Drosophila_melanogaster Locus RpL28
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL28
Drosophila_melanogaster
RpL28
3L
snoRNA:Or-CD11a, snoRNA:Or-CD11b, snoRNA:Or-CD11c, snoRNA:Me28S-C3351, snoRNA:Or-CD12
1418..1484, 1630..1696, 1843..1909, 2112..2188, 2532..2609
4049
TTCCACACAAGGATACCCTAGGTGGACCCACCTTCTTGCAGGAGCGGACTATCTTCTTC
AAGTCATACTCCGCGGACAGGCCCTGGACAGTGGTTAGCGTCTTGCGACCGTTCCTCTGC
TGGATTCTTATATGCACTAGCCCGTCTTGAATATCATCATCATTGCCCTTGATTGCATCA
GCAAAGGGGTCTGTAAAGGCGGAAAAAGGCTTGGTTATTGCGACTATCGGGAAATTCAGG
GCATGCAAGATGTAAAACGCAGGTTGTAAGGCATGTAATCACACCCCAGCAGCGTGTTTT
TCTTTTGTACCAGAATGCGCTTATGTGCGTGTGTATGGGTGTGTGTGTGTTCGTGATGAT
GACCGTCAGGGCGGCCATTTTTATGTACATGTGTAGGAGTCGGGGAAAAGTGTCTCGTTT
GGCCTAAACTTACCACGAGTGTTTAAATTCTGGATGGACATACGACAATAAAAACAAACC
ACAGCCTAAAACAAAAACTTTTTGAAATGATTTGTTGATAGTCAAACTTTAATTTAACGT
TTTACTGATTGAGTTTTTTTTCGGAAATGTGTCTGACAAGTAGACTAGAGCTGGAAAAAA
ATCGATTTCTAATCGATACTATCGAGTGTTCAGAAGATGGGCAACGCCCGCCAGCATCAA
TTATAATCACTTGATTTAAAATTGTTAATCACAAGGGTCTTCGTAAATTTATGAGTTTTT
GGAGTTTTCGCAAATAATTAATCAATACCATAGCTTTTGCTTATATTCTAAAAATATGCT
ACAAAAATATTATAAAACTATATAAGCAATTAAATTTGCAAAAATTAAATTCATGTTATG
TAGTTTTGAAAATACAAATCAGACAAATTTTAAATATTATCTGCTATGTGTTAGCGTACG
AAATGCTTATCGATAGTTGCCCTGCCAACTCGCACAACACAGAATGCAACCCAGTGTTTT
CGGCAAGCGCAGCCAACTTCGCGCTATGTCGGGCTGCCATATTTCTTTCCTTCTTGTATT
TCAACGAGAAAAGGTGGGCATTTTGCGTTTGTTCTCGATTTGGTTAAGTTCTAGCGTTCT
CTCAGCGTCCCAAGCGCTCCGCAAGTGTAGAGGTATAATGCCTGCACCACGTGTTGCCGT
CTATTTGGCTGCCGGCCCGCTAAACCTCGGAGGTAAATTGAGTTTTACCCACACGTGCAA
CGCAGCGGGCAAATAGTGAATAAAAATTTGAATTAATTTGTAGCGAACCCATAATGGACT
TAATCAAATAGTCTATATTACTAAGCGAACGTGGCGTTGATCAATACCAAATTTAATATC
GTTTTTCTCTTTCTTTGCATGCTGCTTTTCCTACTGCTGATTTTACATGGATCTTTTCAA
TAAAGGTAAGAACACGTGTGGTCTTAAAATGCGTGATTAATTCTGTGATGAATGATTGAG
CAGAAGAGTTCTTGAAGACTATATTCATCACCCAAGACTGAATATAACAGAAATATCGTT
GTCTTTTATTCAGAAAAACATAATCTAACTGCCGACTTTCTTTTTGTTCCATGTTCACCT
TTTGGCTGTGTAATTTATTGATTTTCCTTTAAAGGTAAGCATATAAAATGTGTTCAAAAT
CCTTATTTTTGTCTTAATGAGGATTGATTTAGCAGAAGAGTTCTTGAAGACTATATTCAT
CACCCAAAACTGAAAACGTTGCAGTTCTTCAAGAAATTAATATAGAAATTATTAATCTAA
TCACGAAATTTGTTTTTATTTCATGTTCCCCTTTCTTGCTTGCGTTTCTGGCGATTTGAT
CAAAAAGGTAAGCATTAAAATCTATATTGAGTACTTCAGTTGTGGCTTAATGAGGATTGA
TTTAGCAGAAGAGTTCTTGAAGACTATATTCATCACCCAAAACTGAAATACCTTTGAAAA
ACTTTAAATATGGCTTTTTCCTGAGCAATTACTAATATGTTCTTAACTTCTATTCCAGAC
GTGAGATGGCAACCTCTTCGCACCTCAATTGGTTGATCATTCGCAACAACAACGCCTTCT
TGTTGAAGAAGCGCGATGTGAAGAAGCCCTTCAGCACAGTAAGTAAATATGGATTTAAAT
AACGTGCACCACATTTAAATGATGTTTCCAACTTATAACTTTCACAATGATATTTGAATA
CAACATGATAGTAACTTTAATCTGATAAAAGTTGGCTTCATCACTACTATGATATGACAA
GCACATTACTGACTTCTAAATCCCTTCCAGGAGCCAAACAACTTGGCCAGCGTGAGCTCG
TACCGCTACAGCGGCATCGTGCACAAGAAGACCCTGGGAGTCGTGCCAGCTGCCGACAAG
AAGGGCTTCACCGCCGTGCTGAAGAAGGGCAAGTATGCCCAGCGCCCCGCCAAGAACACC
GTGCGTGTTGACTTCAAGGCCGGTCCCCGCCGTTCCCTGAAGAAGCTGAAGAACCTGCTT
ATCGGCTCCAAGTACCGCAAGGACCTGACACAGGTGATTATGGCTCCAAGCCTAGAAACA
ACTGTTTGGGTTCTTGTCATGATGATCTTTTTTTTAATGCTACACAACCAAGATCGCAGA
ATGATCGTGTTGATAAACTTATCTGAAGCTCTCAAAGCTGAAGCTTATCGTACTTCAGTG
TTAGGCCTATTCTAATGATTTTACTTGTGCTTATAGGCTGCCCTCCGCCGCGCTTCCGCT
GTCCTGCGCTCCCAGAAGCCCGCCCCCGTCAAGGGAAAGAAGGCCGAGTTTGCTAAGGGA
AAGAAGCCCGAATAAACTGTACCAGATTGGGGCTATGCGGAGCTGTTTTCTACTCGAGAA
TAAAGAAAAAATATTAAAAACACCGTAATATTAATACAGTTCTGTGGTTATTTGTCGATA
ATGGGTAGCGACCAAGTACTGCATACTTTGGGGCGGTAGTTATGAAATTTTCTATAACCA
TGAATGAGCTTACCATATATATTGTTGCTTATTAAACGACAAACTATATTATTGTTGATA
CAAAAGGTATCTTTAGATCAATCAATCTTTGTTTGCCTAAATGATTCTCACTTTTATTGA
ACTATTATTCCTGGGATATGGATGACGTTACACAGAAAGAGACCATGGAATTGCATTGAC
GGTTACACGAATAAAAAGATCAAGTAAGAGCGCTATAACTCTAGTCAAACATATATCGCT
GCTTATAGTACGCTACACGTGGATTTTAAATGCGCATTGAGCTTGGCTGCTATACACAGC
CTCAGTAGAAGTACTCGTACTTCTGGGCGTGGTGCAGCATCACCTCCATCGACTTCTTGC
CCTGCAGGACCCCATTTCGTTCCATATAGTTCCAGATGGAGGCCATGAAGACGCAGAACA
GGATCACGCCAAACACGATGAACTTGAGCAGCAGAAAGATAGTGCGCATGCCCACGGGGG
CGGTGAACTCCACCAGAAGGACCAAGAGGACAAACAGGAAGGTGGCGGCGCTGTAGTACA
GTATTCGATCAGTGTTTAACTGCAGCAGGGAAGCATCGCACAGCGCCAGAGCTTCAAGAA
GGGCAGCAGTTCTAGCGGCGGGCATGGATTGAATGGAAGTGGAGCTTCCATTGCATTGGA
TCTCCGGCTGGTGTTGTGATGACTGATCGTCCTCTCCTGTCAAAGCATCCCCTGCTCCTA
CTTCCCTCACGGAACAGGTTTCACCATCCTCTACCAGGCAGTTCACCTCGATCGTTGCCA
CTGGCTCCTCACTTCTAGGTTCCAGCTTGAATAACTTCAGCTTGGCCATCACCGCCTCGT
GGTCGGAGAAGCTAAATTTCTCGCCGGGTACTCGCTCCGGAAAAGGCAGTTTGTATTCGG
CTATCTCAGCATTTACATGATCGCCACCACGCACAAAGATGTGATCGATACGGATACCCA
GAGGATTTCTCTCCCGTGCTTGCTTAGATGTGTATGAGTTGTGTTCGCATTCGTTGGTCC
GAAAAGAGTCCGAGTCGCAGCTGTCGAGCATCTTGGAGGTATAGAGCAGCACCTTGTAAG
AGATGTCCTGTGGCTGGGCATTCAGGTCGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1978..2077, 2250..2492, 2676..3049
1985..2077, 2250..2492, 2676..2771
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved