Drosophila_melanogaster Locus dpr10
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster dpr10
Drosophila_melanogaster
dpr10
3L
snoRNA:MeU2-A31
35380..35494
40653
GAAGAGCTAGTCTAAGAGCACCAAAGAATTGTTCAGTGCATGCGCACTCTTTGCCAAAT
TCCATACAATTTCTCTTTGATACTGACCTAAGTCTGTCAGTCTTGCTCAAGATATTGTCC
AAGGCAGACGGTTTGCTTCCCTTATAGAGACGAAGTACCTAAATATAAATAAATGAGAAC
GTAGCATGCACAAAGCGTATATAATAATGATAATTTAATATTAAATTATCTAAAATAAAT
GAATATGTTCTTGGGAAAAATATTATAACTTTTCTCATTTATTAAAATTGAACTTAGGAT
CTTATGGAAGTATATGAAATAACATAGTTTCCTAAATTCAGTTAAGTAAGCATATAAGCA
AGTAAAAAATAAATGGGATCAATAAGACATTATGTTGTTTTTGGGTTTTGCTATAGTGAT
TATGTTCTTTTTATGATCCTTCACTCCCTCAACCGGATTAATTCTTTTTATTTCAAGTTT
CAACTAAAATGGCTTAGATTATTTTTTTTTAAGAGACCTATAATAAAGCACTCTAGCTGA
AACATAAACTGAAATATTACTCTGCTTTTAAGAACTGGAATCCCTACGTGTCACTTAACT
TCACTGCATTAAAATTAACTTAACCCCTTAAAAACAGGATCGTAAAGTCCGCTTTTATTT
GCTTTGCGAACATAATTCGACCTCAAAAAACACCCTGCTGCCACTAAAAAAATAATCGCG
GATTTCCAAAACTATTTGAAACCTTTTATTGTAAGACCTTGAAAGTGAACATAGTGTTGT
GATTAAAAGAGAAGAGGAAATTAAGAGAGATAAATGCGGCGAATTCAGCTGAAATGCTCG
GCACACGATTTTTCCGTCCCTCTTTTCCAACGACTTTTCCCGAGCCGAAGACAACAAACC
CGAAGCGTCGCTGATAAAGGCTCGTATGAGTTCGGGAATCCCCCCCGGAGGCCCCAACAA
ATGCTCCACTGCTGCCAGAAATCAGTTTCAGTTTCTGTTTCAGTTTCAGCGCGACATCGA
CGGTGAACGAAAGGCGAAGGCGCGGAAAAGCGCGTGAAAATCCGAATAAAAAGTTGAGGG
AAATGTGAGGCCCAAATACGTGAGGCGCGACATTTTCCGGACTATAGTGTATGTGTGTGT
GTGTGCATGTGCGTGTGTTTCTGTGACTCGAGGCTAGAGAGTGTGAGTGCAAACGGATAA
GAAAAGCGGGCACAATTGGGTCGTAAATTTTGGAAAACGTGTGAAAACGCAGGAAAAGCC
TCATTGCCCCATTGCCGGCAGTCGAAAATTGAATGACCTTTTGTCGCTTTTTTTTTGTTA
TTCCAGTTACTGTTACTGCTGTTGCTGCTATTGCTCTTATTGTTAAGCTAAAACGCTTTC
GGCACGCGAATATTTTACGACATCGTCTCCAAAAATTATACACCTAAAAAAGAAAAGTAA
TCAGAAATCTAACGAAATTCGGTGCGTGTCAGCTGCTTGCCAAATGTGGGGCCAGAAAAA
ATGCAGGAAAAGAATTCTGTCTGCGGACAAACAAATTATAAAAGTGTTAAACGCCCACAC
AACGTCCTCCAGCCCCGCCCCTTGGCCATCTCATTAGCATGCAGCAAATTAAGTTGTTTT
ATATTTAGACCGCCAAAGGGGAGCCCAGACCCCAAATACAAATTAACAAATTAAAACAAC
ACACAAATGCCAAACAAAAAACAGAACCAAACCATCTTTGATCTGCGTCAAAACAAAAAA
AGCGCTGCCACAAATATCGAGCGTTAATACATTCATTTCTGTGTAATCTAATATTCCGGC
CGAGGGGAGACACTAAAAGAATGTGACAAAAATTAATAGAAAACCCATAAAATATTAACG
GAAAACAAGTGTGCATTGAAATTTACGACAGACTGATCACAGTGCGTATGCGCAATGTGC
GTCGCCGCAAGAACCGAAATATATCTCTCGTATGGGTATGATAAGATGTTGTGGCTGTTG
GGGAAAATTAAGTTTCCTTGGGAAAAAACTTTCGCTTGTCTCAACTGCAGTTGTTGATGG
AAAAGTTTTGTCGAGTGCCAAGCACTTTGGCTTTTCAACGATTTTACTTTTGCCCGCCCC
AGCACCATTGTGTTGTGGTATCAACTTTTGAGGCCACGAGCTTATGTGCAATCCTTGCCT
GACATCCCCAAACACAATTAAATTGTTTCCTTTCTTTGTTCTCGCACATAATGCCATGTA
GCCAATAAAATGTGAAACCCTTTCTCAATAAAATATTCATACAGCAGGAATTAACCGGCA
CACAATGGGGCAGAAACAAAAGCAAAGATTGCCCACGGGCATTGGGTGGGTGTGGGTAGG
GCAAATTAAGCCCACCCGGAACTAGAGTTGCCTCCTAATCACAGTTACTAAACATTAGAG
CAGACACTGCCCCCAAGCTGAGAGGCAAAATGCAGACGCTTACAATTAGAAAGAGTGGCA
AGAGGACTCTCAGAAAGAGAGGGGGGATAGTGGCAACGAAGGAGATGGGAATAGTAGCAA
TTGAGTGCGTTAACACTTTTGAGAGACATTGCTGACGTTGGCAGGAGTCTCAGACTCCGT
CCCTGAATCCCGAATCCTTCCCTCGAGAACCTGGCCCTCCTGGTTCGCACATTCTGGAAC
CCCTGGCCCCTCCCTAATTCCATTACGGAGGCAACAGTGACAAGTGGCCAAGGATTCCAG
CCAGGATTCCCAACAGGAGCAGCATGTCAGCAGCAGCCACTTCTGATTGAAGTCGCACAC
AGAGGTTTCTGCAGGCAAAAAAATTAGAGATCAGGGATCAGATCCTTTTTAAGGATTTGC
TTTAAAACTATATATTTTTTAAAATATATACATGAGATATCGTATAAGCTGCTTAGCAAT
ATTGCATTAAAATGTATATTTTATATCAATGATTTATGATGGCAAGAGTTTGTGCATTGA
TGATTCATAAATTTTTTATTGTTTGAAGTTCTTTTTTGAAGTCCTTTTATAATATTTGTT
TATTTTTAATCAATAAATCTAAATAATTGTTATACAAAATCTTATTCAATTGTTTCCATT
ATACATAATTAGTTTCCATTGTTTCATGCGAAAATCTTTCCATTGTTTCACTGTACCGGC
TGATTAATTTTTTCTCAGCATGTCGAATGAGTCCTGCAGTTGAACTCAGACCTTAATCCC
ATCCCCCTACTCATTAGTCTGTCTGTCGTCTCTTTGGTGCAGCGGAGTTTGCAATTAATT
AAGTTTTAATTAATTTCACACAGTGCAAGAGGGAAAAATTCGAAAGGAAAACACACACCG
TGTTTCAAGGGGCGTGTGAAAAAGGCAATTCCCCAGCAAATGTTTAACAAATTAGATGTG
AGGAGAAGTGCCCGAGTAGCATAAAAGTTTTTCCCCTGGGCAGGGCAATTGATTGATGCC
AAAGTGAATGGATGGATGGCAGCAGGTCTGAAAATAGCCTCAGCCGGAAAATGGGGCGTT
ACTGCTTTGAACAGTTCTCCAAAAACGACTCATAATTTTGGGGTCGTGGGGGCGTTGAAT
TATTTTCGGATCCGGACACATGCCACCGAAGTTTTAGGAAATGAAATATGCAAGGGCAGC
TGACCAGAGACACTTCAATCCAACTTCTGTCAAAAATTGATTCTGGTTTATGCATTAACC
ATTATTAATTGTATGATGTGAGCATGTCCTTCAAGGGAAACTGGATTGGGCGTGTAATGT
TCTTCTAATTTGTGGTGTAAACTTTTGTGCGCTCATGGAGAGGGAAAAGGATTCCATTTT
AGGCCACTCACCTATTGAAATCAATAGTGGATTGCTTAGAGAAAGAGCTGTTTTATTGGT
TAGCAGAATTTCTAGAATCTCTTCGAGAAAATCCTTGTTTTTACCATAGTTTATTATCCA
TTAAAGTCTGTTATTATCCATTATCAGCCCTAAAATCAACACAAATTTAATCAATTCATG
TTCCACGACATCAAGGGTGATGCGACGAAAAAAAAAAAACAACGAGACCCGGACAAATGA
AATTCCTTTTAAAGCTCTTTAGCCCCAGACGAAAATCAATTCTTTTTGGGTACGTTCCAG
GCGGAATGAAAATAAAAAGTTGTCCATGGAAATGCGAAACGAGTCGGGCAACAAAAAATA
TTATTTCGGCCTAGGACGAGCCAAAAGAGCAAACACAAGTGCAACTGCAATTGCAACAAG
CAGCAGCAACAACAGCGGCAGCAGCAACAAGGACGAAAAACAACAAGGACGATTCTGAAA
AAGTTCAACAAACGAACGTTAAAGGATTAAATTGTCTGCCATTGATATTAAGTGTTTTAA
ATGTCATTGCAAGTGTTTAATTCACGCGAAACGAAAAGAGAAAATTGAAAACAGGCGCAA
TTGCAGAGAGAAAAATTTGCATACAAAGCTACAGTCTTAATTTATATTTATTGCGCTGTG
TAGAACTATCTTTTATAACGTTTTTTAATTTTACAAAAATTGAAGATAATTTTTGTAGGA
ATAGCAATCTTCAACCTTTTTTGTAATAATTGTAATAAAAGCTAATAACGCAAGCATGTT
TTAAAGCGACTTATAGTTTTTCTCTCTGTAGATGAAGCTAATAGAAAGGAAGACTTAAAA
AAGTGTTGTGAGTGAAAAAAACGAGTTCAAAACAAACATATATTGCCGTAGATCAAAACT
CGCAAAGCCAAGTGCGAATTGATAGGACAAAGGCAAGCCTGATAAAGTGAAAGAAAAAAG
AATCGAAGGAGAATTTGAAGCAGAGTGCAAAGGTTGTTGCTGCAGCCCTAAAAAATAACC
ACAAATCGAGTGGGTCATCGCAAGATGTTGACCCTGTGGACGGCACTTTTCTGCTGCCTG
ACGGGTAAGTCAAATTCCCCACAGGATCCTGCCAGCACACACAACTCATCCCATAAAGCG
CAGTCTGCTTAAGCATGCATAAGATTATCAGCAATATATATACCTATTATATACATATAC
AATATAGGCCTCCATCAACCCGCTCAAGGTTGTTATTGTTGCCGCCTCGCCGGGCGCTGA
ATCCTTTTAAAAACATTTGTGGTTCGGGCTGCGAAAATCCTGATTTATGTTTCTGCCTGC
TGCGTTGTCCTTGCAATCCTGTGCTGCTGTTCTGACATGGCCACTGCCAACCGCAGCAGG
AGCAGTGAAAGCGATGGGTACACGCAGAGGAAAGTCTAGTACTGAACTGATCAAATAATA
ACTTTTTAATAACTTACTATTAATTCTTAACTACAACCATATATTTTTAATATTATTAAT
TGATAACACTTCTTTTGAACTGAAATAGGCACATACAGTTTTGATCTTTTAAGAAATACT
TAAATAGTTGTGACAAAAACAAACATTATAAATATTTCGATGTATATGTATATAAAATAT
ATTTCAATTTCGGATAAAATTAAGCTTATATTTTTCTCAGTGTAAAATTGAGAGACCAAC
GCGGAGCCAAAGCAAACAAATGCGGTCGCTTGCTGGTCGCTTGGGGTCGTTTTTAAGGGC
ATATCGCATAACAGCAGCTCCGGTGAGGAATGAGGGGTTAAGGGTTATGCTGTGCGGAGT
GTGGTGGATTCAGGGGTTAAGGATGAGTTGCTGGTGTCACTGCACTTTAAATTTTAAACG
CGCTTCAAACACACACAAATTGCTTCCTACACATAATTATGCATAATTGAAAAGTGTAAT
TATGCCCGAGACTCCGACTTTATGAGCCGCAAACTGTGCGCTCAATCAGGCGGACAGCAA
CAGTTGTGGGTGGTTGGAGGAATGGGTGGTTGGGTGGTGCTGATGCCACACAGGGCCAAG
TGAGCCACCAGTCGACCCACTCAAACGCAATGTTTATGAGTCGCAAGTCCTTTTAATTGC
GTGCTGCCGGCGCGAAGCAAAAGGGCAAGAAAAGCCAAGGAGCGTTTTATTTTTCCCAGA
TAGATTTACCTTTTCTCCTATTAAATTTCATCCTGACATCAGCAGACTTTTCTACGGAAT
GGCATTTTCTGAGAAAAATATGATATAAGCATTTGAAGTCATTTATAAAGGCATTATGCT
ATAATAATTTTACTGAATTTTAAATATAAAACAATTTTCTTTAGCAAACCTAGAATGAAA
ATATTTTTATTTGCTGTACTTCTTTTTAAATTAATGGTAAAAAGAGTTTTTAGTAAATAC
ACAATATTCCAGCATGTTTTGATACAAGCGTAAAAATATGAATTTGCGTTGGCAGTACGC
AACATTTTTTAGCGAGATCTTTATAAATGGATTTTTTCCCTGACGCTGACATATATGTTA
GTCATTCGATGTCGGATGGTTATGTAAGCAAAAACTTATCGATCCTAACACTATACCTGT
ACACTCGCCATGGCTTTATGTGTTATGGCTTTATTTCTTTGCCATTCTGGCAGCCAACTT
TTCATTGTTTGTGTCCTTTGTTTGGGCTTTTGCTCCTGCCAGTTTGGCCATGTGTTTTTA
TTGCATTAATTTTTATGGTCGCTTGCTTTTGTTGTTCTTTAGTTATTGTTGTTGTTGTTA
CTGCTCTTCGGAATGTTTTTTGTTGTTATTTTTATTGTTGCTAGCAGCGTTACCGTCGAC
TGCTCTTGTTTTACTTAGCTGCGTATGCCCCAAAGTAATAAAGCGAATTGGTTTTCCTCA
AATAATTTCCATTTTAAATCCAGTTCGCAAATCCCCGCCCACTTTGGTGGATTGCAGGTA
TTTTCTTTCACTTTTTGCTGTACTTTTGGATTTTCCTTTCCGCGTTTTGTTGTTATTATT
TTGGCTGTTGTGGGCGCTAAGCAAAAGTGGCTTCACTTCCCGCATCAGATTGTTTCTAAA
CTTTTAGACGAGATTTGTTGTCGTTTGCCAAAAAGTGGCAAGTGGCATCGGCAATTGTTT
CTCTTCGGCTGATCCCTATGTATATACCCTGATATATATATATATATATATATACTACTT
GAATATTCCATCTTCGAAAGCCCCTTGATGGTCTTGTACTGTCAGTTGTCAAAGGAGGCC
TCAAAATTTAATTGAAATTTAGTGTAAACACAATGACAGCCAGTCGATTATCCTGCTGCG
GCTGCTTCAGTAGCTGCTGCTCCATTTCCGTTTCCTTATCATTTCCCTGTTAAACTCGTT
GGCAGACTAAACTCACAATATGTTCAGACATGCGTGTACTGAGAAATAAATTCTAAATCA
GTTTGAACCAAATAATAAAATATATGTCTCCTCAGAACATAAATTTTATAGATTGGTATA
TTGTTATTTCCTTTAAGTAAAATCGAGTAATATTCAATATTCAACATTACTAGAAAATAA
GGCAAATAGTTTTATTACTGATAAGAGTATAACAATTTAAAAGTTATTATGGTGGTAAAT
TTATCTGTCTGTATAATTCGCTATATTTCGCGGGTAAATCCTTTGCGCGCAAATCCTGAC
AACTTCGGCTTGACTTTCCAATTTGCCATCGTTCGCCCCTTGTATGTGTCAAAAAACTTG
GAATCGGCTCCCCTGACTGGTGCCCCCTGACCCCGCAGAACATAACATTTCACACGTGTC
ACTGAGCAGTGAGTTGTTGGCTGTCAAGATGCCACAGCTACACCGCCCCGATCCACGTAT
CCTGCGAGTCCTCCGAACCACCGACAGGAATCTAACCCGCTGCCAAGACAACCACCAACG
AAATGGGAGGCAAAACTGTATCGGTCCCGTATTAGCATTCACTCACTCGGCTAGAAGGCC
ACGCCCCCAGGCGACCACTTTTCCAATCCCCCCCCCCTACCCCCTCAAGAAATTGTTTGC
CTATTTGCTTTGTGCATATGGAAATGAAATGGCAAACAAGAATGAGAGCTGAAGTGGAGC
AGGGAAAGTCAGGGAAAAATTACGTTGACACAGGCAAACGCTCTCAAACACAAACGCACA
CATATGCGCGGCAAAGGAAAGGCTCAATCACACCAACGCCAAGTCAGACTTTCACCGCGC
ACAACCCTATTTTCCCTCAACTTACAGCAACAGCTTAATGCAATTATCAACTGTTTCCTT
AACAATTTACTACACTTGAAACATGATTTGAATTGTTTAACGTCAAATAAAGTTTTAAAT
GTGAAATTATATATATATAATATATATATATACAGCCTCCACATAAAGGTAATTTCATCT
GGCCAATTTAATCCAACAATTAAACTTCATAACAAATCAATGAAAAGCTGGACAAAATGG
GATTTGTGAGAGTAGTGCACTTACTAATTACCATTACCATGGCTACCGAATAGTTTGACT
AATGAAGACGAAAGCTTTGCTCAATTTAGTTTTATCACTTTGAAATGCAATTAAATTACT
TAAGGCCATTAAGCAACCCTTGGCAATAAGCAAAGTGTACAGCTGTTGGAAGATTAAAGC
GCCAATGGACGGTTCATAATCGCACTGATTAACGATATGACATAACTCAGCCATGATACT
GGAGACTTTTTCTCACGCTCGAGTTTAACCCTTTTTCTTGCCAATTGCTACCAAAAGCGT
TGATTGCCCCTTTTTAACCCTTTTTTAAATGGGCGAGACCTCGCTCGAAAAACTTGAAAA
TATTCCAGAGCTGCTCGTGCTTCGCCTTTTTGGGTTGGCAGTTCATTTGAATTGTTTTTT
TTTTTCTTCTGTTTGGCTGCCATTTGTATCCTTTGTAATAGGGTTGCCTATTTTCAATTC
TCCCCCCCATTTCATTTCTTTATTTTGCTTATCGGGGAAGCGGCAACAAAAAGCTGAGAA
AAATAAAAGCGAATAGGAGCATGAACAAATTGTTTACGGATGTGTTTGCGACCCGCTCCT
CTGGCAACAAAAAAAATATACAAAAGGGGGTTAAAGCAAACCCCAAACCAAAACCGAGAA
AGGATGTAGCAGAAATTCATAACAAACTACATTTCATGGCTTGGTGTCTGTGTGTTGCTG
AGGAAATTCACTTGACTTTTGGCCACCGTTTCTTTCCATTTCCATTTTTTTTTTCTTTTT
TACCAATTTTTTCTTGGCTTCTTCGGCATAAATAAGCTCTGGGCCAGGCCAAATCGGACT
GCTGCAGTTGTCGCCATTCTGGGGCAACAATGGCCAATAGGTAGCGCACACAAACACAGG
AGCATGGGTATTTTGCCATGGCACTTATTTATGGCTATTTGTCGGCGGAGTTGGCCAGGA
CTTTCATGGCATCTTTATGGCCCCTAACTATATATGCATATCGCAGCATTGGAAGTTTGC
AACTTTAAAGTCAACAGACTGCCGGTCGCAAAATATGGGGAAAAAAACACACTTCGCCCA
AGAAGTTTACTTTGCAGTTTCTTAGTGGGCTTTACTTAAGCTCTTTGCTCAACTTTTCGT
CAAGTTCTTGTGTTTGGCTATCCGTTGCCAAGGAAATCCTCTTAATCATCTTTGCCAATA
AGTGTTGAATAAATGTGTATCTTATTTATTGCATATTTAATCCCCATCTACAATAGCTCT
CGAAAACCAACTCGATTATTAGTTTTCAGGCTTATTTTTCTCTGGCTCGATATTCAACGT
CAATTGAAGTCAATTGTTGACATATTTGCCAACAACAGACTTCCATAACAGCCTCCCTTC
GTGGCTGGCTGGCTTTTATTATTACGCCAAATTGATTTTGAATTTAGTTCAATGTTTATG
GTCAAATGATTTCATTTTTGTGTCAGCCAATGGGTGGTTGAAGGTGAGCCACGGCAGGAC
CTCCCTCAATTTTTGCCCTTTGTCTAACTTATAAATCATTTGTGCGGCGATGCGTAAGCA
AACGCCCCAAAGAGCTTTATGAACCGACTGGCCTGAGGGGTAATCCAGGGGCCCAAAAAT
AAATATGTATGTGAAACGAGGTAAAAATGAAAAGCGATGCCCCGAAAGTAATCCCCAATC
GATTTACAAAAATCCACAAAAAAAAAACCAAAAAAAAAAAAAAACAGAGGATACAACGAA
GTGTAAAGGAGAAGCGAGACTCATTCAATGAGTTTCCGTTAGCCATTTGGTGACTTTGAG
CGAGGTTCACTTTTTGCTTTTTTGCATAGAGGAAGTCTTATGGTGTCGGGGAATATGTAT
ACATTTTTTATATATTTCATATCCATTAAGTTCAAAGCGAAAGATGTGTCCGGACAGGCG
GCAACATCGGCGGAAGCCTCTAATGTATTGGCTCCGAGTCCACTTGGGCTCCCCTATACT
CTGGATGCTGCTGGGGCACCTCCAGCAAAACCACCCCGAATCACTCTGCACCACCCTGCA
CCACCCGGAAACACTCTGCACCACCTAGCTCCTCTGATTGCCCCAGTACGGTCCGCTTTT
CGCCCGGCGACGTTGAAATTTCAATTACTCAGGCAAAATGATAAATGAACTTGTAGCCGC
AAATTTTTGCTTTGCCTTTTGTCTCGGCCAACTCGACCTGCCTCGTCCCTCTGCTGCCAC
TTTCTTCATTCTTCTAACCAAAAGCCATTACGAAGACAGCCCACTAAGTGTGTGGGCGTG
GCAGAGACAGCGGCATGGGCAGACATGTGTGTATTATAGTGTGTGTGTGTGCAACTTTTG
CCAGCTCCCCAAATGTTTGACAGTTTTTCGCACGAAACAGACCAGCATAGTGGCTCATTA
AACTTTACCAACTATTCCGGCACAAAGAGTCACAAAAAAAGCATGTCTTGGCTTAAATAA
AACATTTTAGGAAATTATTGTCTGACAAAAACGATGTCATTTGGTCTCTTAGTTGCGGTA
CAAAAATAATTTGTACTGTGTTCAATTTTATACTGGCATTTTTATACTTGCAACATTGTT
TTTAAAATTCACGAACAAAAAACTGCTTATTATGCATAAAGTTATTTTTGAACTACTCCA
TTTGTTCAATGTTAGTTAGTTAAAATTAAAACCTTTTTAGTTTCGCTTAAAAAAAATAGT
AAGGGAAAAGCCCTTTGCATGCGTTCTTAATTTCCCCACTTCCCTCGCTGCTTTTCACAC
TTAAATACCCTCTAAGTGCATACTTTTTTAACGCAATGTTTGAGTGTGTTCAACAAAGTT
TTACTGCGAAAAGGTCGAGAAGGGAGTGGTCCGGTTTTAGTTTATTTTAATAATATTTGC
TTGGCCTGCAGACCGAGTTGTCGTGACTGCAGTTGCAACAATGCATTAATGCATTTCTCG
CTGTAGTGGTGGCTGCAATTGCAGCTGAAGTTGCACTGTGGCACTTAATTAGCGACTGAA
ATATGTGGCAACGTTTCGGATGGCGCAGCATGTTAGCGAGAATTGAGTTAATTAAATAAG
CTGGCATGACAACTGCTACTAGAGCGACTTCATTAGGTCCGAGTGACTTCAACGAGCCCG
CCCAATCCGACACACATGGGCCCACTCCACACGCCCTCGAGAATTCAATCACTCAACAAC
GAATTCAACAATTTCCAGACACTCATCAATATTCAGGAGTTGTTTTGTTTGTTCGTTGTT
ATTTCCGCCGATGCACAGGAGGAAAATTTAGTTTGCTCAGGATAGTATACAATTTCTTTA
TTTGTATAAATATGGTATATATCATGAATTAAAGTGCACTTAACTATCGATGTCTTGTCC
AAGTTCTCCTACCAATTTATATACATTTTTTATAAATTAAACTATACGTTCTTTTCTGTG
CTGTCTGTCCAGGATCCACCATTCGTACTTCGGCTCAGTGAGCCACTATAAACTCCTTTC
GACATCCACTTAATTGCATTTCATTCATAGCTAAGCAGCCATCCTGCGGAATGGAAAGAG
AGAAAGGTGTCCGTAATGGTGTGAAGTTTTATTTCCCTTCAATGCCATTTCACACTCGCT
CCAGCGAATTGGTTTAAGTATAATGCAAAAAACAGCGAAACAAAAGAGAACTGAAGACTT
CGGGACTCGACTATGAAATGACCATTAAAAAGTTGCTTACACCTTGAGTTTATAACAACA
CTAAAAATAGTGTTATATGTTGACTGGGTCATAAAAAGGCGTAGTTTAATTAATCATTAA
TATGTTTATGACAGTGAAAATATGTCTACCTTGTACACATGCTTGAAAATGTATGGCGTT
GTGGGTCTTGTAGAAAATATGGTTCTTACGTTTAGCTTCCTAATAAATTATAATAAAAAA
TTTTCAGAAGGTGATACAAATAAACATATTTGTCTAAAACAAAAAGAACAATTTTACGGC
TAAAATTCGACGAGAGGTTTTCTGATATACCCAATGAATACTCATTTCAGAGGCGCCAGG
GCAGAATGCAATGCCAAGTGAATGTTTGGGTGTTCGGTGGGGTGAGTGATTGCGGTGGGT
GGGGTGGTTTTGGATTCGCAAGGTTGGTGGTGCCAAGTGGGTGGTGTCGAGGCGGCAGAC
TGTGGGTGCGAAAGGGTGCGAAAGTGAGGGAAGCTGCCAGGAAAAGCGAAAGAGAAGGGC
CAAACAATGGGTGCAATGAGCGCTGCAAGTGGGCAAAAAAAAACGAACAAGTGGGCAAGT
GGGCAAAAAAATGCCTCTCATTTTGGACAAAGTTTTGCAATGCGAATAGTTACCCGCCGA
AAACAAATGAGTGGTATCGTATGCACAAAGTTCGGAGAAATTGAAAAGAAAAGAACATAT
GAAAACGAACATAATACGGCTTGGAGTCATGTATTGTATCAATAACTTTGAACATTACGG
TTTCATTTAAAACTTTCTTTACCAATTTTTGCTGTGAAAGACGAACAGTTGCGCCATTTA
TATCACTCATACGCCATGTGGTTCTTTATACTTTTGGTAGCCTTTGTTTTTATACATCGA
CTGTTTCTATACGAAGTCCACTGTTTGGAGCCCGTTTTTCCTAGATCTTACCCTTTTTGT
TCCCGTGACTTTTAAATGGGGCACGGACATTCCAATCGCTTTTGCCTTTTTGGCCTGCGG
CATTGGCGGTGGCTAAAAATTGAGACGTCACCACCAACGCAGCAAAAGGAACGCAATGGA
AATATAAAAAAAAGAGAAAACGAGAAAATGGAGTGACTGGGGCGAAAAAAGAGCAAACTT
TGTTAATTGAATTGTACGCTGCACGACTTCAATTGCAGGCGCTTTCTGAGCGATTTCGAT
CGCGCTTTTGCGCTTTTGGTCAATGTTTTAGCTGTCAAAGGGGTGTGGACGTTAGATGGC
TTAAGTTTCGGCGTCTATTTTAAGCGTTTTGGTGTTTGGCACGTTTCTCGCTTTATCTCC
GCTCGCCGCACAGAGCCAGCCAACATGACACCCCACTTTAGTCCGCTTGACTAAATGTGT
TGGGATCCAAAACATGCTATGTAAACACTTACGACCGCACATCTGCTGCCAACACCCCCT
CCCCTTGTCCTTCTCCCTTCGACGGTTTTATTAATACAAATATTAATTTTTGCGGCGCTG
CATGTGGCAGGTTTGTTTACACTGACGCCATTGCCGAAACCACCCAGGGATTTACGAACC
AACCAAACAGCCACCCACCGAACATCACGCCCCAATCGTTGGTGTTCGTGGTGTATATCA
TTATCCCATTCTCCACGCACTTCAATTTGCATGAACAAGGCGAGCTGGTCCCCCTTAAAT
TATGTGGCACAAAGGCAGCGTGAGAGCCATCGCCCAAAATGAGACTCCCTGACCAACGAC
CTTGGCTATGGCTTCATTTCTGGTCCCTGCTTTTGAATAACTTAGCCGGGCTGAGAACTT
TTGGGGCCCATCTTCTTGGCCGAGTTAAAGGGAATGCATTTCTGAGTTGATGAACAGTGT
CCATCAGCGGCAGCTCATCTCCGGGCTCTATGAGATGCACAAGAAAAAATAAGACAATAA
ATTCAGAGAAAAAAATTGTTGAAAATTGAGGAAACACTATGAATGCATGTTATTGTGGAA
TTAATGGTCCAATTTAATTTTATTATATGTGTTTCTATTATTTCCAGAGCTGTATATGTA
CTTTCGAATTTCCATATACTTCATAGTAGAAACTTTAAAAGGAATTAATTACACCTCTAC
TGAAATCTAACTCTTAGCTTACAGAAAAACTTTTGATTTTACTTGAGGCAAGCATTTACA
TTATTTATTGACATAATAATCGTGTTTAAGCAGAACGGAACTAATTAAATTTTCACTGAA
AATGCGATGTTTTTTTAAGAACCTTACACCAATATTATATTAAGTGAAAACAATCAGAGT
CCAGTTTTCCCCAATGTGCTGCTGGGCAATCGCACCTGGGCTGACCCACCTGACCCAGTT
CAAGGCTGCAAAAAGTGGAAGGGCGATGAAAGGGGAGAAGGTCAAAAGGAAGGTGGGGGC
CAACGGAAGATGAGTGAACTGAGGTGCAGCGAATCAGCCCGGAGGCCAAACGACTCGGAA
AGGGGAATCCCGGTGGGGTACATTAGCTTTGAGGAAAACTTTGCAGAACTTTGGCCCTTT
GCGGTTCGGGGAAAACTGCAAAAGGGTTTGTCTTTAATCTGCGGATAGTTGGACAACTTT
CCGTCGAGAACTACAAATCAAACTATTTTCTACTTAAGGGGACACTTATTTTTGCTTGAG
GTCGGAATGGGGGCGCTTTATTGGTTTGGTTAGAGTGTGGAAAGAATTGCATTTCATTGT
GACCGAATTTTCTACTTCAGTTAGTGTTGTGATTCTTGAGAATTGTACTGGGCAGGCATC
CTGTGAAAGCCGCGCACCAATTCCCTTTCCCCTACCAATACAAACTGCAGCAAGTCTCAA
CAGACGGAATGCGGCAATTGCTTGCCTTTTTGGCTATATCCTTCATACACTTTGAGAAAT
ACTTTCGTCCTAATCGAATACATCATTTTTATGTTTAGATATAGATATCTTAGTTGTTGT
TTGTTGTTTATTATTGTTGGTTGTTTGTATAAAGGAAAAAGAATTCTAATTTTGCTCTTC
TAAAAATTGTAATTTTTCCGAGTGATCGACTTATTTCCCCAGTCCCACTGCAACCCAATT
TCTCTCAGCCAAGAGAGCTTGGCAAATATTTTCTTAATTAGTTGCTGCCAAGGCTTTTCC
GGCTCACGAAAAAAGTGCAGCAAAGCAAGAAATGTGAGAGAGTGTGAGGAAAATGGAGAA
AAGCGGTTGAGTTGGTCAGTTGTCAAGTGTGAAAAATTGCAGCTCAAATTGCAGTACAAA
ATGGCTTGAAGCGCTCGTTAAAAGTCACGCAGCACGCAGAGGAAAAGCTGGCCGGGGAAA
TGTTTCAAAATTTATGCGTATGAAAACAGAAATTATATTAATTACAACAGGCAACGGGGG
AATGTGGGGACAACATTAAATTGCAGCTGCGACGGAAACAAGGGTAACATCATCGCCAGG
GGGTTAAACAACACTTGACATTTGTCCTCCTTTTCCCCTCCGCACATAAAAATTGCATAA
AATTTGCATGTCAAAAGTGCGACTCGAGAGTTGTGCGAGCCACCCTAGGTCCACCCCATT
TGGCCATCATCAGCGTTGTTTAGCAAGCATTTGGGGAATTTACTCTTGCTGCGCTGGAAA
TTCGCAATCAACAGAACAATTATGCGCAAATGCAGAGGGGGAGCTCAACTTGTTTATATA
TAAAACTATGTATTTATTTACTTACAACAGCGAGAGATACTCCTCGCCATATGCTGTTTT
ATGGTCCATTCGAATTTAAAGATCAGCCGGCTAATTAGGGTGGCTGGCACACATGTTGCC
CAGCGGAGGCGGAGGGATCTGCACAACAGATTTCTCATTGTCTGGCCCACAATCGAATAA
GCGGAGCGTAGCACTGCGATTGTCAAAGCGTATTTAATGAGCAGACTCCCGGGTACGAAA
AGCCACCTAGGCAGTAGAGCCATGGCCCCAGTGATATATCTCCCCCTGCACCAACCAAGT
GGTGCTGTTGTTCCTGCGAAAATCACGAAATCAGTTGGCAAGAAATCACTGCAGACAGTG
GCGTTCGCTGAGAAGGGGTCCTGGGACGGAAGGGAGCCCCAAAACCGCGGCGACAACATC
GAAACAACGACAACGACGACATCATGCTGGCACTGTTTGCTGGGGGATTTCGTTTTTTTT
TGGGGTGAAATTGTTGTGGGAATGTGTGTTCTAGTGCACTTACAAAAATGTCTCGTCATA
GAATAAATTCAATTTAAATTAGTCCGCTCTTGATACGTAAACAGATGAAACTCTGCACAT
CTTGGATAACATTGCATGTTGCTTAAGTATAAGGTAGTAATTAGTATACAACTCTTGGTT
ATTATACGTATATTTTCCCATATTAATGTTCTAAATACATTATAATCTAATGAAATCATA
GTTAATTAATCCTTTAGAGAAGTATTTTTTTCAAGTGTTAATCCCCTGTAATGTCTACAA
GCAACCGGAGAAGAGCTTGTGGCAAATACCGCGATGCGTGTCTGTCTGTATGTCTGCGTT
TTCCTCTATTGCAATGTGGTAGGTGGGAGTTTTTCGTGAGGAAAACCGACATTGTCTAGG
CCGATGATGGGGCTTTTGTTGTTGCCAAGGTAGGATAATGACATCAATATGCATGACAGG
ACAATCCAGAGAGACGGAAAATGAGGCAGTATGGCATAAGTGAAGTGGATAGCTTTAAGG
GCTGATAAAGCACAGCTGGGAGATGCTTCATTACCAGTCCCGCTCGATAAGAAACGGAAC
TCGTTGCGCTGCTAAAGGACCTTTTTCTTGCCCGCCCACCTGACCGAACACATATCTAGG
GAATTTGACCAAAAAGTGGCACCAAAGTGGGAAGAACGGACCGCAGGACTTTTTCATTAG
TGCAAGTGCCGCACAGCTGCATGCACACACAACACACAACATTCACGCACACAGAGACAC
ACGTGGCCAACTACCGACACGTTCCCGGCATTGCGAAACGTGCCAAAAAGCATTGCATAA
GCGCAGGCGGACAACGAAATCAGTTGGGCAAAAAGGTGGGGGAAAACAAAAAACAAAAAA
TGAAACGTAAATACGGGCAAGGCGAGGACAATATTTTTGCTGCTCCTCCGATTGCTACTA
CTGCTGATTCCTCTTTTTCTTGTGCAAGAAAACAAATCTGAGCCACACATGCCCAGATAT
TCACACTGAGCGAAAAAGGATAGAAGATATATTCGTTCGCTATCTGTTAATTTGGCATAA
ATATATAAGTTTTATGATACCTATTATTAAAAGAAACAGTCGCAGTGTATGATATTTAAA
CAGTTCAAACCAATATTTAATCTTAAGTAATTAATATAATGGAAAATTGCAAACCACGTT
TGTAATCTATAAAATTCGCACATCAAAAATCATAATAACGCAAGTGCTTAAAATAAATCC
CTTTTTGGTTTGTAAATTATGCGCACTATTACTCAATAATATTTTTGATAATATAAAAAC
TTTATATCAATGAATATATCTACTGGTATGTCTTTCAAATTCCAGTTCAAATTCCCCCAG
AAATTCAACGGATGTACTTTATTCTAGCGCAGATAACCATTTGCATAAAATCTCTAACTT
TATGGCGGTATCTTTTCCGATCTAGCCATTTCCATGAATATTTAAGTTCAAGTTTGACCG
TGTACCACATCCATCCATCGCAAATCATATCCGTCTAAGGCACTTTTTCAAGTGCAGTCG
TTGGCAATGCGTTTAGCAATCAGCTCACGACTTGGCAGCCAGTCCGAGTTTGCAGAGACT
TTGCCTTGGAACGCAGAACTCAGAACTGAGAACTGTCGTTGCGCATACGCCACGTTGCAC
TGCAACCCGTCCGATGGGTCGTGTGTTAATAATGCGTGACATAAACTGGAGCTCCGACAA
GTCCCGTCGATGGGACAAACGAATTGAGTTGACTCGACTTGAGTGGGGCATTTTAAGTGA
CAGCCTGTGAGGACTCAGAAACAGGAGCGAGGAAGTCAGTTCTGCAGACTTTGTCTGCGA
CTCTGGCGAGCAAATGACATCTTCTTTGTTTTATTGACATGCCGCACACTCAGAAAATTC
TGAACACAGATGAGAATGAGAGGTTGCTCCTTAACACTTAAATTTTTACTTAAAATATGC
AAATAAGTGCTGCCAAAGTGCCAGTGGCAAATGCGCCTTTTACCCAAACTTCCAACCTAA
TGTGTGTGCGAATGTGTGAGAATTTCAATTTCCTGCTCACACCCAATGCCAATCAAAGGA
AAACCCCGATCGAGGGACGGGTGAATAAATTTGAGCGAACAGCGAGTGAGGAAATTAAAC
CAAATTGAAATTGTTTCGCGTTCGCACACAAAGTTTTCCTTGCCCCTTAAAGGTTTCTTA
TTTTTGGGCTCGACTTAAGCTCGGGGAAAGTTTTAATTTCCAATTGACATTTTGCAAGTG
CATCCCACTAATCCCGCAGAGCCGGCAAAACGGCGTAACGGCAAAAGGGGCTGAAAATAA
TTACAAACTGCAATTATTAGCCCGGCTAAGGAGACGCTGCCAAGGCAAATCCAATTAAGT
GAAAAGCAAGTGTAAGCCGATGCCTTTTACCTGACCAGCTCACCTGATTCCTTGCCAACC
CCCCTTCCTATTTCACCCCCTGTAGTTAACTGGGTAACTTTAGCTGATGACCTTAGCCTG
TTTTCTTTTTTTTTTTTTATTCCTACCCCGTTCTTTGGGTTTACCTCCCTCAAGTGTGTC
GCCTTTCTTTGGCTCTCCAGTTTCCCTCTTCTCGAGAGCATGAAATGAAATTGCCGAGCT
ACAGGCACAACAATGGCTATAGTAATAATAAATAATAATGGTTAAATGTGTTTACAAAAA
GACAGAAATCTTTGGCTGTTATCTAGACCAAAGTCGCCACCATTCTTGCTCTTCACTCTT
TACTCTTCACTCTTGGACTTGGACTTGGCTTACTTTTGTCTGCTCTGAACTGTCATTGCG
TGTTGCACACAAAAACACCCGGAGATTTAGAGCGTAGAAAGAGGTAAAAGGAATGCGGGG
AAAGCAGAGAAAGAGGCAAGAGGCAAAGGAAAGCGGGCTCTGCGAAACAGAATGAGATAT
TATGTGGCAAGAGTTGCTTCACCAGTTGGCAGTTCTACTTAATTTTTGATGCGAAAATGC
CACTTGAGTCTGCTCGAAGTACTTTAGGAAAATAAACAAGTATTTTAGTTTTAGAATTTC
GGGTACGTCTGTCTTAAAATTAAGTCGGGTTTCTGTTGGAAGTACCGCAGACATATGTAG
TCAGTTAACTGTATGAGTATATATTTCTGTTCTTATTATTTATAATATAATCCTTTTAAA
TATTTTACTTGCATTATATACGAAAATATTAAAAAATTAGAAATTGTAAACTATTTCATA
AAAATGTTTTGGTAAAAAAATGTAAAATCTTTAGCTTTGTAATAACCCATAAGATTTTGA
GGCTAGTATAAATTTGGTTCAAGCCCGTCCAATTATATAATTGAATTCCTTGGGAATCCT
ATCAATAGTTTCATTAAGACTTGAGAAAACATTCTAAAGCCACCCTCGTAATCTTCTGTC
CCATAATGAAAGTGAAAAACTGTTGCAGCAACAGCAAACAATTTCGCAGCCGAGGAGAAA
ACTATTTCAATTGAGGTAGAAAATGAACGACAAGGACATGGCGGCATTTCCCTCTGGTTT
TTTTTTTTACTTATTTTCATTTTCTTTTTGCCATTCTATGTTTTTCTTGGTCTTGCCATG
AATGGATGCCCACCTCCCTGCATTTCTTTTTGTGTGTTTGCAGTTTAAATTGCGCTATGA
AAGGAATTTTTTGGATTTAAGCATTCGTTTTCATTTGGCTTCTATTTCTTAGTTTCTATA
TCTTTTTTTTTTATTTGCTTTTGCCTGGGATGCCAAGTGGGATAATATGTCAAGTGGCAT
AAGTCGGCGGGGAGGCAGAGAGCTGGTGCACCATTGATAGGATCGAAGCAGGTGTCATCC
CGTTTGGCAACCAGGTCTTAACTTGGTCATTTACGGACGACTAGCTGTGTTTGTGCTGGC
CCGGCTTAGCCCCAGTTTCAGTTTGAATCAAGTTGCAGTGGCAAAAACAGCTGTGGCAAG
TGGCCCGATTGAGAAACAGTTGTCCCCCCCCATATAGACCGACTTTTGGGACATATAAAA
GGGGAGCTTGGTTGGCAAACGAGCAGTAAAAGACTGTATCAGCAGCATGTCTACGGAATT
GGTAGTGGCCCTTATGCTCTTTGGATTCCTGCAGGTTGCATTCAGCCAGGACAATGCGAC
TGCTCCCCCAACGGACTATTGTCAGAGTGGATTGTGCCCCTCTCTAAAAAAACACATTGC
CTGCAAGAACAAAGGAGTAAGGCTAACTTTTGCAGGACTTAATTGTTTCCCTACAATGGT
AATATTATTTGCTCTAGGAGTTGGGCAAACAGTGTTCTCCCGACGCCCATTTGGTCAATC
TCACTGGCCTGCAGGACCTGATCCTGGGTGAACACAATGCATTGCGAAATGTCCTTGCTT
CGGGAAAAATCATCAATTTACCTAAGCCCGATCGCATGGCCACACTGCAGTGGCATTCAG
AACTGGCCGATCTGGCCACACTGAATGTGAAGCAGTGTGTTCTGCAGCACGATTCTTGTC
ACAACACTCCAGATTTCCATAACTCTGGTCAGAACTTGGCTTTGGTCAACATAACCCTGC
TACCTGAAGACGGAAATCACACCGACGAGTGCCTTGTTAAGGAGTCTATTGGAGGCTGGT
GGAATCAGAGTATCAATATCACAAAAGAGCAATTGCAGCGTTTTCCCAAAGGAAAATTGG
GAGAGTGGGTTTCTTTTGTTTAGGTTCATATTTTCTTTTAATATTATTTATTTTCCAACC
AGTTCCATTCGCAATTTTGCCGTCATGGCCCGTGACAACAACACCCATGTGGGATGTGCC
GCCTTGAGATTCGAGAAGCCCGCAGGACATCCGCTATTCCTTTTGGCCTGCAACTATGCC
AGCAATTATGTTCCCGACTGGCCCATCTACAAGGAGAAAGCCATTGGCTGTCAGTCCGGT
TCCGACCTCAAATATCCATCGCTTTGCAAGGCTGGTGAGGAATACCAGGATCTTATCGGG
CAGCAGGGCTCCAAGGGGAAGAGATTTTGGACGCTGTAGGAGTGCCAAAAATAACTCCTA
GCTAACGGATTGGAGTGGGTGGCAGGCGCACTTACAGTCTATTTAACATGTTGATTTGTG
TCGCAGTGCCTGGCGGTCATATATCATCTCACAGCCGCATTAGCATTAGCACAGACACCT
GGAGAGACAGTGATGCTGAATTCTAGCTATATATATAAAGAATACGTGAAAAATGATAAT
ATTAAACATGAGAATTCAATGAGAATATAGACAATATGAATATAAATTTATAAAAGACAA
TATGAAAAAGGTGTATCTTTATTTTAGTATAAATTAGATATAGATTTATTTAGGAAATGT
TTTTTCTTGATATCCAATCCAATGCTGAAGAGAATAATGATGCATTCATTTTCAAAATAC
CCTGTAAAATGGCTATAAACTGGCTGAAACTACAGCTCTCACACTCACACACATTCTGCC
CCACTTGGCCGCCCCCAGAATCATCATCATTCTCTTCAGTCGCTAAAATATGTTACGCGT
TGTTTGGGCTCGAGAAAATAGCGAGCGAGACGACGACAAGTTGGCATCTAATTTTAACGT
CAATATACAAAATGTAAAAACGTGTCTTCATCAGCTCGTAATATAGAGACCACCATTTCC
ACCACTCTCCGCTGGTGCCGTTGAAATCCCTAAGTGCCTATTAATAATGCTGCCTCGACG
GGCTAAAAAGAAAATGCTTTTCCTTGGATCTGCTTTATTTTTAGTGTCCGTTCGCGATGA
GGCCTACGTTTAATATGCCGTTACTTTGTCAAATCCGAGGCTCATTAAAGTCAGGCGAGA
AAAATAGGCAACATTTTTGTTCATTTTTTTCCGCTGTGATAATTAATTTCGTACTAATGC
AGGCCACATTCATTATGGCTTAATTAAAATTCAACTGGAATTAGTTTGCAGCACCTCGAA
AAGCGACCATTATAAACTTATCATGCCGAAAATATTCATAAATGCTTATATCTCTATTTT
TTGTGCTAATTACATTTTGGTGTGTTTTCAGTTGTTCATTTTGCCTGAATATTAAAATCA
CAACAGAGCCTTTTTTGTTGCTGTTTTGGACCCTCATTAAATGCGTGTAAAACTAACATG
GCCCACAACATATTTCACGCGGCCCATAAAAGCATAAATATCTGCATAAATAAAATAATT
TACAAAGTTATGTCAGTGGTTGGAGTGATATAAATTATTCTCTTACTGGGACAACAATGT
TGGGGTTTACTGGCTTTTGATGGATGTGGGAGAAGTTCTTCCTCGTATAGGGTGCGCTTA
ATGTACGATGATGCATATCAACTCATGGAACCAATTTAAGATTTATTCATACCGCTTAAA
AAATATGAGCAAAATCAGTTTTCAATTTGTTTCGATTTTGTGCCTGAAAAAATAAATATA
TGTACATGTCCGAATAAACATAAAACTATTAGTATAGTGTCATATGATTTAATATAGTCG
TAAAAGATTTCTCAGCTCTTAAAGATTTCCACTTGATATTTATATTCCGTGATGCCGAAA
TCAAAACACACTCGCCTTTGGTGCCTAGAGAAAAATTCAATAGACCATTCGTCCCTGAAC
GCTTCACAAACTTGATTGTTGAAAATGATTTGATGGGCCGAGCTGAATAAAAGCGCCAAT
TTATGGCCTAAAAGAGGACTGTGCGTTGCATAAATTGTGGCTGAATTTAAACAAGTTAAT
GTGATATTAGTTGGAAGCGGGCATAAATTATGGAAGCGTGTTCCATTGAGGAAGAGGGAG
AACAGTATAAACAAAGCTCGCCTGATTTACTACTGGCCATTTGACTGTTTAATGAGCACT
CAAATGTGTCAACAGGCTATATGGAAATTTATTTAATTATGATTCATAAGTCACAAAGTA
GCTTAGAGCCGGCGAAACATGCCAAATCCTATGCTTCCCGCACTCTCCAGTGTTTGAAGT
TGTGCGCCTCGGCTTGCAAAAGTCTGGAGCTCGGACATGGCAGCATCTAAAAAGGCAATC
AAAAGTTTGGCCAAAAAGAAATGGTAACAAGAGCGCAAAATGTGTATAAAATCAAAATTG
GCAAAGCAAAACTTTTGATTTATGCAATTTGCGCTAAAAATACAAATCCATTTGATCACA
CTGGAGTGAGGCAAATAAAATTTTGGCCAACAATTCCAATAAAATGGCAAAGCAGGCTTT
GATTTATTTGTCCTTGACCGGGGGACGTGGGAATTCCCCGAACACAGCCGCAAATGCTTA
GCCTCGTCTCTCTCAGGACCCAAATGTCATACATGGAGCATAATAAATGGGCTAGTAAAA
CTTTGGACAGGAATGGGAATGGGAGCATGGGTTTCTTGTGCCCTGTGTCAAGTCAAATGC
AAATGACCGACAAATTTGCCCGGCTATATAGCGATATGCAAACAGAACGGATATATGCTT
TGTTTATGTACATTTATATGTATATGTGTGACCGCAGGCCAAACTGGCCACAAATTTCCA
CACAATTTATGCACAAAATGTGGAGCGGAAGAGGAGACACGGCGGATCCCATTGCCGGAT
CATTTATTTTATAGTCCGTCGCTTTAAGTTATTTTTCTTCATTATTTTTTATGTGGCTCC
GAGGCGGGCGAGGACAAACGAAAACAATTGCCAAAGGCATTTGGCAATCAGCGCCAAATG
TTTGCTCTGTTTGCGCAAATAATTTATACGAGGAGCAAAAACACAACAGCCGCCAGACGT
CGGACATCAGACGGCCATCACACATACGCCGCGTTGGCCGGCTCAACTTCATAGACAGGA
TCTTAACGGCACAGTTCATTAGCGGTCCCTTTTGGCCAGGAACTTGGTTATTAATCCTCA
AAGGAGCGAGAGACAAAGGACGGCTGTTGTCATTAGGGGTCGTCCTGCGATTTCCGTCTC
TTTTTTGGACATAAACACCAAATTAAGTTTTAGTGTTTCATTTATTTTTGGCACTCTCTT
TACATGCGTGTGGGCTATAGGGATATACATGTATGTATATGTATGTAGTGTGGTATTTCG
GGCCTATTTGTTTTTATGGCCCCAATTTTTGGCCTGCTCCTATTGCCTTTTGATTGTTTG
TAATGAGCTCCTCGTGCTGCTTATGTGCGGGTCATCAAGGATATGAATAAAACAGCGATC
GAAACAACCCGATAAAGGCTGGTCAAATGTCAAGTGTGTTCTGCTAAAGCCATTTATAGG
ATCCACTCATTAGGAAGGACTTATAGTGATAGGATTACAGACGGATTTCCTCTTCATATT
GTTTTTATTATTCAATTTTAGTATAACAATTATCAATTAAACAACTTTATGGCTTAACCA
AAATCCTTTTGTATTTCTCATTGCTGCTTGATTTATAAAAATTCCGTTTTTTTTATTTGA
TTTTTTCATTCCCGTATTTCGATTAATTCCTGCTTTAATTGATTCGTTTGAAATGTGATT
CCAGCTGATTTAATTTATTTGCCAATTTCATTCGTTATTTATTCAGCTCATTTGAGCATA
CAATTTGGTTCGCTTGTACAGTCATTTTAGCGACAGGTGAATTAATATTATTTTCTAGAT
TTTAACCAATTTTTATCCCACTTCTAAACCGCTGATCAAACATGTTCAAAGGTCACTCTT
AATTTTGTTGCACTTTCAGCGGCCAATTGTGCAGCAAACATAATTCAATTAACGCCTGGC
CATTGGATGCCACCACACAGGCACCCACACACAAATAGATAGAGAGGGATATAGGCAAAA
GGAAAGAGAGGCCGACAGAATGGCCGGAAAGTGGCGCTTTACAATTTGCGCAATTTCCGC
TTCTGAACAACATCAAACAGAAAATCTCCACTCCATTCCCGAAAAACAGAGAAAATATAA
AAACTTTGCTCTCGTTTGATGTGTGAATTGCGCAAATATTTTTGTTAAAAAAATATACGC
TCCTCCTACTCCGATACTGAGCATTTATCATGTTTTCGTATACGTTTGGGAGATTTTTCA
CCAGAAACTTGTTAAATGGAAAACAAACAAAGAATGTTTGCACATAATGCGATTAGCGGC
CTCGGCTTCGGTCGCCATCGAAATTTATTAGCCGCTTATGCTATGCGATTGAAGTTTAAT
TGAAAGCGTAACAATATTTACCAGAACAATATTAATTGACAGTTGATGTTGCGTGTCAGT
CAGATATTTGATTTTCCGTTTCGACTCCTGCCCATTCAATACAAATGTCCTCCTGGATCC
GCTTTCCTCCATTTTAATGCTTCGCCAACAGCGGAATCTAATTAGCATTTCAGACCCCTC
CGGCCGGATGGCATGGCTGAATAACAATAATTGCTTAAATAAACACCACGACAAATGCAC
ATTAATAAACATCAGTTGCCTGAAATATGAATTATGGCAAGCCCATCTCGAGTCTCGGCC
AACATGCAATCAAGAGCACGAAGCTTGAGGAGAGCTCTTTGCGGGTTAAAGTCGACCCAT
CGGCAAAGTGCAACGCCATTTGCATGTCGGGCTGGTCATTCACGTCGCCATCAACCGGTT
GGTGGATACAGTGCCACTCGAAAATAAGGAACGCATGGTACTTGGAAAAGCGTACTCTCT
TTAGTCCAGTCACCCGAAAAGGTCCATGAAATAATCAGAAACCTAGTTGACTATTAAAAA
CTACACTATATATTTAGCTATGCAATTATCAATAGTTATTCAAACAAAAGGGCTTATATG
GACTATTACTAGTAAGAGTTACAATTAAATAGGATTCTCAACACGTTCCATTGAATCAAG
ATTATGGAAACATGTTATGACTAGGAAAACAGGACCCCCTCTCAAACAATTTCTCTAAAT
AATAATATGTGCTCCTTTAAAGGGTTTCATTTTAATTGTGTATATATGATGGGCTCGTAA
TTATTATGCAGCTCCGAATTAAAAATTAAGAAGCTTATATTTATGGTCCGCACTGTAAGC
AATATGTGTACATGCTAAACAGACAGTGCGTGACGTTTCCTCGTTCTTTGACTTCTTCGG
TGGACTTTAACATGGCAATTATGCATTTTTAATCAAACTACCATAATACTTCCCGGAAAA
GCTTTTCTATTGATTTTCTCTATTAACCAATTGACATACATCCACTAAGGGGAGGCCTTT
GAACCTCGGTTGGAAGACCCTATATATTCCAATAAGCCAAATCAAACATGCTGAACGGAA
AATGAAATTCTAAAGAATCATTCCGATTCAGTTTCTGGCTACATTTGCATACAAATGCAG
CCGGGATTAAAATCAAAATTCGATATGCCACAGGCCACACACATACACGAGCAACCTCTC
CGACAATTTACCGAACAATATTTTACTGCTCAAGACATTCCGACATTGTTGTACGGAAAA
TGGAGAACCCTTTCCCCCTGTGAGGAGAAAAACTTACCCAAGTTCTTCAATTACAATTTG
ATTTGCAAATGACACAGAGAGAGAAACATGCCAAGAAATTGAAGTGGAAAACTTGGCAAA
GTCAAGAGGGAAAATGAGGAAAATGCGACAAGTCGGTTTGGGAAACTTCAACACGAGCCG
GGGCAAGTGGAATTAAATGTTTGTTAAAGGTTTGCACTGATTAAAAATGATGGAAGGCAC
TCCCTAAAACTTTTTATGAACATAAAGTTCGGATATACAATCCTAGATAGAACCCTCCTA
AAATTTCCATCATCAACAACGCTTCGGGCAATTGAATCCTTTAAGCCGGCCACTTTTTCA
TGGCTCCCGGCAATAAAATGTTGCAACATTAAAAGGGCGGTGCACATAAATAAAAAAAAA
AATCGTTGAGTAAAAAATTGGGTTAAAAATTAACTACACCAAATTTAAATCAACTTCAGA
TGGGGGGACTGAAATTTTTCGGGGGATCTGGCTGTTGCCTGTCAGCGAATCCTTCGAATC
CTTGGGCGGCCGTAAAAAATCGACTCGTTGGGCAGGCTGAATACGGCCGGAGTCCTGGCA
GCCGTAAATAAAGCGCCGCAAACATTAATAACTCCCATTGGGTGTGTTAACAAGCAATGA
CCAAAGAGGGCCGTACCCGGCAGGACTGGGATTTCGGATTCGTTTTCCTCTGTTTTTCCT
CCCATTTCCCTGGCATTTTCCACCCTTTTCCCTTCTGCCAATGTGCATAAATTGCAGTAA
AAATGGCGCAAAATTTTACATTTTGTGGCTGTTGTGAAAAACGATGTGCAACAAAAAGTC
CAGTTCAGAGCGGAGCGAAAATAAGTAACAAGTAACCGAGAAGCTCGCAGGCATGTAAAA
ATTGCGCATACGCCAGGTGCGCCGCGCCACATAAAATGGTTGAGTGATGGAAGCCGATGG
GTGTGAGTCCGGGAAGTTCCACGACGGTGGGTAATGCATGTAAGACAATCATTTTGACAG
CACTCTCCGTCGTGTTTTTAGCCCCGGAATTGGCCTCCGGCTGTGTGTTACCCATTGGGC
CGTCGCTCGCCTGGCTGCCTCCTGATTACTATGCACTTTGATACTTATCTTTAATTGAGG
TAACATTCAGCATGGCGCAAGGATACGAAGGATGTTGGCAGACCAACAAAAGCCTCGTCT
GCCACGCTACGCTGAGCACACTTTTCATATTCGCAGTGTTTTCCTTTCGGTCTGGCTGGA
TCTGCTTTTGGTTGGCAGTTGGGTACAGAAATGGGTATTACGAGGGCACAAACAGTGTTG
CCACTTGGGCTTTTACTTCGGGCTCATCTTTTAACAGGTATATAAATATGAATGAAATAA
GTGTAAAATAGGAAAATTACGTTTTCTAACAATTAATGCAGTACTGCAGTGCTACAATTG
GCCATTTATTGTTACAATGTGAGATTAATGTGTTACTTAATATTATTTGACCGAATTTGA
CATTTTTAAATAAATTGGTAATTACAGCTGTATTTAGAGAGAGAGAGAGACGGTAAACAA
TGGTTAATGCACTTAACCAAACCCTCATGAAATTGGGTCTAATGTGATTTAACACCCATC
GGCCCAATTATGCGTTGACCCCTGTCATATTTGACCTGGCGCCGCAGAAGTAGTTTCAAT
TAATCGTTAACCCTTACGGCAGCTCCACAGTTCGACGTTTGCCGATGCGGTTGGCCAGTG
CTTGCTTTATAAATATTTAAGACCATTAAACAGACAGCATACACACACACACATGCATAC
GTAATGCTGGCCGTGGTCGAACATGGCCAGGACTAAGCGTTTTATGGCCCTTCCACAGCC
GATTGCCATTGTTTCCACAGGGCAGAGCCGTAGTTTTGTGGCCATGCCTGGGGTCGAAGT
GGAAACTGAAACTCCCTTCGCAAGCCCCACATCCTTTCGTAACCATAATCGTCATCGTTA
TCGTTTGTATTTGGTTCTGGTTCGGGGTCCAATTGTTTTGCCATCAGGTGAGCTGCAATG
TCTGCGGCGGATGCCAAGGCTAATTTTGCGTAAAATGAGCGCTGAGCAGCCGCCCGAATG
ATTCATTATGGTTCCCCAAGGAGTCGTTGCATGCGCATATATGCAAATGAACGGATACAG
AGGAGCCAGTGGGGGTGTTTGGGTTAAAGGACCTTCCGGTACCTTGGGGCCACTGCACCC
GCACGGCGAATCAATCATAGATTGTCAACGGCCACGATTCGCCTTAGTCGGTGGCGTATA
CGTGATGTTGCCCACTCCCAGCGGGCCCACTAATTGATTTATTGCCCCGAAATTAATTCT
ATCCCAGCACATTAATATTTATTGCACAATCTGGGATGGCGATTACGAAGTCGTACAATC
CGGCACCTTGACCTTCTGCTCAGATTTTTGTCATGAATCCGCTTTTTGAATAATTTTCAT
TTTCGGATTTGCCCGCAGCTTTTTGTTCGCCCTCAAATTGCTGCCATGAATAAATGAGTT
GCTCAAGCGGGCCGAGTACAAAAGCCTGGCTAACGAGTCCGTACAAACAATCTGTGGACA
TTGGGGAGGCATGATGGTGTACCCCATGGTCCCATGGTCGACCCACCCACCTGGTATTTG
CTGTTTTATATAAAAGCAATACGCATATGCCCGACATGCCAATGCAGCACTGCTATTTGC
ATTCACTTTTCTGCAGTGTTTGCCCCGAAGGGGCTTTCCCCATCCCACCGCCAGCCATTT
GTGCCCCTGCAAGCCCGGCGAAAAACCCTGTGGAAAGCTCTGTGGAAAACCCTGAAAAGC
GCTTGTAGGACTTCTGGCTGGTGGCTCTTTAAGTTCTGCGGTTCGTTGCTGGCTTCGGAA
AACTGAAGTTCTGGCTAAATGACACTTGGAGGGGAGTTGCATGGCAAACAAACCGAATTT
CATCGAATTGCTACTCGAAACGCATGAAAGGAAACACAACTATGCATTATTTGTATAGCA
CTTAAATCAATGTAAATTAATATTAATGTTAAAAACATAAAATGATAAATCAAAGCTGAT
AAATTAAAGCTTTCGTGAAACGCTGTCATATTTTCGATCACTTCTGACTTAAACTACCAA
ATCGAATTAACTACCAATTAATTTCGCCCAGTGCAGCATCTCGAAATGAGCATTGACTGA
TGCCATTACAGATGGCCATTGAATGGATTTTCCGACCAAAGGCATTTCCTTTACAGGCAG
CCTCGAATTTTCCTTTCTCGGCTTCGGTTTGCGGTAGAATTCCATTTCGGTTGCTGGCAG
CTGGAATGCAGCAAGTACTCCATTCGATTCCAGAGAAATGGAATTTGTGCATATCCACCG
TCATTGTAAATATAATTTAAGCAATCTTTCATAATTTTACGTGACTTTTTTTATTGCTGG
TTCGGTTTTATTGTGCCTACTTTAAAAATGCCCAACTATGTATGTGTATGTACCTCTACC
CGCACTTAATTTGGTAAATGCCAAAGTTTATGAGCTGCGCCATTTGGGAGTCCGCTTAGA
TTGTTGTTTGTTTGTTTTGTTAGATTCTAGATTCCTTTTAGGCGGAAATGAAATTTTTGC
AGTTTTACAATTTTGCCGTAAAAGGGTTATATGCTTTCCGTTTTTTAGGGGACTGGGCTG
GTTTTGAGTGGGCTATAAAAGCTTTTTGCTTTGCCGTTTTACAAATACCGACTGCGAAGT
CATAGAAAGTCGTCGTCGCGTCGAGTAATTAGAAAATTAACCCCTGCCAGCAGGCCATAA
ATGAAAATGAAACAACAACTGTGTTTTCGCAATGCGAGCAACTAACTAAACATCAACAAC
TGGCACTCCACATGGTCGCCACTTGGAAAATCAGCCAGGCGAAGGCCACTTAGTGACTCT
TTTTTTTTTAAGTGGGGAAAAGCGTGAAATGAAAAAAACAAAAAAAAAAACAAAACCGTA
AGGGGGTTATGTCATCGTTCAAATTAAAGAACGCGACTTTAAGGTGCAGCTAACAGGAAG
TTTTGTATTATTTTCCCTTTTTTTCCAGTGAATTATTTGTTTTGTGCCCCTGCTTCCATT
TTCGCACTTGAAGTTATATCTGCGGCATACATCATTCTCATACCTTATACCGCATTTTTC
AGGGCTGGCCGTGTGCTACCAGCGGCAATCTGTAAGCAACAACAATCACAATAACGCCGA
GGCGAAGCCCACCCATGCGCCACCCTCGCATTATCCTCATGGCCACAAGTGGAACGAGCC
GTACTTTGATCTCACGATGCCCAGGAACATCACTTCGCTGGTGGGCAAATCCGCATATCT
GGGCTGTCGTGTCAAGCATCTTGGCAATAAGACGGTGAGTCCGGGGATAACGCACTAAGT
CTACACTTGAAAAAAATTAAGAACATAACTAAGATATAAGATACAACTGCTTAAGAATAA
TCAAACATGGGTTGTATGAATGTTCAATACAAAAATAGTTAGATAAAGCCCCATTATTAT
ATGTATCTGGTATGTTTATTGTTTATGGTATATCTTAAGAAAGCATATATTTTTCCACAG
TGCAGGCAAGTCAACAGGGAGACAACAGTCGGAAACATTTCGCATTAATAATCTTGATTT
TTATTTACATTTAATAAACAAAGAGCTCCGGAATGAGGGCGGTCGCAAGTGTGGCGAATG
TGTCACCAAATATCCACTTAGATGGCCCAAACAGACAGAGCGGGGTTATTAAATTTGCTG
CCAGTTTATTATGTAATACGTGACAGCAGCCGACACCCAAATATACACACACATGCTGAC
CGCTTGGCCCTAGTTTTTTCATGTTCTTTTATTTTTCTAGGATGGCGTCACTTGATCCAC
CCAACCCAATTAAAGTCTTCGCTAACCAGTTGTTAGCCCCTTAGTTTTTGCGGAAACAAA
AAGTGTTGCCTTTCAGCAATCAAAATTAAATTGGTTGCCACAACAAGAGCTGGCTATATA
ATAAAGTTTTTTTTTTCGCCGCAGACACAATGCGGAAATATTTTGCACGCATTGGACAAA
ATTTAGCGCTTGCTTTTAGTGGGAAAGCTTGCAGGTGTTGGCAGGCCCGAAAACGTTGAT
TACGTTAAGCGATTTGGCCACGGTCATGGGGCTCATAGATTTCCTTTAGGCCAAATCCGC
TTCCGCAATCAGTAAACTACACACACTCGCACACATCCTCCAGTTAACCGGCCGTGCTCG
GTTTTTGGCCAACAGTAAATTTATGGCCAGCCCAGGCTAAAGTTTACTTTCCAAACTTTT
TTCGGCTTTTTTCCTGCTGCTACTGCAGAATTAGACAGGCGGGCAGCCGGCAGGAAAGTG
GAACTGCACAGATGGATGCCATACAGTTGGCTGACTCTGTCTGTCTTTTGGACTGTGTGT
GTTATTGGTTAGACAGTTAGCCGCATAAACAAGGAGCTTCCATGGCAAAAAAAAAAGAAA
ACAGGCAAAAAGAAAAAAAGTAACAGGCCAAAAGGACGGACAAAAATTTGTATCAAATGT
AGTGGGCAATGTCGAGTGAATGTCGCTGTATGGGGAGTATCATTTTCCGGGTCTGTCATG
CGTTCCGCACACTAATTTCAAGTTGTATGAAAATTTAGTCTGTGAGCTGCATAAATTTTG
CGGTTTCTGCGGCGCCCAATGGCCCCAAACGAACTACAATCAGGGGCTCTTTAAAGTCCT
TGGAAAAGCGTATTAACGGAGCTTCTTTCCGCAGGTTGCCTGGATACGACATCGTGACCT
GCACATCCTCACCGTGGGCACCTACACCTACACGACGGATCAGCGTTTCCAGACCTCCTA
CCATCGGGACATCGACGAGTGGACCCTGCAGATCAAGTGGGCCCAGCAGAGGGACGCCGG
AGTCTACGAGTGCCAAATATCCACGCAGCCTGTGCGCAGCTATTCCGTCAACCTGAACAT
CGTGGGTGAGTAGATACTCTGCTCCAGAGGAGTACATATGTTTAGATTACCTAGAAGGCG
ATTAGCGCTTATGATTAAAAGATATTACATGTGCTCCTGTGAAAGAAAAGTAAGATAAGT
TGAAAAAGTAGTTCATAGGCTTATGTTAAATTTTATCCAATTTTTTTTACCAGGAGTGTA
CAAAGAATCTTATAGAATTTTCGTAAATTCACCCATTTTCCAGTTCAGCTTGTCAAGTGT
AATGTATAAATACAAGCAGATACAAAATAATTCAGGATCTCTGTTTTGGGAATTTCGGAT
ATTTCTCTGTATTGCTTTTGCATATTCATGCAATTTTCAAGGGTGTAAATTATGCACACT
TGGCAATCGTCACAGCAGGATATAAAAACGGGGCACGACTCTGCCGGTAAATATGACAGA
GGAATTTTTCGCAAAATTCTTTTGGGCAGATTGATGGACTGACAGGAAATGGCAGGAGCC
GCAGCACATACACACATAAATGGATATCGACAGGATACCTATTTATATGGGATTTAAGGT
GTAGATAACAGGGAAAACCAACTGCGCAACGAAAACAGACGTGTATTTAAAAAAAAAACA
TATATCCTCTTTAAGCCTGTGGGCCACAGTACGTTCGTATATTTTGGTTGAATTATTTTT
ATAGTTTTTCTAAACGAAGCCCATAGCTGAATAACAAATTCGTGATTGAAACAGCAATTT
GATGGAACGAAACTTTAATTTTTTTTCTTTAAATAAAAGCCCACAAATTAGGTTTGAATT
ATTCAGCAGGTGGACTTTGCCCCCGCAATTATTATGGATGGTTTATTTCTATTTTTGATT
CTATGCCCGTGCTGGGTACTTTGGTTGATTAGTTTAGCCACGGGCATATTATAATTATTT
CAACGTTTTTCTATTTCTATTTTGATTTCATATGTTATTTTTCCATTTTTCTTTGTTTAT
ATTTTTTGGTTACCCATCCACCACCAACCACCATCCACCGACGTTCCGATGAGCAGACCT
GATAGACGCCGAGACCAGCGATATAATGCAGCAGTATTATAACGATGACGCCTTCTATAT
AGCCGAGAATCGGGTGTACCAGTCCAGTAACGATGAGTTCGCCGGCATGTTTGGACCCAT
CCAGACAGTTGCGGGTTAGTCCTGGTGAACCCTCGTGATCCAGCCATCCACTGTTCTCGT
AGCACACTTATTTTTTTGGCCGAGTGACAAAGTCCAACCGCAGATAGGGGAAAAATTAGG
TGCCAGACGGAGATGAGAGCTCTGCTCGAGGGCTGCCATGCATGCATATTATTTTTTAAT
ATTTTACAACATTTTTTCGTGGCAGCTGAGGGGCAGGATGAGGAGCTGCTAGATGGTCGG
CAGGATGCGGGGTGTTTGTGGAGTCAAGTGCGCTGGGCGCCCGGAGCAAGCACTTTTCTG
GCTCATGACGAACAAATTGCTTTCCAACAAGCTTTTACCCACTAACTTTGCCAGCTTGTT
ACGGTTACTGTTACTCCTCCACCTATTATTTTCTACCTTTTCGCAATTTCCCGGTCTCCT
TACTGTAGTGTTGCCGCAATTTGAGAGCCAGATGATTGCCACATTCGCAAATAAAGCAAC
TTGAATTGCTATGAAAAGTAGAATTAAAATTGTTTAAAAACAGTGATGTATATAATAACA
AACGTACTCCTAATTAAAAATTCTAATAAGAAAGAAAACTAACAACATGTTTCTTCATTA
TTGATGATTATAAAAGTAGTTATTTTAATCGCTTATTCATATAGTATTAACAAATGTTTT
ATTATGTGTACTTTTTAATTTTTTTGAAGTATTTTTGTTGCACGATTAAATACTACTGTA
ATTTTGTCTTTTTTGGCTAGATGCTCATCGCTTCCTATAAAGAAAGCCAAAAGTTCAGCA
CTGCCTTTACTCCATTTATGGCCAAGTGGTTCGCACATTTAATTATACCCAAAGCCTTTG
CAATATTTATTTTGTCGGAGATTCAGGTTCTTAGTCATTCAGGGTCAGTGTTTTGCAAAG
GTTGGGATATTCATCACTTTGTCCATTGGGACATAGGGTGGCATTGAAAATGCCTTCTTC
GTATAGGTTTCCCTCGACAGGTGGTCCTGAGCTATAATAGCAAACGAGCACAAAGTGTAT
ATTCCACAGATCGTAATCCTGGCCAGCAGCACAGCCCATATAGGAACTGCGATCGTTGAT
GATATTCCTGATTTCACCTTCCGCACTATATGTGGCTATATCATCCAGATCGTAGAGCTC
GTCCAGCCATTGTTCAGCCAAGATGGTCATTTCCCGAACATTCGATTGTCGAATCACTGG
TCTTGGATAGAAATCCTCGGCGTAGTTGAAATGCGGTTCTGAGAAATCATCGGTGGCCAC
GCAGGAGTCATCGGGCAGATCCATTTGGCAGCGTTTCAGGTGATATTCGGCAACCACCGA
CAGGTAATTGTCCCACACCAATTCGGGCATTTTCTGCGCAGGTGGCAAGTCGACAAACAA
GTTGCTGGCCACCTCTTGGCGATATCCGTTGTGGAGACCCAGCAAATACTCACGGAAATA
GGCCATGTTCACCAGGCCATGAAAACGCAGGCAGCTCTCATCGAACATCTAAAAGGAGCT
GTTTGAACAGTTCTTATAGGATGTGGACCTTACTCACCATATTGTTGTCACAGCCAATGT
GCCGCTTGCCATGACACGACTTAATATCACAAAAGTCTATGGCCAAAATTGATCTGAGAA
ACAGAATTTTACACAGAAAAAGTGTCAACTGCAATCGTTGCATTTCTGTTTAGAACTAAA
AACTGTATGAGAAATATGAAGGTGTTATAAGAGCTATAAACAAAAAACCTCAATTGCCAA
ATGGCAAACAAAACGAACTAATTAAACAAATTGTTAAGCACAACCAAGGTACAACTAAAG
AATTTATTTTATTGGCATTTAAATAAGTGTAGCAAAACGTTTTTTCCGTGTTGGTAAATA
GCTTGAAAAAAATAATAGTGCTGGATTAAATATCCTTTTAATTTATATGATTATATTCCT
GTTCTACCATATTACATTTTGTCAGAAATTTAATAGTTTACCAAAGCCTCGATTCTCATG
CCACAAACAGAGAGATTCTCAAACCCAATGAAAATTGTAAGTTCCACGATAGATCCCAAG
TAGCATAAAATTGAGTTGTAACCCAACTTGAAATCACTTTCAACTTTGTGCAGCCTTGTC
CTTTTCAAAGTTTGCCTTTCTGTCCGCCTGACGGGCGGTAATCGATTATTTAACGTGCTG
ACTTTGACTGGCACGCCAGTTTTCCGCTCCCAGCACTCTGCTCCGGACTATGGAAATTGG
CACAAAAGCCGAGCTGGACCGGATTGGCCTGGCCAGAAGTTGGGGACGTGGGAACATGGG
TACGTGGGGCACATGTCACTGGTCGCCGGCGATGTGCTGGAAATTGGGAAAACAAACCAT
TTCGCAATTTCACAACTCGTCAGAGATGGGGGAGATGTGAACGGCGCTGATTAGGCGACG
TAACACAGTGATTAGCAGAGCTCGGGAATTTCCGGATTTATAAAGGGAATAGCAGAGGGA
TTGCATAATGGATGGTGCATAGCCAGTAAATATCTCATCCCCTCACACATTTTCCATTTG
CAGTGCCCACGGCCACCATTCTGGGAGGACCCGATCTGTATGTGGACAAGGGCAGCACCA
TAAATCTCACTTGCATCATCAAGTTCAGCCCGGAGCCACCGACCCATATCTTCTGGTATC
ATCAGGATAAGGTAAATATCTCTTAAAATCAATTTACTAAAAGTAACCAAAAAAAAAAAA
AAAAAGCAAACAAAAATTAAGCGGCCGCGGGGCCATAGCAATTTAAGGTTTTCCTTTTTG
GTGCCAAATTATCGTGCAATAATTGAGTTTGTGCGCAGTAAAAAGCGCAAAAGTGGGGGG
CGCGAGGAGGTAAGGATAAAGGGCGGGGCCATGCCCAGCCAATTGCTGCAGGATAAACGT
TTTTAACTTTTATGAGCTCTGGGCTGGCGCCTCTCCAATGCGAGTGTGCAAGTGTGTGAG
TGTGAGTCTGTTCGCGTTTGCTTACGCGTCGTATACGCAATGTATTTAATTTTGGCTTTT
ATGATTATGAGAAAACATGCTTTTGCATTTAGCTCAGCACTCAAAAGAGCTTTTGGCTTC
TCCAACGAGGGGAAATCGCATTTAATATGACAAACACACCAACGATATATTTTTTCTACC
TTTAGGTGCTCAGCGAGGAAACTTCGGGCGGCCGACTGAAATTCAAGACCATCAAGTCGG
AGGAGACCAAATCCATTTTGCTCATTTACGATGCGGATCTCCTGCACTCTGGCAAATACT
CATGCTATCCTTCGAACACGGAGATAGCCAGCATACGCGTCCATGTCCTTCAGGGTGAGT
TTCGTTTCCACTGTTTCTTTCGCCCGCTATCAGGCTCTCTCTTTAAGGCCTTAATTGGAT
GCTTGAGTTTGATAATGTGAATTATACATTCATGCATCTGCTTGACCTCGATTTGTATGC
ATTAAACTTGCATCTCGTTCTCTCTTTGTTTGGCCAACTTTTGCGCAATTTATGATCTAG
TGGCCACAACAGATATTACACCTTGAAAAATAGAGACATCCAAGGAAGTTTCTTAAAGAA
CCAAAACTTTAATTTTCTGTCACTCAACTAGACATACCATTCATCTATTTTATTATGACA
TAATCTGAGATGATCTGAAAATGTCTTTATAATATTTTCTTAAACTTCAGAATATTTTAG
ATCTTACGAATGTTTTATCATATTCTTTTCTTGTTGAACATCCAGTTTTGTTTTTAAAAT
AAAATAGTTTCAGAATATATTTTCTTCATAATACAATGAAAACTTAATGAATTTAGAATC
GCTCCCGTTTCGTGCAAATTTAATGCTAAATGTTGACCTCTTTGTAATGCAGACAAGCTA
CAAATTGTTGCTCATTCAGCGCAAGTTTTGTGCCTCTCTCTCTCTCCACGAATCTGTCCA
TTCTGCTCCACTAAACATTTTCCATTTTCCATTCCCCATTTTCCATTTCCCGCACAGGCG
AGCGACCCGAGGCGATGCAAACGAACGCGGCACCGGCCGCTGTTGCCCTGGCCTGTTGGT
CCTGTCACTTTGGCCAGGCCACGCAGGCGGTCAGGGTAATTAGCACAATGGTGGCGGCAC
TTGTATTGTTGGAGGCCTGCTCCTCGCTGCTCCTGCAGAGTGGTGGCGGAGGTGGATGTC
CTGGAGGAGGATCGCCCGCAGGAGGAATGCCCACTCGAGTCAGGGAGATACGGGAAAAAC
CGCTCACAAATTCCCTGCTTGACCCCAAGATACCCTCGACGACGTCCGCGGAGCGTGTCA
ATAATGGCAGCAGGAATGCACGGTGATAAATTAATGTCGCCCAGTTGGAATTCCACCGCC
AATGCAGCCCCCGAGTGCAGCTGAAATGATTTATACTCCAAGTTACAGGAGCATCGGGAG
CCGAAGCAGGAGCAGCAGCATCTGAGGTCCTTCCACTCGAGCTGCATGTAATACCTATCT
GAAAAATCAACTAATTATGCTAATGATGGAAGGAGCCGCGACGCTGCTCCTGGAACTGCT
CCTCCTGCTCGGTGGCAAGTTGTAAGTAAGCGTGTTTCTAATTAAGTGGGCTGGGGATTA
GTTAGTTAGGCGGAAATCGGAGCCATGTACATAAACTTCTCACGTAAATTGCCAGCACAC
TAGCGAAACTAGCTAAATGGAAAGCATTTCGAACGAATCATCAAATTAGAGAACTATATT
CAAGTGGTTTGCTTGTAGAGCCATGGCTAGAAGTTTAAATAAATAATAAAGTAAATGGAG
GGCAGGGGCGTTTTGGAGCTAGTAGAGATTTAAAAACAGTCATTAAAGTGTCTATGACCT
AAGGTATCGCATAATTTGTTCTATAGCTATAAGGCAAATGAAACATAATTTGTATATAGT
GTAGCACTTGACTTCTGTTTTTGAATATCTTCGGATTTCTGAAGTACCCCCATTAGTAAC
ATAAGTATATACATACCTAGCGAAAGTTTACTCAGATCGTTGTAAATACTATTGGGATTC
GTTCTTGATTTATCTGTGTGTTGCCCTTGGGTTACCCTGTATAGCCTAGAGTTTAAGCAA
TGTACATACTTAGAGATACAAAGTAGCTAACTGTTTCGACACGAACTTCTTCGAAGGTTC
CTAAACAAATTTTTTTAACAACTTTACATGTCCCATGGTCTCCCTCAATAATCTATGGGA
ACTCGGAGAATGCATGAGAAATTCCTGCCAAAAAACCCGCTTCGGTTTGAAGTGCGACTT
TCCGGGCTGGCAATTTATTTAGAAGAATTTCGAATTTCTCCAAGTCATGTGGGCAGTTCC
TGTTCCCATTTACCATATACCAACTCCAAGCAATTGCTGCGAGTTCATTGCTCTCCGAGT
CCAGGGAAATTTAGAGCCACCCAGTTCGGCATGTCCGGTTGCATTTATATGGCCTGTCCC
ACCGGAAAAAAGGGGCAAAAGACGAAGACGAAGACACAACTGGCAAGTCACTTTTCACTC
TTGTCAACAAAATATTTGCATTTCTATTTCGGTCCGAGGCCGTCGAATGTGTTCACGTTG
GGTTCGAGTTCGTCTTGAAGGACTTTGGCCGGGAAACCGGGCTCGTCTTCCTGTGCCACA
TTTAAAAATGTATGGGTTCTACGGCCGGTAAATGGGGCTAAGTTTAACTGATCAAAATTG
TAAATAAACCTGCATATATACCATATGAATAAACTATAAATTGTACTCAAGTATTCGTGT
GGTAGTCATACATTACATATACGAAAACACAAACATAAGAATGCACAGTGCTAGCAAATC
GGACATGAATATATATATAGATATGGATTTATATACGTATATGGATGTATCGATATTAAA
AATGTAAACCCAACGCATGCAAAATTAGTCGCGACATGTAAATGAATGTTTAATGGGTAA
ATTAATGTTGCCATAAAAGGGACAGGAAAAAAACCATGAATATAATTGCAATTAAGCAAA
TAAAATGAAATATATGTTATAAGCATAATAAGGGGAAAAATAGCGAGTATTATAACAGAA
GCCGAAAAGCAGAAAGCGGAAATAAAAACAAACTCTGTTGACTTTTGTTGCAAACAAAAT
GGCAACGCATTATAAAGATTATGAAATTGTTTTTAATTTTTAAGCGAGTAGCCACGTAAA
CATGAAAATCGGAATGAAAAATTTCAATAAAGTTTTTTTAGTTATTACCATCCAATGATA
AATATGTATAACAAAAGCCTGTCTTTTCTCTGATTTTTGGGTTCCTGCGAGCAGTTGCCA
CATGCTGAGCCGAATCCTGGTAAGATTTATGCAAATATTTTCCATTGCCATTCATGCATT
TGGCTTGGGAATTTTAATGGGCCACACGCACCAGTCGACAGACAAAGGAATTTTCCGAGT
GGAAGAGCCACGGGAGACTGCAAGTTTTCTTCGCTCTTTTCGGGGGCGCCATTTTCCATT
TTTCAGCCTAATAAAGCGGCAATGCAAAAAACAGGACCGACCACGAAAACTGATGGCAAG
AAGAATGGGCATTAAGTGCCTGGCTGGCAGCTGCCCTACGACTAGCTCTGGGCCATGTGT
GGCAGGACTCTGTTTGCGCTTTGGTAAGACATCGAAAGCCGTTAACATAAAAGTTTATTA
TATGACAAGTAAGTATGTATGTGTGTGTGTGTGTTTGTCCTGGCCCGTAATATCATGCCA
AAAAGTTTAATAGCGCTCAACGCGTCAACCGAGAACCTCTCCTTCACCCACTTTTCCCCG
CAAATCCATCGAGTGGAAAGCGTAAGGAGCGCATAAGGCGCATGAGGCTCATGAAGCGGA
AAGTTCCCACACTTCTCGGCGGAAAGACAGTATTACCCGAGATGATGACGACGATGATTG
GAATACTCTGGTTTTGGGACCAAAGCCTCGTGTGCAAGATGGATGGACTGCACGAGTCGA
TAGGTTGGATAATCTGCAGGGAAAGCTACCTGCAGAAGCTATTTACGTAACAAGAATTAA
TGGATTAATGCATTAAACTAAGTTGCATGCCATATATTGATTGGATGTTCATTACTAAAA
ATAAAAAAGGCATAAATATATATTTAGCCTTGGGATATTAAAAAAAGATATTACTTTAAT
TAAAAAGCACTTAATTATTAATACTAAATCTGCTGCATAAATTTTACTTTTTAAATGGTA
AAATAAACTGTTTTGATGGCTTTTTTAGCTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1181, 4591..4863, 30542..30753, 32134..32344, 33356..33493, 36003..36130, 36605..36773, 37437..39653
4824..4863, 30542..30753, 32134..32344, 33356..33493, 36003..36130, 36605..36773, 37437..37762
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved