGCTTTAATTACCACAGCAATTAGCAGTTGAAAAATT
CGCTCTGCCAGCAAGCTGCCACAATTTGTCATAGCACATGGCTGCAGCATCATCGCCGAA
AAATCTGCAATCTCTAACCTGCTCTTCGCAATTTTTTTTTCTTTCCAGACTATGCCAGAT
CTGCAGCGATTGGACTCGGCCACCGTCTAAATCAAAGAGGTAAGTTTGCCACCAGCTGCT
GCTGCTGCTGCAGTTTGCTCTTTTTTTTATTTCATTTTTTTTTTTTGGCGGCGAATGACA
ACCCTGGCCTGGCCGCTTTATTTTGCGATCGCAACTCCACCTGGCCAGGCAACCTTCACA
AAAAGCTGAAACGCATTTTGAATTTAATGCGTGCGACGAGGACAGTCCAGGGGTGGTGGT
GTGCCAGGGGGCTGAAGGGGGTGGCTGGGGGTAGATCCCCCTTCGGATCGATCATGTTCG
TCTGTGGGGCTGTCCAACTTTGCCACAAGCCAGTGTCGTCTCTTGGTGAGCTCGCTTTCA
GCCGAATTCAGTGGTGGAATCAGATGCTATCAGATTATTCGATACTTTCCGAATATAATT
ATTTTAAAATAAAATATTGAGAAATTCCGGCCAGCCTTGATAAGCCTCACAGTTATTGGA
ACTCGAAGAAGATTAAGAATGAATATTTTTAGGCATTTTAGGAATGTAAGAAACTTATCT
TAAAGCTCAAAATGTTTAAAGCTGTTCTTAGAAAATTTGCGTTTATGTAAACATTTGCTT
TTATGCTCACACACGATTTCTTATTAAAGCATTCAAAATTCAGCTGAAAAATGAGTTCTT
TATCATTCAAAGAAAAACTTTCGAAATATCAGGAATGTAGGACAAATACAATAATAGATT
TGAAGTTTAAAACGAACTCTAGACGTGCCAAAATTGTACCGAATTACGCAGGCGATACTC
CAATATCGTGAAATCCCAACTATCGCATCCTTCTATCTCAACTATCGGCTCCTTCGTGTT
TCGGTTTCGTGTATCGTTCTTCTGCAGTTGCACCACTGGTGGGGGCGTTGTCTCGCCGAC
CTTCCCCGCCAAAGGAATCGCCGCCTGCCATTGAAAGCAAGTGAAGCTGAGCACTCTAGA
AGGATTGCCAAGTTTCGTCTCGTACGAGTCCGAATATAAAAAAACATGAAATGAGAAAAT
AAAACGATACAAGCCAGTGCAGCTGGACCTGGCCACTTTTGAAGATTAATTGCTCGCGAC
AGTCGCAAGTCGCAAGCTGGCGAGGCTGCCCCCTGAAGTTTGCTGCTGATTTCGATGCTG
CCTCCAAAAGCTGGCAACCTGACCATAAAAATCGGCATTTGTTGGCAACACACAGCACAA
AAAAAAAAAAAAAAAACACAAAAAAATTAACATGACGTCAACGACAAGCGCACAACAACA
GCTCAATTGGCCAGCAGCAGACGAGTGCGACCTTTGCGATTTGGCCTGTCGCGTTGGCCA
GTGGCGATTAAGGCCAGAAAAGCGTTCCACATGTCCGAATGTTCCAATCTCTGGCTAAGT
AATCCATCGACTGGCGAGAGATTTCTTTTGACACGCCCCACGTTTTTCTTTGGGTGTCAT
CACATTCGCTTTTCGAATTTTTTATACACTCAGTTGAACTTTTTCGCTGGCTTTTCGCGA
TTTTTTCGGAGCGTTTTTGGTTTTTAGTTTGTTTTGTTTTTTGATTTTTTTTTTTGAATT
TTTGCGTCTCGTCGGTGTCGGCGCTTTATTCATAAAATCCGTCAGCTGCATGAAATACAG
CTTAATTAACAAAAAGCTGGGAGAAAAGCCGAAGCCGCACGCAGCGGTGGCGCAGTTCCA
TTCATTCAATCGTCCATTGAACAACGCCGGAGTCTTTTGGTTTTTCGTTTTTGGTCTTAT
TTGTGCGCCCGAAATTTGTCACCACAATATCACCATAATTGTGTTGAGAGATACGGATGC
GGCGGATTGAGCTCGAGAAAACGGAACGGTACGCAAACGGTAAATACACACACGGGCCAT
AAACAAACGAGTCAAATTACAAGCGAATGAAATCAATTAACACCTGCCGCTGATGACTCC
ACACCATCGATCAATCGATCTCGCACACACACGAGCTGCATAAATTAGTGGTCCAGCAGC
ATAATTGTGTGTTTTTTCAAGCGATCCAGCGAAATTAACATATCAAACACAGCATAATTG
CGCTTTAATCGCGCCAGGTTCCCCCCCTCCAAACTAAAACTGAAACCAAAAAAAAAAAGT
GAGAAAATTAAAGCCTGAAACTCTGATCGCTCGCTGAAAATTAATGACTTTCAAGGGCTC
CCCGTCGTGCAGACTGAATAGAAAAATAGTCAAGGAAGCTTAAGGTCATTTCTTCTGTTT
GAAATCTTCTGTGACAACAAAGATTATTTTAAATGGAACTCAAAAGACTGCACTTTGTTA
GGGAAATACTTCTTTAGAGTGGGGAAAAATATGCTAAAATGTTTTTTTGTTTAAATGAAA
AGGAATTGATATGATGAAGTGATTGGATTTGAAAAGTCAAGAAAAATAATTCCCAATGAG
CAACAAAGGCGATGCTTCATAGTTGTAAACAACTTGGTTCATATCGTAGCTAAAAAGTTA
AAAAGATTCTAAATTCAAATCCATTACTTTTTCAGTTTCCTTATCGATCTCAATAATTTA
TTTCATTTGCTACGTTTTCCACAAGACTTGAGCGCGTTTTTGAACGCCTGACGTTCGTCG
AAAGGCCTTACGACCCCGCAAGCTCCCCCAAATCCCCTCGGGAGACCCCCTTAGTCTCTC
ATTCGAAACCCCCTTTCTGGAATCTTGGACTCGTATAATGCAAAGTGACAGCAACGGCTT
GTAGGCAATCAAAATGCGAGCCGAAACACGCGCAAGTTTGCAATTGTGTATGGTTGTTGT
TGCTTGGTGTGTTGTTGTTGTTAATATTATACTCGTTGCTTTTATTGTTGTTGTTGTCGA
CTCCACCTGGCAACGCAAATTGAAAGAACTTGTTGCAGTCAACGGGGCAAAAATTGAATG
CTTTTGCACTTGCCTTTGCGGTCACAAAACAGCACTAAGAGAACTGAGAAAAATGCAGCA
AAACTCCGTGATATTGGTGGTGCACTTTTGGTGGTTACAACTATTGATTACATGCCAACG
AACGGCTCACATTACCGGAGCAGCAGACCCCAGATGCGGGTGTTGCCGGTGTGCCACATG
CAACATGCGGCGATATGTATGTTGCTGCTGCCGCTGCTGGGCTATATTGCAGCAGCAACA
TCGAACAGAGTCTGTAATTAATGCGGGAGCCTGCGCTGACATTTTGAGAAATTTATTGCT
CCAAGTGGATTTATAGTCTGCGACATTTTATAGTTTTGGCCCCGTAGAGGCCTGCGGTTA
ACCGAGCGATACCTGCGAGGATCCACCAGATCCACCGGATCCACCAGATCGATGTGGGAA
CTGCGAACTGCGTACCCTTAATGCGCATCATGTGCGCGCGCGCATATATAATTTGGCTAC
CCGATAATGATCGGCCTTTGGCATAATAAATTTTACACAAAGCGAAAAAGAAACGGGAAA
TATGTGCCGCAAAACGTTAAGGAAACTTTCAACTTGTTGTGTTGCCGTTGCGTATCCCCA
CTTGCAATCTATATTAATTTTTATACGAAAACGAACCGAACTGAACCGAGTCACGCTGCT
GCACTTTCATAAATGCCAAAAATTTCACCTGCTTTCACAAAGATGATTAAAAATAAATAT
GCAGGCGCTGCAATTCTCGACGACCGAAGGTTGATATACGATAATTTCGTTCTGATAATG
TGACGGACGGAGGATGAGACAGGCTGGACCTGTGACCCAGTTGAGGGGTTTTCGAACAGT
TTTTCGGCGTTTTCGGGGTTTGGGCGGGCTTCGTGTTGAGCCAAAAAGCGTTTAAGGCTA
ATTGCAAAGATCGCTTTTGACTGATAAACGAAGTGGAGAGGGTCCGAACGGATATGAGGA
GAAGGTGGAGTGGGCGGACAAGGTAGGTAGGTTTGCCCCCTTGGCGTTGACCCAAAACCC
TTTTGCTTCAAATCTTAAGTAAAAGAAACAAAACTCAACTGAAATGGGAGAGAAAAAACA
AATACGCGGCATTCGAAGCTCGTGCTTAATGATGATTGCTGGCCCCCAGAGGTTAAAATT
AAATAATTTCCGACTCCAAATGAAGGCGAAGCGCGCTTCTCTAGTCTAGGCTAAAATGGC
GGGCGTTCCAGCCATTCATTTTGAGCCCGGTCATATATAATTAGCATGAAATGAGCCAGG
GATCTTTAGTTTGGTCAAAGAAACCATTTTTCGCTTGTGGCGATTTTTTCGGTCTTTTTA
TTATTTTTTTTTTTTTAGCTCGCTAGTTCCTCTACGTTTCATTTCGTTTTCAGCTCTTTT
CAGCTATTTATGTTAATGCAGCGATTAAGCAGCAAATCGTGCGCCTAATTATGATAAACA
TTTGCCAAAGCCAAGAATAGAAAACAGAAAGAGGAAGTGCCACATTAGAGGGTGTTTCTA
GGCTGTACACATTTAAATAGTGTGGCCAACGTGCATTTTATTGCAATTACGCGGTCTGAC
CAGTTAATGTATTTTGGCCAAAAACAATCTGAAGTCGTCAAGATCTTTTAATGTCAGAGA
ATAGCGATATATTTGAAAAGCCAAGACTATAAAACCCCCGAGAGAAGTTAAGCAATACGA
AGTGTGACCAGGCTGTTGCAGTTTCGTGTTGAAACCAGTTTGAATATATTTATTTTTATT
TCCTGCGTCCCCTTCCCAATTTCTGTGGCCCTTTTAGGCGCCTCAGTTAGTCGGCAACGA
TAAGGCGGCAATGGTTTAATTTAGCTGCACCAGCGGCAGCAGCAGATGACGACAGGATCG
TTGGGCCGGTCTACGTGCAACAGAAGTTGCTGCGCCGGCAGAAGCAACGGCAGCGGCAGC
AACAGCAACAGCAAAACAAATGTGTCTGTATATCGCAGCTAAATTGACTTTGATCACGCG
ATCCCGAATCCCCCCCCCCATTTGGTCCGAGTTATATGGCCGATTCCAGGTTGCAGGCTC
CAGGTTCTCGGGCGCGGCCTTTTGTGGCACAAACGGAAGTATGCTAAGCAACTTGTTGCT
GCCGCAAAGGCAAAGCAGCAAAAGCAGCTGAAGGTGTATATTGCAAAAATAATTACATTT
GATTGTAAAAGGCCAGCGTCTCTAGGCTGGGGACTCGAGATCGGACCTCGGCCTGCCAGA
GAAAAATGTGCAACATGATTGCAGTTTACAGCCCCAGCAGCAGCAGCAGCAGCTAAAGCA
GCAACAACAACAGCAGCAGCAGCAGCAAAACCAACAGATAAAATGCATTTACAATTGAAT
TTGAATGTAATTTTATTTAAGCTGCGGTCAGCCAGGGGCAGCATGTTGCTGGGGTGTTGC
TGCTGCTGCTGCTGGTGCTGCTGCAGTGGCTCCTTGGCACGGCAGCAACAATTGGCCTGG
TGGCAGGAAATCGCCATTATCTGGCATTATCCACTTGGCCAACTTGGTGGCGTAGGCTGC
AACCTGCAACCTGCAAGCCTGAAAACTGAAAACTGCAACCTGCAAGCACGTCAATCCGCA
GATCAGAGCCCCTCTTAATTAATGATCCGAGTCCATGGCTCTTTGCTCGGTAGCAGTGGC
AACTAATTAGCATATCGTTAGCTCACATATTGACGTCAAATTTGGTCCGAGCCAATTCGC
AGTCGTTTTCAAATTACAGTGATCATTTTAATTGCAGTGCGCCAAGCGCGGACTCAGATT
CAGATTCACAATCGTACACAAAGATTGAGCCTCCAATTGAAAACAAACGAGCAACAGTAG
CAGCCAAGCTAGTTATAATAAATGAGTTCGCATCATGGGCAATGCAAAAGGCGGGGGAGA
GCCAGGCGATAATGGAATAGGGTGAAATATAATGAAAGATCTACGGATCAGGGTTCAGTA
TGGGGAGGGGAGATTACAGAAATACATCGAGAATGGAGATCAATGTAGATCTTTGATCTC
TGTTGGTGATAATATAGCAATGCAAATGGTATTCACATTTAATTGATATATTTGCTATAA
ATAGGTCTGGTTTCTTAATAAAACAGATTAGCTATAACGAACTAATGAACAGGATATAAT
AGCCTATATAGGTAGATTTTCATGCTTTTCCCCATTCATTAGCTCCTTCACTTTTCCACT
GAGTTTTTCCGAAATGATCGCAGCTTTTTTTAGCCAGTTGCGAGCTCGTGTTGCCGCGGG
GGGCGGTCTTAGCAACATGTTGCTGTTGCTCATTGGCTACCAGCAACAGCGGCGATTGTT
GTAGGCGTACAAAGAGTTTTCCCCAGCTTTTTTTTGCTATTTTTTTTTTCAATTTTTTTT
TATTTCTCATTTCTCGTTTGATGAGCAGTTGAGTTCGTTGTCGTGGCTAAGCAAATGGCG
TTTTATTTTATTAGCCATATTTCTGCGCCGTCATGCTTTGTTTGCCTTCGGCGCAGCGAG
TTGTTGCTGTTGGCTGGTGTTGTCTTTGCACTTGTGATTGAAGTTGAGACTCCATTGAAG
ACCCCACTGTATCCACTGTGTTCCCCTCCCCTGCCCCTCCCGCCTTTCACCAGCCCAAAG
AGTTGTCCATTATCAATGCATATCACGTTGAATGCTGATGTTTATGATGTCGTTTATTAC
GACCAAAGACAAGTGAAGTAAACTCCAGTGAAGTGTGGCTTAAATGGCGTCAGAGACATT
TGCCAGATTAATGGCCACAGTTGCTCGCTGTTTTGTTTGGGGGCGGGGAAGCCCCCGACG
GAGGCGTGGCAATAGCCACCAACAGCAACAACTGCAATCGCACACCAACAAATTGTTTAC
ATTTTAATTTCTGCAATTTTATTTGCTTAGCTCTGCGAACTGTCGTCGGTTTCAAAAGGT
GGGGGCTAAAAGGGGTTTCAAAAGGGGCTCCATGAGGAAAAGGAGGGGTTGGGGGGATCT
AAAAAGGAGGCACATGGCACGCGGCTTATCGCGGCGTCTCTGTGTCCCAAAAGGTGGGGG
GTATAAATGTGTTTGACGGCTGCTGCTACTGCAAAACTTCATCAAGTTTCGCTGTGTGTA
ATAAGCGTGACAAATGCCAGGCAAATACAGTGGTCACTCAGCAGGGAATACCTCTGGCAT
AATAAATAAGTCATAAACGATGTCGGACAGTAAAATTGTTAACCACGTATTGCGAAAGCA
ATATAAAATTGATCCTTAGAAGAACACAAATTGTAAAGCAATTACTAGTTTAAATATGAT
AGCCCGAATAATTTAGTAATTATATGCTTAAAATACGATCATGAACTTAATTGTTATCAG
ACAGTCGAACTGGAATGTTTCTTGTTCTTAAAAGGTATCATTTATCTTAAGTAATCAATT
TGCAACCCTTTCTTAGACTTCATTTTCGAACCCCATTTCGTATACCTTTGTTAAGTGTTA
TAAAGTCACCCCTTTTTCGATTGCCCAAGTGCGTCGCTTAATTATAAAATTTTAATGGTC
ACCTATATGCTTGTTGGACTGCCTGAAAAACCGGCCATGAATCATATTTCCATGGCATTG
CACATTTTCAGTTTTCCCGCCGTCAGTTTCGCAGTTGGCAATTTTGCAGAGCAAAATAAT
GACAAAGCCCCAAGTTGGCAAATCTGGGTTCTCGTTTTTTGCCATTGTTGACAACAAATG
AGCGCCATTTAATGCGCTTCCTAGTTGTTTGCCGTCGTTGTTCGACGGTTGTTCATTGTT
CGTTGTTGTTTGGCGTAATTAAGCAGCGCTTTTCCGTCTTCAATCGCGCAGCCACTTTTG
CACTTGGCTTGCACTTTTCCAGCTTTCGGTTTTCAGCGCTCAGCTTTTCAGCTTTTCAGA
TCATTTACGAGCGCACTTGGCATTCGCCGTTCCACTTTGCCAATCATTTGCTTACAAGCC
ATGTTTCGCTGTCCGCACTTTTTGGTCTTTTGGCGCTGGCGACTTGTTAGCGCCATGTTT
ACACTCCAGAAAAAGCTTAATTAAATCTGAGATGGCCGCCAGCATTTTCATTCCCATTTC
CATTGCCAGGCCCGTTGTATATATTTATTTTTTTTTTTCGGCCACTTACAAAGTCATTCC
ACCCGTGGCCAAAAATTAGCACTTCATTTAGCATAATTTCACACCATCTCTTTCATCGCC
TGACAAATCCACTTTGTCTTTGCCATTCTATCATTATGTAATCTTTTGCGCTTGGCCAAA
AAGAAGTCCCACAAATTAGGGAAGAATTTAAGTTGAGATTTACAGGGTAGTTTATAGCGA
AGTTGGAACTGACTTTTTTAAGAATGAATGGCTTATAGTTTTAATTTGTATGCTAAAATT
CAATTGTGATAAAGCAGCAAAAGCTTAGTTTTTTTATGAGATAAAAAACATTTCCAGTCA
TATTGGTTATCTGATCGCTTTTCATATCAATTCTGCATTCGAATACAACTCTATCGATTT
AAAGTGCCAACTTCTTTGGCGAGTTAATTAACACTTGGCAAGGGTATGACCGCTTATGCG
GATATATGTACACTTGTGTTTATCCAAACTCTGCCACCATAAATCAAAAATCTCGACACT
CACCCGGCTGCACCTCCTCCATGAATCGGGTCCCCGATTTCGCGTGCTAACAAGGCCCCA
AAGCGGCGAAACCTTGGAGAACCCAGAAGAGAGCTCGACTGGCGTGAAAATTTATGTTTT
TTTTCAGTTTTTTGTTCACTTTATATCATGAATATATACATCTGAATATACATATATATA
GCGAAAGAAGTGGGAAAAAAGTTGAGGAGGCGGTGAGGAAAAGCAGGAAAAGAGCCAATG
CCGTTGGCCACATTTGCTGGTGTAAAGTTTTTCGCATAGTTGTCAGCATTGCGCTGTTTA
ATTACCCTAATTAAGAATATTAATTGCCCTTCGGGTGGATAATAGTAATAATTGTGCGAG
GGGGAGGAAAACGGCTGGCGGTGACCCTATTCCCGGAAATAGAACATGAATTATGATATG
CACAAAAGTTTCACAGCGTTTTCCATTTAAGTTGCGAAATCGAAAAAGTTCGCACAACTT
TAAAGGGGCCGCCAATGGGAGGATACGGGGTCCTTGGCTCTGGACAAAGGACACGCACTC
CATTAAACCAAAAGGGGCAGACATATATGTACATATGCGACAACAATAACAACAGCAATT
GCAAGCCACTAACTGGCAGGAGGTGAAAGGTGAAAGGGGGAGCGTGTTTGCAGCGGCAGC
CGAAGGATGAGCAGATGGACACAGGTGTCCTGTCGCTGGCCCATCAACACCTCTCCTCGG
CTGGACAGCACCAACACACCAACACAGTCGATAACAGACGAGTCCGGCTCTTTTCATTTT
CTCAACACGTAAAGCAAACACGTGACCGTTAAGGACACGGACTCCTGCTCTGCCCCTTGC
TCTTAGCCAAAGCTGCTCGGCCCACTCTGCTCGGTTGTAGGCGCAAATTGCCAACAGAAG
GACAACGACAGAGAGTGCACTGAAAAAAAACGTAGAGCAATATAAAATAAACTAAATTAA
AACGCATTAATCACATTATTGCGAAATAGAAATTTGAATATTTAAATATTCTAACAATGT
GTATTTTTATAAATATAGCTCTTGGCATAAATATTATTTCTCAGTGTGCAACTGAGAGAC
CCCGCCGTAAACTGACGGCTTATGGCAGACACAGCACAAAGCTACGCTTCGTTCGCCCCC
CGCTGCACCACCCCCTGCACCACCAACACTCCCCCCCCCTTGCAACACATCACATCGCAG
CTACGTGCGTGTGTGCACAATATTCATATATCACAAGGATAAGCGCAATGCAGCAAACGT
CCTTCCAGACGTGCCGTTCGTTGTTGTTGTTGTTGCTGCTGTTTGTGTGTGGTGCCTTGT
CCTTTTCCCGAGCCAACTGCCTTGGATTCAGTAGCTCCAACACCTCCTTTCCCGCGCCTC
CTGGTGTGTGTGTGGTAACTTTTAATTATTTGCGAATGTTGGCGCCAGACGGCGAGATGC
GATGCGATGCGATCCTGTCCAGGACTGTCGCCCGTGCCATGCTGTCTCCTTTCCTTCATT
GATTCCGCTGACCAGCGCAGCCCAGTAGCTTAGAAGCGGTAGGTGGGGATGGGTGACAAA
AAGGGGGGTGTTCGCCGGTCAAGGCGAAGGCAGAGCCAAAATCCAAAGGACCCATAAACT
TTGAGCGCCATAAAATCTGCTGGCAGCGCCATAAAAATTCACACAGCGGGAGTTGGAGAC
TGTACCCACCAAAGACCCCTTTTGGCCATACTGTACCTACTCCCTTGCCACTATGGCTAG
ACAGCCATCCCTTTCCCACTCGCAGCGACAAACGCATAAAACTAACGCAGCGTAAACGCC
GCCGTTGTTCTCATCTGTCTTCTCGTTACGTTATTTCTTTTTGGCAGCTTCAGCAGAAAA
TTTATCTTATTTTATTTGTTTGACTGAAAGCCAACACACAAACGGATGCCGGCGAAATTG
CTGCATTTTGATGCTTGACTGATTGTCCCCACAAAACATATACATATCTTTCATTTGATT
CCCCTCCTTCTGAATGGTTTCTAACCCAATTACGTAACCCAATTCTTAGTAAGACCAGCG
TAGGCGGCCAAATTGATCTGGCAACGCTCTGCGTGACATGTGCCAAAAGTATCGAGTGCG
AAGGAGATGACTATTGTAGGCGTGCGGAATATCATTCTTTCATTCTTCTTCTCCGAAGAA
CGCTTGACGTTGCCGCTTCGCAAGAGTTCGCTTAAGTCAAATAATCCAAAAGCATCCTGC
ATCCAAAAAAGTTTTAGTTTTTGCTAAACTAAAGCCAATTGTGTCTTGTATTTAGTGAAA
AAGATCTGAATAAGATATGGTGGTGGGTGTATAAAAGAAAATAGAAAAAAAAAATTTTAA
ATTTGTGAGCTTGAAAATATAATGCACAAAGTGTTGCAATTGCAACGATTTCAATTGGTT
TCAGGTTCTAGTGTCTTATTCTTGGCAAGTGTGTCCAAGAAGTGCCCGAAAAAGTGTCCA
TAAAAGTGCGGAATTTACCAAAGTAAAAATGGTTTTTAGGTTAGGTGTCCCTGAAAAGTT
ATTCTTGGTGAAGAATTACTTATTCCACGCGTGAGTTTTTGGCGAACTGAAATTTGTACT
TCAAACTACCACATCTCTCCCGAATCCGCAAGACTAATTCATAATAATTAATAATTTTCC
ATTTCATTGAACTAATTGTTAACACCATTTTTGTTTTAATTACTTTTTATTTCTATGACT
AATCTTAGATATATTCATTTTATTTAATTGCAGTCCCAAAAGTCTCGCCAGATAGCGAGG
AAGAATCCCAGGCCACGCAGGCTGGATATCTTGTGGCCAGGGTTGCCGAGGCCTTCGCAG
CTGCAAGAGCAGCTAGCCCAATCCCAACCAGAAGCCTCCAATCCGCAGGAGAAGCCGCCG
CTAAAGCCGCAAAAAGTTGACCTCATGACGATGGCAGAAGGCACCGACCCCATGGGGCAT
GGTCACCACACGAATCCGCACAATCCGCCCCAGCAGCCGCCGCAGCACCATCCGCACCAC
CTGCCCCTGCCCCATCCCCCGCCGGCACCACCGCCGCAGCTACTCAATTTCAATCACCAC
CAGCAGCAGTATCTTCCCCACATGTATCCTGCGGCAGCGGCAGCGGCACAATCTCACTCC
CACTACGGTGGCCTGCAGTATCCCCATCCACATGCGCTGCAGCATCAGCATCATCCCCAC
CAGCACCAGCATCACTTGCCGCTGGCCTTGAGCCTCCATCAGCAGGCGGCTGCGGCGGCG
GCAGTGGCTGCAGCGGTGGCCACCAACCACTCCAACAATAACAATCAGGCCAGCGTGGCC
AACAATAATATAGTGGTTCCATGGAAGCAGCGCAAGCGCAAGAGGCTCTCAGCGGTGCTG
GACAAGCTGCACCACAATAATAATAATAATAATAACAACAATAATGAGACCCACTCCAAT
GGCATGGCCTGCAAGGCGGAACCGATGGAAATGAAGGGGGATCTAGCCGAAGATGCCGAA
CAGGATGAAGATCATGATGGGTCCGTGCCTGATGAGGAAGATGATTCCGTAGATCAGGAT
GGTGATGCTGGCAAGTACATCAAGAGCGAGCAGCCCGTCAGCGAGGACGAGGAGAACGAA
CAGGAAATGGACCAAGATATCGAGGACATTTCCGGCGAGGATCTCGAGCTGTCGCACAGC
GATGATAATGACCAGGACGACAGCCCCAGGATCAGTATGAGTCCTCTGCAGCTGCAGGCC
GCCCAGAGCAATCTGCCCCAAGATCAGAACCAGCCGATGAACAAGGAGAATCCGCTTCAT
GTGGACATCAAGACTGAGATCCCCAGCCCCTATGATAGGTATTTCCCTATACCATCTCCT
CTGTTCGGCTATTACCTGCACACCAAATATCTGAATGAGGTATTCCGCCGGCGTCATGAT
CTCTATCCCTCGCCTCTGCAGCACACTCCATCTTCCATAGCCTCCGAAACGGAGACTTCA
CCCAATGCTCAGGAGCGCAAGAGTAGCTCCAACCACGTCTTGCCCCACGCTCTGTTGGCC
AATAATTCACCTCCGCCATCGCTGCCATCGCCACCGCGCAGCGAATCCTCGGTGACTAAC
AATGTGGCCACCACCACCACTAGCAGCACCACCAAGAAGCGCAGCAGTCCCAAGCCCAAG
GGCAAGAAGGGTGAGAAGAAGCCAATGCCACCGCCGCAAGAGCGTCCCTTGGATCTGTGC
ATGCGCAACGAAGTGGAGCCCAAGAAGTACAAAAAGTCAGGCTCGAAATCCTCTCTAGAG
TCCCGTTCCGCCGGTATGATGCCGCCGCCGCCGGCTCTGAGTGCGGCCAGCAGTTTGGAG
AGCATGAGTGCCCTATCACCGGCATCGAGTAGCCACTCGGGTCACATGCCCATCACCAGC
GCTGCCACGCCCAACCACCAGCCACCACCCAATTCCCCCTATGCCAATGCCATGAACGCT
GCCCATGCAGCGGCAGCAGCGGCGGCGGCAGCCATGATCAAGATGGAGATGCCTTTGCAT
CCGCTGCACCACCAGCAGATGCATCACTCGCAAGTGCCCACCACCACAGTGGGTGTGCCG
GTGATCAAGGGCGATGTGGCCTCGCCCACAACAAAGGAAACGGTCGCCTGGCGTTACAAT
CTGGACGTGTCGCCCGTGGTTGAGGAGATGCCGCCCGGTTCGGATGTGGCTTATGTATGC
CCCACCTGCGGACAGATGTTCTCGCTGCACGACCGCCTGGCCAAGCACATGGCCTCGCGT
CACAAGTCCCGCAATCCCGCCAATGATATTGCCAAAGCCTATTCCTGCGATGTGTGCCGG
CGATCCTTTGCCCGCTCCGATATGCTGACCCGCCACATGCGCCTCCACACCGGAGTCAAG
CCGTACACGTGCAAGGTGTGCGGTCAGGTCTTTTCCCGCTCGGATCACCTGTCCACCCAC
CAGAGGACCCACACCGGCGAGAAGCCCTACAAGTGTCCGCAGTGCCCGTATGCCGCCTGT
CGTCGCGACATGATCACCAGGCATATGCGGACACACACGCGGTACGATTCCAGGGGAGGA
TCTCGAGAAGGCAGGGAAGGACGCGAAGGACGTGAGGGCAAGGAGAGCCGCGATTCGCGC
AGGAGCAACGAACGAATCGAGGAGCCCAACTCGCCCGGTTCCCATTCGCTGCTGGACATG
AAGATGAACATGAACATGGGCATGGGAATGGGCCTCAATATGGGCCTACCCATGAATCCG
ATGAGTCTACTGCAGGAGGAACTGCTGCAGAAGTCCCAGCCGGGCCTAACCCTGGGTGGA
CCCATGCCACTGGTTGTCAAGACGGAGAGCGCCTAACGGTGTCTGTATGCAGCAGCATCC
AGACCATTTATGACCTGTTAGGTAAAATCCAGTCCATCCAATCTCCATTTGACAGGCCCA
GCTTAGTGCTACAGAAAAATATCTGAAAAAAAAATAGAGAAAAGAAATGAAAACATATTA
AACTAGAGCAGTTTGTACTTGTACCGGAAATCTCTGCGAAGACTGAGGAACCTTAATACT
ACCTACAGTTTAAATAATAGGCTAAAGAACCATCAACTAATTTTGTAAAAGAGGAGTTAG
AGGGCAGCACTCATATGACCACCCAACGTATTAGAAGTTTAACTAGTTCTAGTTGCTAGA
TCCTTTCGCGCGTCAAATGAACCCCCAGGAGTTTAGATAGCCAGGATCTTCGATACAGCT
AGCAATTCCATGTTCCACACCTAGGCTATACTACACTATATATAGATATATATATATAGA
TATGGGTCAGATCCATCGTCCCGATGATCTGATCTCTCAGCATTTTGAGCAACGTTGAAA
TTACTAAGTTAGACTCGCTACTTAGGCTTCATAGGCACGCCGCATTGGAAAAGGCATTAC
TTTTGTACTCCTAATTTTAATTAATTCTTAATTTATTTGTAACATTACTCAGCAGAATGT
AAACTTATACCACAACGATTTGTATTAATTTAATTTTACCTTATTTAATATTTAATTTAA
CTTAGTTTTAAGGGATGCCTGCCTACACAAGAACACAAACAAAAGACAAAGAATTCTCCC
TAGGGCTCAAAAAGAAAAAAGAAACGAACGCTACACAAAACTCATTTCTATGGAAATCTT
AAATCTTTAATGGAAAAGAAAGACAAAAAGAAACAATTCCTTTTTTTGTTCAACAAAAAC
ACTGTTAAATTTACATTACCTTTGTAATTGATTTAATGCTTGCTCTTCTATTATCTAAAC
TACTTTTTGTTTTCATGAAATGAAATAAAAACTTTTAAGTTTTCTTTAGTTTATAAACCA
TCTGGGGATTGGAAACACCTCACCCCCTTCCGCTCCCGCAAGTGGGGACACGTTAACCCG
TTTCTGCCCCCGGGGGTGGGAATCACCTCACCTTTCGTGGTCGTTTACATGTTTCAAGTT
AAAGTTGTTCGTTATTTATTATAAAAAGAAATGAAACAAAGCCCCGACTCCCGATTATTG
ATTATTAGTTCTTAGCTAAACGTTTAAATAAATTATTAATTTATGTTATTCTAGTTGGTT
ATGATTAGCACTTAGTTAAAAACGTTTTTCACAAAATAAAACAAAACAAAGTCTATACAT
GATGGACAATGTCATACAAAACAGAATTTAAAGCCAACGTAATTTGTTATTATTTCAATT
GGTTATATATATTATTTTCAGCTGGATAATTTAAATTGAGTTGCACATTTCTATGCTTAT
CGGATTTCTTTTCTTTTGTATTTCATAAACTCTCTTTAGTATTTTGATTTAATCTTGGAT
TTGTTATACATTCTATCAATTTAGTACACACATAAAATTTAAATTCTTGCACTTCCATAG
GAGCTTGAAAAATATTCAAGCATATCCTTTCAACGGCTGCCCACCTAATTTGGTTATTAT
TTCACTGATTAGCAGTGTGGATTTTTTAGACATACATTTTTTTACGAGCCAAAACCCTAT
ACTTTCGCCACAGTTTTTGTGGGGCTGAGCCGGAGACGAAGTCGTTGTTTTAGCCGTAGT
CGCAGCCGGAGCCGGAAACTGGCTTACAAGCTTTTAGGCAATGGGAATCGCTTACAAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1475, 13548..13598, 24753..28099
24924..27332
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved