Drosophila_melanogaster Locus RpS9
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS9
Drosophila_melanogaster
RpS9
3L
snoRNA:28S-G3253
1736..1823
3653
actttaagacttgtaaagtggttcgcagggaaaatggtcgagctgctctctatgttagt
gaggtgtttctctacaaagatccaattgatgatatcgttgtaagttgaaaagtaaacatt
tctgaagaaataaatgaatacctattttacagcttaaccttggtgtttttagaatagcta
aaaatcgtcgttttcagttcctgaatgagactttggactattgtctttttagtcggcagt
atttggccagtggattttttggatttctgatgactccactgttgagaatctcaaacttga
atgctacatgtccgcttcaggtgagatcgaatgggttgatgattgatttttgtcattgat
ggtataacctttagcaaaatataactttcaacggcttttctgttgatgaaaacacaataa
aggagattccaattccaaacggtgtttacatgttccacttgcgatcgtccctgatgaaaa
aatggcggacagacgtgaaagtctatgctacgcgagttaataattattcggaataactga
taaattggtttacatacttaatagctcaatctaataaaggtctacagtatttcttacatt
ggaactacatcttaaatgtattcaatatttgacacaacattggtatacgtatacgtactg
tataacacttacattgaaattacatttcatgcaatatacattcgacacagcactttcagg
cacatcattagaaaagacgccactttgagaagttgaagttgagaagaagaagtatcgtaa
aaaattaaatattttccgcaatgggattgtattttaactaattaaaagttttttcttatt
ttttttccatacattaattacatttaaaacttttgcttagttaaccactcataaatttca
taatgtataattacatgtcaaatctctagtggttagcgatagagtgaccgtttagtttcc
gtggtaggattatgtgtatttctatcaaacactttggtcacACTACCTTCACCCCTCTTT
CTTTTTCTAAACGTGAGCAAAACCgtaagtacaaaatatgagctccgcaaaaactttgaa
aaagtacatgataatgttcaagataaagaacaaattcgcctacttaggtctgaatcgatt
gttggtacgctgaatatttcaaagtttttgcgaaatagactgacgatggtgcagatacgc
agtgatttccgaaccgaatttaacctaacttttgccttgcagTGCTCGGTTGAATTGTCG
GAACCATGGTGAACGGCCGCATACCCTCGGTCTTCTCGAAGACCTACGTGACTCCCCGTC
GCCCCTATGAGAAGGCGCGTCTGGACCAGGAGTTGAAGATCATCGGCGAGTATGGTCTGC
GCAACAAGCGCGAAGTGTGGCGCGTCAAGTACGCCCTGGCTAAGATCCGTAAGGCCGCTC
GTGAGCTGCTGACCCTCGACGAGAAGGACGAGAAGCGTCTGTTCCAGGgtaagtaccagg
cacacacatatattcagtcgaacttcctcaaacagcagcctactagttcccgacttttag
agccacttctaaactttgttaattgctttgattaatcgtaattaattagtcgtaacaacc
cacgtgtaaagctgttgaccggatttattccattgtatattgcaaaattgcatgtttaaa
tgtctagacagtatgtatatgcgaaggaagttcgactgcataatccaattagttgccctg
acctgatgaactgtattaaaaaatatattctgacacttcttgtctgataaaatacgttga
cgttaacaaatacacactgaagagaattcttcgctagaactagcgattgcattttgaaac
ttccattgattgtgtacccattttacccacagGTAATGCCCTGCTGCGCCGTCTGGTCCG
TATCGGTGTCCTGGACGAGTCCCGCATGAAGCTCGATTACGTGCTGGGTCTGAAGATTGA
GGACTTCTTGGAGCGTCGTCTGCAGACGCAGGTGTTCAAGCTGGGACTTGCCAAGTCCAT
CCATCATGCTCGCGTCCTGATCCGTCAGCGTCACATTCGgtaaatatcgcttggacaggc
gacaacatcgtcgccaggctctctcagatataaactctgttctgttcagtaagaccactt
gggagtcgaacaggcgccaatgcttgtaccgactctcaacgtctgtagattgcgcatgtg
actccgttcacaccaatcgaaaatgcaaaatgcccgcctagcgtaagttgcactgaacgt
tttttgttgaacccaacatacatagcagccaccattccgatggttatcataaagcagagc
ttaactaatccaaatatggtgttcttcttccgtttgttttcacagTGTCCGCAAGCAGGT
GGTCAACATCCCGTCGTTCGTCGTGCGCCTGGACTCCCAGAAGCACATCGACTTCTCCCT
GAAGTCGCCCTTCGGCGGCGGCCGTCCCGGTCGCGTCAAGAGGAAGAACCTGAAGAAGAA
CCAGGGCGGTGGCGGTGGAGCTGCTGAAGAGGAGGAGGACTAAGCAGTGGTAGCCAGCTG
TAGCCAAGACAAATACATGGCGCAGACTTGATAAAAATCCGTTTGCTTTACACAAATAAA
TGTAAAAATACACGaagttgaatgtgtttcaatgcgcatgtttgtttatagaatgggtta
agccgaagatgatatcgaaatatatgcaaataagacattgaagttttaaacaaaaacaaa
aaaagttatatggttaatgtaaagattattttcttttttaatattgctgaaataaaaaaa
agcagtatttatcgatacccggtcagagctgcaattccagataaggctccagtgtgccca
gagaagtaatctaacgaaatgctgccgttatcaacttagtactcgttatttcccgagctt
tcgtgtgcttcgccagcaaaattgccattctcacaaaacgaacgtttgaaaatcacttga
gattcgggtaaacacaaactccaagtgacgaggaagaacagcagccggaataaatcgcgt
ataaatagtgtgataagcaagtgtcgccgaaatgccgaaacccggtgacaaggcgaaggt
gaaggtgaacgtcaaggagcgggtggtggacgaaacctgcgacttgagtctctccgaact
gagcgaaataccggtgcgggagatcgtaagtacaagctgaaatacaagtaattagcatca
gctcccatcacccctctcgcttcctcttgggtccacgtttgttgtctggcgaatgtctag
tcactgtctgtctcacttgcacaagtgccgtgtggtggggggtgcggtttggcatggata
aagagagatccgcatactcttgttgtagttgttgttgttgttgctttgccggctggcttg
caattaacgctgacgtcgacttccacacaccccttaacccttgtgtgccggcgaatgcag
ttgaattcgctcgagggggttgatttttggtctttgccacccctcaaaaactcagatggt
tgccaaaaaagaaaaacaagtatggtagcttaagtgtagagtgtcgcgaccaccagatac
cgagtactaattattaaaaaagaatataaaaaataatagatatatatttgatgt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 1242..1487, 1892..2078, 2385..2653
1265..1487, 1892..2078, 2385..2562
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved