Drosophila_melanogaster Locus CG10576
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG10576
Drosophila_melanogaster
CG10576
3L
snoRNA:Psi28S-1837a, snoRNA:Psi28S-1837b, snoRNA:Psi28S-1837c, snoRNA:684, snoRNA:Psi18S-1397
2313..2449, 2458..2594, 2623..2761, 3285..3362, 3707..3847
5737
GCACACTGTTCATGGACTCGGCCATGTCAAAGTCAATCGTGCGGGGCTGGTTAATGAAC
AGCTTCACATCCTTGGGACCCAGGTGCGAAGGTGCCTTGAACTTCAAAGAGTGGATCTTC
ACAGCCTGATTAAAGGTGATGGACAGGATGAGCTGCTCATCGCAATCGGACTGCAGGTAG
CCACCGGCGGAGGCCAGGGCGTGCTTTAAGTTGTGGTCATCAGCTTCGTTGAGGCACTCG
CACTCCTGCTTCGAAATAAATGTATTCAGTTCCATCTGTAAGAAGGATTAGGGATTATTT
TTGGAACATTTCCAAATACTGCACTATATTACCAATCCCTGCCCGTAATCCTCGCCCCCC
TCCTCGCCACCGGATGTACCGATGTGCTCCTGGATCTTGGCCTCGAGCCCATTGACGTCC
GCACCCTGGACGCGATCGATCTTGGTCCTGTTCCTGTAGAAGATGAATGTTGGCATGGCC
GAAACGCCCTGTCCAGCAGCCGTGTCCTGGCACTTGTCCACATCCACTTTCAGGAAGATG
GCCTTTGGGTACTTTGTTGGAAACGTCTCGAAGATGGGCGCAATCCGCTTGCAGGGACCA
CACCACGAAGCTGTGAAGTCCACCACAACCAATTGAATGCCCGCTTGGGCCAACTCCGCC
TGGAAGTGGGACTCGTCGTTGATCACGCGCACGGACATGGTGATAGGATTAGGTTTCTAT
TAATTGAGCTTTTGTTTCGGCAGCCGAATTGGATTTAAGCAAGTAAATGTTATTATTAAC
GTTCAATGCAAATTTTTTTTGTTAAAGATGACTTGTAATATGCATTTAGTCCAAATTCGT
GCTAAGAAAAATACCGAATGCGGTATTCCACAAGCGGTCACACTGTGATGGTATCGATAT
TTCGAGCTCTTTGACTTCCTATTTTTAGAGGGACCATTTATGTGTAATAGAAAAAAACCG
AAACTTAATATTTAAACTTTTATTGAAATATTAGTGGATTACAATATGTAAAACTATGAA
ATATTCTCATTTGATATAGCTCAAAGTGTTATTTAAAATTCATTCAGTGTTTACGACTAG
CAATCTACGCTTTCACGCTCATCTTAAGCTTACCGCCCATTTGCCAGGGTTGTCAAGGCG
AATGAGCGGTCCCACCATACACGCCACTGGAACTTTCGATACCTGCGCTGCGCCTGGCCA
CACGTTCATTACCTCGTGGTGTTTCAGTCGGTCGCATTTTCATTAAGTCGCCATTTTAAA
ATTATTAGAGTCAAGTACAATGGCAGATGTGGAAAAGGAGCCCGAGAAGACCATCGCCGA
GGATTTGGTGGTGACCAAGTATAAGTTGGCCGGCGAAATCGTCAACAGTGAGTATTCCTT
GGCCGGAAACAGCGAACGCTGGCCGATTCCTGGAGTCGCTGCTACGTGGCGCTTACACAA
TGCACCGAATGCCGCTTTCCCTTGTGCGCCACGCGTTGGTTAATCTGCCTATTTCTGGAC
TCTGTCTGCTCGTTTAATTTTAGAAACCCTCAAGGCGGTAATTGGACTCTGCGTGGTTGA
TGCCTCCGTCCGGGAGATCTGCACCCAGGGCGACAATCAGCTCACCGAGGAGACCGGCAA
AGTAAGTGGTGGCCACCTGGCGGTCATTCGCGCCAATTTCATGTCCAATGATTAAGACTT
ACACCTTTGAGGGTTTCCCGATGGCGAGCCATGTGCTGTGCGGGCTGGGGATCACCTCGT
GGTCGCCAGGCGCACGCGGGGACTCCAATGCTCCACGTGCCCGGCTTGTGTGCTCTCCAA
AAGGTCCCGAGGATTTACAGATTATGAGATCTGAGGACACACCGCGCACTATCATTGATA
TATAGTACAACGAACAAGCAATCTAATGCTTTTATCGATCTTTCACAAACAGGTATACAA
AAAGGAGAAAGACCTGAAGAAGGGCATTGCCTTTCCCACCTGTCTGTCCGTCAACAACTG
TGTCTGCCACTTCTCGCCAGCCAAAAACGATGCTGACTACACGTTAAAGGCCGGTGATGT
GGTCAAAATGTAAGTTGAACCTCCTATTCCACATATACCGCCACTAAATACGTAACATTT
CTTTTCTACAGCGATCTGGGTGCCCACATTGATGGTTTCATTGCCGTGGCCGCTCACACA
ATTGTGGTAGGCGCTGCTGCGGATCAGAAGATCAGTGGTCGCCAGGCCGATGTCATCCTC
GCCGCCTACTGGGCTGTCCAGGCTGCCTTACGTCTGCTCAAGTCCGGCGCCAATGTGAGT
CCTCCCTTACTTCTAGGTAATCCTCCGTTAATCCCTGCAAGAAACGGATTGTCTGCCGCG
ATTCTCCAGCGACTGAACATCTCAACACTTGCAAAGATCAGCTGTGGCAGCTGGTAATTG
CCCTGGCCTATTATTCAGGACTGGAGGCTTCTTGTCAGTTGTCCACAAGGTTATTTCTTC
TGCAGGCAACGGATTGACTGCGCTCAAACTCTGACACAGATCAGCTCAACACCTGCGGAT
AGAAACTGTGTCAATTTCGTGAACTGAACAAGTTCATTCCATAGAAGTGTTCGGTCTTTA
AATTTGTCCACATCTCCAGTTTATAGATATGTCGGAATTGTAATCTGCAGGCAACGGATT
GTCTGCTGCCTTAACTCGTGGCTCAGCACAGCTCAACGTCTGCAGAGATCAACAGTGTCG
ATTTCGTGAACTGAACAAGTTTAGATACTTGAAATGTTCGGTCTTTAAAGTTGTCCACAA
TCGCAATGATAATGCCGATCAGTTATTGTTATTTTGCGTTATCTATAGTATACTATGATA
TTTGATTAAGATTAGTCAAAGGGAATTGGAATGTTTTCTTTATCTCTGCTTTGAACTATT
TCCATTTTATTTCATACTTAATATTTATGTTTCAATTCTGTATCCTTACAGAACTACTCC
CTCACCGATGCAGTGCAACAAATCAGCGAGTCGTATAAGTGCAAGCCCATTGAGGGCATG
CTCAGTCACGAGCTGAAGCAGTTCAAAATTGACGGCGAGAAGACGATCATACAGAACCCC
AGCGAGGCGCAGCGCAAGGAGCATGAGAAGTGCACCTTCGAAACGTACGAGGTGTATGCC
ATCGATGTTATCGTCAGTACCGGCGAAGGAGTGGTTAGTAATCCATCAATAGACACTACA
TCTCCACTAATTTGTTCGATGATTAAAAACACGCGCTTGAGGCTGACTTTGCTGGAATGC
GGTGTTTGTTGCGAGAGTGACTTGTTTGCTCGGCGTTTTTTTATACTAAAATGCGGCACG
TGCAGACACCAAGTTCCGGCTGGCTGTTGTCCGAAGATTGCAAGATTATGAGATCTGAGA
ACGCCAAATTTAAGCTGGATCCTGGATCATCGCAGCCAGAGCATTATTGCTAACATTATT
CGTATTCGTTGCAGGGACGCGAAAAGGACACCAAGGTCTCAATTTACAAGAAGTCTGAGG
AGAACTACATGCTCAAGATGAAGGCGTCCCGTGCTCTGCTGGCAGAGGTGAAAACCAAGT
ACGGAAACATGCCATTCAACATCCGCAGCTTCGAGGAGGAGACCAAGGCCCGCATGGGAG
TTGTTGAGTGCGTCGGCCACAAGATGATTGAGCCCTTCCAAGTGCTGTACGAGAAGCCAT
GTAAGTGTGATGCATATTATTATTAATCCTATTCCCTATTATGCGAGTTGGCAGAACTTA
ATTCCGGACCTGGTACACCTTCGGGTGCTAAGTGCGGCCAGACATTTTGCCAGAACAAAT
TCCAGGCATTGTCGTCTTCAGCAGTTGCCTCAGTGTGGCCTCTGTCTGAACATGGCACTG
TCACAATCGTATCCAATCTATTAACCTGTTTTCTTATACTTATTAAAGTTAATTTAGAGA
CTAAACTAGTTTGAGCAACCTTTATAAAGTTCGAATTTTAGCCGGAAGTAATAGCAAAGT
TAAACAATCCTTTTCCTTATCTTGCATTACAGCCGAGATTGTGGCGCAGTTTAAGCACAC
GGTTCTGCTCATGCCTAACGGCGTCAACTTGGTCACCGGCATCCCATTCGAGGCGGAGAA
CTATGTGAGCGAGTACAGTGTTGCGCAGGAGGAGCTCAAGGTAAGCTGCAACAATTTCCT
TGTATTCACGATGCGTACTCAATGAAATCTCAACTTTTTGCAGACTCTGCTCGCGCAGCC
TTTGGGTCCTGTGAAGGGCAAGGGTAAGGGCAAGAAGGCAACAGCTGGGGCGGCGACAAA
GGTGGAAACGGCGCCGGCCGTGGAGACCAAGGCATAGACCAGCCCGCTGATGATGATCCG
CACCGCCAAGCCATCAACGGAAACACAATGTGAACAATTGCGCTGCCCAACGCTGCGCTC
CACAGATTTTTACTATCGAATTCGTTGCGTATTAGAGGACCCTTTTGACAACAGAACAGG
ACAGAAGAGAAGACGGCAACAATTTGAGGATACATTTCCCCAGAAATCCTCCATCCATCA
ACAAGGCGGGCGGTCGGTCGGTCCCGCGCCAACTTTACCTCTTTATTTCCTTTACTATAA
GCTGCCTTCGTTTATCGGTCTGTTCAACATCATCGCAACGAAAAAGCAAAGCAAGAACTG
TCATCAAATTGTAACAATTTTAACGCTAAATGATCTTAAAATATAATTCAAGTGAAACGT
TATTAACGCTGCGTAGTAGGTATTAAATAAAATTAACATTTTCTATAAAACAGCCGATAA
ATGCCAAACGATTTTTCATTTATTTACTTTCCGCTGGCGCCCAATTTTAATTCGATTTCG
ATACGCTTCTCATTCTAATAAATGCACTTGCGAGTTGTGTTTATTTTATACGTTTAATTT
AGTTTTGATGTTCACATTCACATTATACAATTTGTAATTTAGATTTCTTGCCTTTTGTTA
TTTTAAATTTTACAGTCTCATCTTTGAACTCTTGTATTACGAAAGTTGCAAGAATAACTT
CGTTATGTTAAACGTCACTTAGTGCTGTGCTCACTTGGCCACCCCAGTTGTCCATCCCAG
ATCCAATCCCAACAAGACCAGACCAATTCGATGCCGTATACGGCGACTTTGCCCAACTCG
CTGACCTCTTCCCTTGCGTCAAACAAAATAAAGAACAACAAAAAACGCAATTGCTGCGGA
TGAAGTATAGAAAACACGAGCAGCACTTGCAGACGACAAAGATATGTGGCCGGTGATCAA
AAGAGGATCTGGGATTTAATGGTCTGCCGTCGCTTACATACATGGTTTGGTGTACTTTTT
TTTTTTTTGTTATGATCGCCGCGACTGTTTTCTACTCGCCAGACTAATTATTGACATGCA
CGTCCATCGGTGCGGAGGCGGTCACGTTGCTCGACTTCTCCGGAGAGTCCAGGTAAATCT
TCAAGGCACGTTCCCGGCGCTGCGCATACCGCGTGGTGGACACGCAGCCCACCCGATCCA
GTCGTGCCTTCTCCCTGGCGTTCATCAGGCGTCGCTCCTCCAGCGTCAGCTCTCGCGCAG
GTACCGTCCTATCTCTGTTGAATTCATTGGTTAGTCTAGGAACTGAACTGCCACTTGCTC
CACGCTTACTTGTACAGGTAGATGTTTCCTGTCTGTGTGCTATTAAGCGGATATTTGTCC
AGGGTGGTGGGCACGGAGTACCAACTGCTGGACTCGTTAACACTTAACGCTGATATGCTT
GTGCAGGGGAAGTTGCTGTTCAACTGCAGAGAAGACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1366, 1523..1620, 1912..2048, 2111..2273, 2931..3152, 3434..3659, 3992..4119, 4183..4737
1279..1366, 1523..1620, 1912..2048, 2111..2273, 2931..3152, 3434..3659, 3992..4119, 4183..4293
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved