Drosophila_melanogaster Locus RpL14
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL14
Drosophila_melanogaster
RpL14
3L
snoRNA:U49:66Da, snoRNA:U49:66Db
1472..1551, 1947..2030
3398
AAGGCCATACAGGATAAATTTATAATTTCTCCAGTTGGGAAAATATATATGTAAGCTAT
AACATGGACTTTCCATGTTCACTTACCTCTTTTCGATCTCCATGGAGACATTGACAATGG
TGCCGTAGTCGTTGAATGTCTTTTTTAAGAAATCCTCGGTGACCTTGTTGCCGGACACGA
AGATGGTATTGCCGGCCCGTGGCTTCTCTGGCTGCGCTGTGTCCATGGGCACCTTCTCGG
GCATGCCGCGCTCCTCTCGATCCCGCTCGGTGGCGAAGTGTTGGTAGAGATTCTGTCGAC
GCGGCTCCTCCTTAATGATCTCACTAATGATCGTCTCCTGGGCCACGTCGTTCTGCGTAG
ACGAAAAGGGCTGGTAGGAGGCAACAGTGGTTTCCGAGGTGGAGCGCTTGGCTCTTTCCT
GTCCTTTGGGCCGCTTGAAGGAGGTTTGATCTTGCTTGGTCTGCTTCTGGATGGCGGGAA
TGGCGCCGCTTTTGATTAGTTTCCTGGCCACTTCACGGGCATCTCGCGCATCCGTGGGAC
GCTTCAAGGTCAAGGAGCTCTCCGGCTCCGGCTTGGGCGCCTTGTGCGCTTGCAGTGCCT
TTTTCTACGGGTTAAAAACTTGTTAATATAAATAATCACATTTGTGGCATGAGTTTTCCC
ACCTTTTTCTTGAGTTTCTGATACTTGGCCTGCAGCATTTGCTCCTCTTCGGTTAAATTG
TTGGGGAAGTGTATGTAAACCATGTTGGGAAAATGTCTGCTTGAAATTAACCCCGTAAAA
AGTAACTTCTACAAAAGTAATTATGTTATTCCAAAATGTTTATTTTTACTATCGAAATCT
ATCGAATTGGCTTAGTGTGACTGTAACAGTTGATAGCGAAAAATACCACATAAGATGTGT
ATGATTTACTGTCACATTAACTATTTCTGCACAACACTAGACCACATGCAACTCTGTGTT
TAGCAACACTAACGCCATGCTACCACCGAGCTGTCAAAAAAGTTCTTTCCTTCTCTTTCT
TTCCGGTTAGCGTCATGGTAAGAATCGACGAAGGTTTCTGCGGATCGGTTGAAAAATGTG
AAAATTCAGCGGTCTAAATGGCCCGAGATGAATTAAATTTGGCGGCCAAGCGAACGGGTC
AGTGCGTTGAACGTGTGAATAGCGAAAGCAGCGTAAAAGCGTTGGAAAACCATGGGATAT
CCAACATTCAAATAGTTCACGTGGTGGTCACCAACACAAGCAACGCGCTGGCCATGCAAC
AACCGAAATCCAACATTTTCACCCATTTTTAATGGACTTCTCTCTGTTTGCAGCCTTTCG
AGAGATTCGTACAAACTGGTCGCATTGCCAAGGCCTCCGCCGGTCCCCTGAAGGGGCGCC
TGGTGGCCATTGTCGACGTCATTGACCAAAACAGAGTAAGTGCATCATTCCATAGTGGAG
TAACAGCAACAAATTGCCAAGTGACGAGCTCTTGCACATGATGATAATTTGTCTTCTTGA
TAGGAAGTGCCAACTGACACATAAATGAAGCTAGTTTAACCCTCTGAAAGCAAGCAAGCA
AAACCAGCATTTGTTGCTGTACTCCTCCCTTCATGGCCATACATGGTTAAAGTGATCCAA
ACTAATTAATGGCTTTTCACTTTTCAGGTTCTGGTAGATGGTCCTCTGACTGGCGTGCCC
CGTCAGGAATACAGATTGAACAATCTGCATCTGACCAAGTACCGCATCAAGTTCCCCTAC
ACCGCGCCCACGCGCATCGTGCGCAAGGCCTGGACAGAGAGCGACCTGAAGGCCCAGTGG
AAGGTCAGCCCCTGGTCCGTCAAGGCACAGAACATCTGCAAGGTATGTACACTGAGCACG
AGGAGGATTCGTAGCTGTAGGAAAGTTTACCTATGTAGAGGGGAAAATGTTATACCTCTT
CTCTGCCTAGTTGATTACCTCCTTGAACTGCACATGATGATAATTGAAAGTTCTTGATAG
GAATTGCCGGCTGACACATATATGAAGCTAATTCTAGTTTATCTGATTACAATCATAGCT
AGGCGTCTTCATAAACATTCAGAATAAATCAAGTACTAATGAGAATTTGTCTTCTTTTGC
AGCGCTCCTCGTTGAACGACTTTGACCGCTTCAAGCTGCGTTATGCCAAGCGTCAGCGCA
ACAAGCTGCTGACCATCGCCTTCAACACACTGAAGAAGCGCACCAAGGCTGACGGCACTC
CCCGCGTCCTCAAGAAGGATCGTCGCGAGCGTCTGCGTGCCGAGAAGGCCAAGGGTGGCA
AGAAGGCCGCGGCCAAGAAGTAAAAAATACTACCTTTAACGAAAGTAACTGCTTGATGAA
CATCCACCACCATGGAGAAAATAAAAGAAAGTGTTATTTTTAGGAAAAACACAAGCACAC
TGCCAGCTTTCTTTTGGTTTAACGGTTTTATTTGCTCTCAAGAAACAAAATGATCTTAAC
AGTCCAATCTTTAAAGCACAGTCTACCAAATAGCTAACGACCAGAGGACCCCGCTCAAGT
GGGGCACTTGCCGTAGATGGTCTTCCAGTTGTTGGGATGGTTGTAGCCCAGCAGGATGGG
CAAGTGCAGGAACAGCGTGATATGTTCGCCTTGTATCGACGTGGACACCTTGACCCACTT
CCGCAGCCACTCGATCATGGCCTCGCTGCTCAGGCTGTCGGGATTCAATCCGCGCAGATA
GCAGGAGTAGCGCAAAGCATCCGGTGTCAGGTTGTGAACGCCACCCTCGCGGGTTATGGC
CTGGTCCATGTAGTGCACCAGGAAGGCGTGCTCGTGGAGCCGATGTCGCTTGAAGATGCT
ACTGGGCAGTCCATGAAGGTTGACTAGGTTTCTCTGGAACGTATGCATTAGTGATATGCT
TTAGGCTGCATAAAATGTGTCAGATTAAACGTACAACGTGCTTCCGCGACATTCCCAGCA
GGGAATATGGTCCTTCGGCGAATATGTCTTTGACATCGATGAGCATCTCAGGCGTGGGGT
GTGTGCCGCTGCCCAGCTGGCCCAGGATGTCAGCAAAAGCCGAGTGCTTGGGATGCGATG
CCGTCGCTTTGAGCTTGTCCTGCAGGCAGCGAAAGACGTCCTTGTTATTGCATAATCGCC
GCTTCATGTAGTAGCTCTGGAACTCGGAGCGCTGCTGCGGAGTCCAGAAATGGGCAGTGA
GAAAGGAGCGGGGGTAATAAAAGCTGCGAAAGAACAAATCGGTATACCAAATTTTGCAAG
AGTGTTTAGTAGGGCATATCTTACACGAGGGGAAAGAACGCATAGCCCACCATGGGCAGG
GAGCAGCCGATCAGAGCTGGTGCCACCTTCATCATGTCCCTTGGCATCTGCATGTACAGC
TCCAGCTCCTGGCGATTCAAAGCTCTTATGCCTTGAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1313..1414, 1647..1841, 2102..2398
1034..1036, 1313..1414, 1647..1841, 2102..2299
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved