Drosophila_melanogaster Locus RpS17
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS17
Drosophila_melanogaster
RpS17
3L
snoRNA:Psi28S-612
1300..1444
3129
GATTCCGCCGTCTGGCTGCCGTAGATGCTGTAGTTGTCCCCATGGATGATGCCCAGCCC
GTCGGCCTCCAATTTCGGTTCGAGCAACTGAGCTAGTGGCCTGTCGAAGTCCAGGGAACC
AGAGGAGGAGCAATTGGATGTGACGGGCGGGGAGCCGGAAAGCGAATTGCGCGACGAGTT
GGTATCATAATCCCGGCTGTCTGATAACGAATTTCCATGACTATTAGCGGTAGTCTTCCA
CTCGCTGTGGAAGTAGTGTTGTTGTTGTTGCTGGTGTTGTTTCTCTTGGTCGTTCATGTC
GTATTATTTGTTATTTGCACACCCACGCACACTAAGACAAACGCTTGCTATATCGCATAT
GATATGCAGTTGTTATTCTCTTTCTCTGCTGCCACCGTGCAATATGTACATATATATAGA
TTGCTAAAGAAATTAGAGATCGCGAGATCGAAAAGCACACATCCGCGATCGAAAAGCACA
AGCAACAACGATAAGAACCAGTGTGACCATGGGCGGAACGACAAAATATAACGCGGTTCT
GGCTGAAATATACCATAAACTGGGATATACCGAAAATAGTGGAACGCAAAAGGGGACACC
GCTTAGTGGGGACTCAAACCGCGTGTAGAGTTTTAGGCGGAGTCTCCAAGCGTGGTGTGA
AATTGAAACTAAGGTGTTCTAATTTAAAGAATGAATAAATTTGCGAAACCAATATACTGC
CGAATAGACTTATTTTTAAAGATTTTATATATTTTCTTATAAAAAAGAGTTTGTTTCATA
ACAAGTATTCTAGCCCATATTTAGGTACCATTGCACTGTACAATAGTCTCATTTAAAATG
TTTAGTACAATAATGCGGTTTTTGTTAAATAATGTGTTCTAAGGTTCAAGTCCTCTCTTA
TTTCTATTTAATTCATCTACCTTCGAGATTTGCATAATTATGGTATATTTGCGGTATATT
TTAGTATGTTTTTCACACAACCACCCTGGTCACACGGCATCCTTCTTTTTCTTTCGTTTC
CGGCGAGGTATGTGCACAAATTTTGTTTCTCCACGTTTTTCTTAAAAATAATTGCTTATT
TCTCATTTTAGCGGTGATTAAAATATCCATCGAGCAACATAATGGTACGTACCAACGAAA
AACTGGCTGAACTCGAATCAAAAAGCGGTCAAACAAGCATAAAACGGCAACGACAGCCGC
TTATCCCACGTGCATAGTGCCAATTTTGTTACCCCAAAAGCAATTATTTGTATCCGGCGT
CTTGAAACCGTCCTTAATATCAATACCAAATAGCAATTCAAACGGAAACTTTAAAAGAAA
CCTAAACTAAAACCGAGTGAAGGCCTCTTACATTAAAAGTCCCCGAAAAATGCCGCAACT
ATCTCAGAAAATCAGCTGCAAATAACTATTTAGTTGTGACAGAAAACTATCGCAAAGATA
CAACAAAATGGATTGAACTATCGTGATACTAAACATTTTATCAACTACCACAGGGTCGCG
TACGAACCAAGACGGTGAAGAAGGCCGCTAAGGTCATCATCGAGAAGTACTACACTCGCC
TGACGTTGGACTTCCACACCAACAAGCGCATCTGCGAGGAGGTGGCCATCATTCCCACCA
AGCCCCTGCGCAACAAGATTGCCGGGTAAGTGCCGCTCAAATCTCGTTAGTGAGTGGATC
TATAATCCCCAAATTCCTTTCCAGCTATGTCACCCATTTGATGGGCCGCCTGCGTCACTC
CCAGGTGCGTGGTATCTCCATCAAGTTGCAGGAGGAGGAGCGTGAGCGTCGTGACAACTA
CGTCCCGGCCGTCTCCGCTCTGGAGCAGGACATCATCGAGGTCGACGCCGACACCAAGGA
GATGTTGAAGCTTCTGGACTTCCACAACATCCGTGGCCTGCAGCTCACCCAGCCCAACAC
CAACAACTTTGGTCGTCGCAACTAAGATTTGTATAGCGCGTAGATGATGATGTTCTGATT
TGCATGGGATCACAATAAATTTGTGTGAAGTGCATTTAAAGTGTATGTTTTTGTGTTTCA
ATTAATTATGCGTATTCGATTGAAAAATATCCAAAGTGAACATCGTTTCCAAAGTGGCTC
ACCAGGCAGGAAACTCGATCTAAATTCAAGAACCCCAAGTCTGTGTTCCGTTTATCATCT
TTATTCGCATTCGAATGGAAAATACTGTAGACATGCACATATTTGTAAATATGTTTATAT
TCAATCCATAAATATATGGGTTCGTTTTTACACAGACGATATATAAAAGATATTCTACGA
GTGCACAATATTTAAATCTAATCGTGTACGCTGATGCCAGTATATATAATTATTTGTTAT
GTATATGATGGGTGGTAGCTATACGTATGATTGTTCCCTCCGGTTCAGGAAGATGCTGAT
GTAATGGGCGACGCAGCCTGATCCTGCTGGGGTCTTCGCACCGGATTACGCAAGACCAGC
TCGGAATCCTCCGAAATGATGGGCAGCGCGTGTGCCCAGTGGTAGTTGATCAGATGGCTA
ATGCTGTCGAAGATGCGATCTTTGGTTCGGACCACGCCCTCGGGATCGATGAGAAGCAGA
TGCTTGGGCGTCTTGCCCTCTAATCCGGTTAGTACGTACTGGCCCCGCTTTCCCTGTGAC
TCGCGCACCAGAAAGTCGCCGTCCTGCTGCAGCAAACGCTCCGATATTGGTCTGGATATG
CCCGCATGGAACCACACCTCCGCTGTGAGCGGGCATTGCGGTCCGTCGAACACATCGCGA
ACAGAGGGCAAAACAGAATTGGCAGCTGTGGTCGCTTGGAGGGGATCAAAGTGGCCTAAC
TTATTGGTCGTCTGATCGGGAGGCGGGGAGTTGAGGTCGATGAGGTTGCTGCTCAGGCGA
TCGCGAGGCTTCTTCAGATTCAGTTGTGCCACACGAGGCGCATGCGGATGGAGAGGTTGC
TGCACCTGCTGTTGTTGTGGTTCCGGCACTTCTGGTGGCAGCTTGTTTGGCAAATCGTTG
TAGTACTCCTTCACATTCTCCTTGCAGCTTTGATTGATGTTACAATCCGCCGAGGGATCA
TTGAGCCTACTGAGAGCGTTGAAGCGCAAGGCAAACGCCTTGCCAATGGTCACTATTAGA
TCCTCGCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1026, 1091..1123, 1493..1644, 1704..2129
1121..1123, 1493..1644, 1704..1941
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved