Drosophila_melanogaster Locus CG13900
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG13900
Drosophila_melanogaster
CG13900
3L
snoRNA:Psi18S-1086, snoRNA:Psi28S-3308, snoRNA:Psi18S-110, snoRNA:Me28S-A771, snoRNA:Me5.8S-G74, snoRNA:Me28S-G3113a, snoRNA:Me28S-G3113b, snoRNA:Me28S-C788a, snoRNA:Me28S-C788b
1194..1341, 1764..1916, 2395..2533, 3892..3966, 4411..4481, 6560..6639, 6783..6866, 7020..7091, 7259..7328
8693
GTAGTAATCACCTTGAAGGAAAATGCTTTTACTCAATGTTTTTATCATGAAAAATAGGC
AAACAAACCTTATTTAGAAATTTGAGCTCTTGCTGAATTTTTCGCTGTACTTTGCTGACA
CCAGGCAAATCTTCGAAGTCTTTCAGCGCTTTCTTCAGCTCCTCGCCCAGTTTTACTTTC
TTGTGGGCTTCTTCGTAGAGCTTTTCTCGATCCTCTTGCTCCTCCATATTAAAACGTTAG
CAATATTTACAAAAATCACGAAATATTTGTTTTTAGCTGTCAGCTGTTTTGAAGAAGCAA
AGATGCAATGACATTTCAGGTTTTACAACACTGACAATTCCATGACTGATTAGAGATGTC
GCGAATCTGAAGTTGGTATATCGATAGTCAACAAACCTAGTTTACTAAGTAATAATTGAT
GATTTTTCTAATTAGTCTAATAACATGAGCCAACGCCGCGTAAAAATATACTCAAGTAGA
GATCGAATAAACAGAAAAAAATAGTTGGGGACTGATCTATTTATTTTTTTTAAATACCTT
TAAAGTTTTCTCCTTAATCATACCTTAATAGCATAGTATTGAGCCCAGCCCTTTAGCCAC
AATTCGGTGAGTGGTTTTGTTTTCATTTAAGCCCATGATAAAAATTTTTTAAGTTAAAGA
AAGATAAAACGATTGATCCAGTACATATTTTTACAGATCCTTGAAATTTTCCATTTTTTC
ACAGAAAATTGCATATTATATGTTTAGCTTTTGAGGCAGTTTTTGGTATGTGGAACTGGG
ATTGGCCCATGGCAATTTCCGAATATTTAAATGTGGTATATTTAATAAAGGATAAATTCG
ATATATCTTGACCAGGATTTTTAGGAAACTTATGATTTCTGCAGCAACAATTTCCAGTAA
AATAATTATTTAATTTATAATCAGTCTGAACCGGGCCTATTATCGATAGGAAAATCGACG
GCCGCGCACTATCGATAAGTCAAGCCACATTTTATGCACCACCATTTTTACTTTTATAGT
TCTTTTACTTTTTGTCGGCGAACAGAGCAGATGTGAAAATGAAGAGTTCTGAGTAATCAG
GAAAATTCGAATCCAAAGGCATCGCTGGTGAAATGTGCTAATTCATCCATTTAACCAGCC
GAAGGTAAACAAATACACGTGCTAGCACTGATATCTACTATTATTTAAGCGCTTTCCGCA
CGAAGTATCTCCAGAAATCAGAAATGTCTGTGCTTTGGTCGCATTTGAAGCGTGCTAAAC
TAAGAATTAAATGCTGCTTACTAGCATCGTTAGGCGACACGACTTTCCATACTGTGGCCA
TGGTTTTCAAAGTAGTACAAATTCACAAAAAAAAAAATACACCGCCATTCACGTGACTTT
TTCCCTTGTCTGCAACTGTACCTAACCTCAACATTGCTTCTCTTGCAGTCGTGGACAAAA
GTGAAAGAGTGTAGTGCTCCACCATGTATCTGTACAACCTGACCCTGCAGAAGGCCACCG
GCGTGACCCACGCGGTCCACGGCAACTTCTCCGGCGGCAAGCAGCAGGAGGTCCTCCTGT
CGCGTGGCAAGTCGCTGGAGCTACTGCGTCCGGACTCCAACACCGGCAAGGTGCACACCC
TGCTCTCCACGGAGATATTCGGATGCGTTCGCGCCCTGATGGCCTTTCGACTGACGGGCG
GCACTAAAGGTGAGTCTTTCAATTGTAATTTAGTTTTGTACCATCAATTGGGAGTAATGT
ATTGCTCCTATATAATCTATGTAAGTCGCACAAATCCCTATTGAGGCAACAGACGGCTAG
TTGACCCCAGTAAGACCTTTGAACGCGTCTAAGTGCGAGAGAAACCGAAAGACTTGACGT
CGCATTTGCCATAAACCAACTCAACGGAGTGGCGAATTGAAACTTCGAGTTACAAAGTCA
ATAAAATATCATTATAGTCATTAGAAAGTGTTAAATGTATGACCCTAATCTCGAATATCG
TTACCTTGCTTTGCAGATTACATAGTTGTGGGCTCGGACTCGGGACGCATCGTGATCCTC
GAGTACAATCCCTCCAAGAATGCTCTTGAAAAAGTGCACCAGGAGACGTTCGGAAAGTCG
GGATGTCGCAGGATTGTGCCTGGGCAATACTTTGCCATCGATCCTAAAGGAAGAGCCGTG
ATGATTGGCGCCGTGGAGAAGCAAAAGCTGGCCTACATCATGAACCGGGACACGCAGGCT
CGCCTCACGATCTCATCGCCCCTGGAGGCCCACAAATCGAATACACTGACATACCACATG
GTCGGCGTGGATGTGGGCTTCGATAATCCCATGTTCGCCTGCCTAGAGATCGACTACGAA
GAGGCCGACATGGATCCATCGGGTAAGCATCAACTAGGTGGCGTGTAGACCCTAGAAGGC
GCTTTAATTCACAGGTTTAGTGGATCCACACCACGAACACTGACTGTACTTAGTGCCAGA
TAAATCGTGATCACTGAACCATTGGTGTTGCTGTAATTGCCTAGCCACACTTCACTGATT
TGTGACCCACACTTCCTAATCTCAATTGATAACATTTTGATAGTACAATGCTATAGTCCT
GTAACTAATCAGTGTCGCATCTATTTGTTCCAGGTGACGCCGCCCAGCGCACTCAGCAAA
CGCTGACTTTCTACGAGTTGGATCTCGGCTTAAACCACGTGGTTCGCAAATACTCGGAGC
CCTTGGAAGAGCACGCCAATTTCTTGGTATCCGTGCCTGGGGGCAACGATGGTCCTTCGG
GCGTGCTGATCTGCTCGGAGAACTACCTAACGTACAAGAATCTCGGCGATCAGCACGATA
TCCGCTGTCCCATTCCGCGCAGGAGAAACGATCTGGATGATCCCGAACGTGGTATGATCT
TCATCTGCTCGGCCACACATCGCACCAAGAGCATGTACTTCTTCCTGCTGCAGACCGAGC
AGGGAGACATCTTTAAGATCACCCTGGAAACGGACGATGATGTGGTCTCCGAGATCAAGC
TAAAGTACTTCGATACAGTGCCGCCGGCAACTGCCATGTGCGTGCTAAAGACGGGTTTCC
TGTTCGTGGCCAGCGAGTTTGGCAACCAGTGAGTATCTACAAATCATTCATTTGAGAATA
ATATGAATGGGTACTAATTGAGGTATTTGTGTAACCCTCAGCTATCTATATCAAATCGCT
CATCTGGGTGACGACGATGACGAGCCGGAGTTCAGTTCGGCCATGCCTTTGGAGGAGGGT
GAAACCTTCTTCTTTGCGCCACGTGCCCTAAAGAACCTGGTGCTTGTGGATGAACTGCCC
TCTTTCGCACCGATCATCACCTCCCAGGTGGCTGATCTGGCCAACGAGGACACACCGCAA
CTGTACGTTCTTTGCGGACGAGGACCGCGTTCCACTCTGCGGGTGCTGCGCCACGGCCTC
GAGGTGTCCGAGATGGCCGTTTCCGAACTGCCTGGTAATCCCAATGCGGTTTGGACTGTG
AAGAAACGAGCTGATGGTGAGTGTGTCTGCGGGCATTAATCATGATTCCTAAGCTAAGAT
TAGACTAAGACTGAAACGTGGCTAATAACTCAACTGGTGCATTGATACAGATCGAGATAT
AGATTACACCTAGCTTTACGCACGATTCCAAACAAGTCCCACAAGTTATCAACCACCAGT
TCTCTCTTATTTCAGGCGCTTAAACACAGACGGCAATATGTGTGAACTATCGAAAAAGAC
AAGCGATTAAAGAGAATTTCTCTCGTTTGTGTAATTTTAAATTGTCTTTTGTGAAGCGAT
AGGTAAGGCAACATTTACTGCAGCTCATAAGTCAAACAGATACTACAACTACCACTGCTA
CTATACCAATGAAAACAGAACAAAAGCTAACTATATTTAAGCCAGTCGGACATTGAACAT
GATGCGATATTTATCAACCGTGTTTCAGCTGAATTATCCATTGATTACAACTTGATAAAC
TGATTATTCAATGTCTTGTGTGATACGCAGATCTTTTTCGCTTGCTCGATTCAAACTGAA
GTACTCACGTTCCAAGTATTGTTTTGCTCCCCTATTTTTTAGACGAGTTTGATGCCTATA
TCATCGTGTCCTTCGTGAATGCCACCCTGGTTTTGAGCATTGGCGAAACCGTCGAGGAAG
TCACGGACAGCGGTTTCCTGGGCACCACGCCCACGCTCTGTTGTGCCGCCCTGGGCGATG
ATGCGCTGGTTCAGGTTTACCCCGATGGCATTCGACATATCCGATCCGACAAGCGTGTGA
ACGAGTGGAAGGCTCCGGGCAAGAAGTCCATTACCAAGTGCGCCGTGAATCAGCGCCAGG
TGGTCATCACCTTGTCGGGCAGGGAGTTGGTCTACTTCGAAATGGATCCGGTAAGCAATT
CTACTACTATATTACACTCAACTGTTGACTTCTTGCTCTGATGACAAAAACACGAAAAGA
ACAATCATGTTGAGACACTATGTGTCCTGCAGTGCTGAGCTTCAAAATCAACCAAAAGCC
TTATCCTCGTTTACTTAACTTCACAACTAATGAATACATTTTATGCTTGCAGACTGGGGA
GCTGAACGAGTACACGGAACGTTCCGAGATGCCTGCTGAGATTATGTGCATGGCCTTGGG
AACTGTTCCGGAGGGCGAGCAGAGATCCTGGTTCTTGGCCGTCGGCCTGGCGGATAATAC
AGTGCGCATCTTATCGCTGGATCCCAACAACTGTCTCACTCCCTGCTCCATGCAGGCCCT
GCCTTCGCCAGCCGAATCCCTTTGCCTGGTCGAAATGGGTCACACGGAGAGCACGACTCA
GGGAGGTTTGGATGACGATGCTCCCGCTCAGCGCAGTGGCAACAATAAGGGAACCATTTA
CCTAAACATTGGCTTGAGCAACGGTGTCCTGCTGAGAACTGTGCTCGATCCTGTTTCCGG
AGATTTGGCAGACACCCGAACGAGATATTTGGGTTCCCGACCCGTAAAGCTCTTCCGGAT
CAAGATGCAGGGATCCGAAGCGGTGCTGGCCATGTCCAGTCGAACCTGGCTGTCGTACTA
CCACCAAAATCGATTCCATTTGACGCCTCTGTCTTATGAAACCCTTGAGTATGCTTCTGG
CTTCTCGAGCGAGCAGTGCAGCGAAGGTATCGTGGCTATATCCACCAACACCTTGAGGAT
CTTGGCCCTGGAGAAACTGGGAGCCGTCTTCAATCAAGTAGCGTTCCCCTTGCAGTACAC
TCCACGTACCTTTGTAATCCATCCGGATACGGGACGCATGCTAATTGCCGAAACCGATCA
CAACGCCTACACAGAGGATACGAAGAGTGCCCGAAAGGAGCAAATGGCGGAGGAGATGCG
CAGTGCAGCTGGCGATGAGGAAAGGGAGTTGGCCCGCGAAATGGCCAATGCTTTCATCAA
CGAAGTCCTTCCCGAGGACGTGTTTTCGTCGCCCAAAGCAGGACTGGGTCTTTGGGCCTC
GCAAATCCGTTGCCTGGACGCAATGCATGGTCAGACGATGTTTAGTGTGCCGCTCACCCA
AAACGAGGCCATTATGTCGATGGCCATGCTGAAGTTCTCCATAGCGGCTGATGGCCGGTA
CTACCTGGCCGTGGGAATCGCCAAGGATCTGCAGCTGAATCCCAGGATTTCGCAAGGCGG
CTGCATAGATATCTACAAAATAGATCCCACTTGCTCCAGTCTGGAATTCATGCACCGCAC
GGACATTGACGAGATTCCTGGAGCCCTGTGTGGCTTCCAGGGTCGTCTACTAGCTGGCTG
CGGTCGAATGTTGCGAATCTACGATTTCGGCAAGAAGAAAATGCTGCGCAAATGCGAGAA
CAAGCACATTCCCTATCAGATTGTCAATATCCAAGCCATGGGTCATCGTGTTTACGTGTC
GGATGTTCAGGAATCAGTATTTTTCATACGCTATCGTCGCGCGGAGAACCAGCTGATTAT
ATTTGCCGATGACACGCATCCTCGATGGGTGACGGCCACCACCTTGCTGGACTATGATAC
CATAGCCATAGCCGATAAGTTTGGCAACCTGAGCATTCAGCGATTGCCCCACTCCGTAAC
GGACGATGTGGACGAGGATCCAACGGGCACCAAGTCTCTGTGGGATCGTGGCCTGCTGTC
AGGTGCTTCACAGAAGTCGGAGAACATTTGCTCCTTCCATGTGGGCGAGATAATCATGTC
GCTGCAGAAGGCAACGCTAATTCCTGGAGGATCGGAAGCCCTTATATACGCCACGCTAAG
TGGCACTGTTGGAGCATTTGTTCCGTTCACCAGTCGCGAGGACTACGACTTCTTCCAACA
TCTGGAGATGCACATGCGCAATGAGAATCCTCCACTCTGTGGACGCGACCATCTCAGCTA
CAGGAGCTCGTATTATCCGGTCAAAAACGTACTCGACGGCGATCTCTGCGAGCAGTATCT
GTCCATTGAGGCAGCCAAGCAGAAGAGCATAGCTGGCGACATGTTCCGCACTCCCAATCA
GATCTGCAAGAAACTGGAGGATATTCGCACGCGATACGCCTTCTAAGGTGAGTTGGAATC
GATATGCCTATGGGACATAGGTTTTTGTGATGACATAGCTATTTTACCTTGGGACACCTA
TGAAATGCCTTGATTAGCGTAAACGTCAATATCTGATAAATACTTTGCTGAATTTAGTCT
TTTATGATTATTGAACAGAAAGCTAACAATTGTTTATATTTTGCAGATGCCAGCAAAGGA
ACACTTCAATATCATGGAAACTTTTCTTTTTTAACTAGGTAAGTTGGTTTCTATTTATAG
TTGTTTTCAATGATGATTTTCGAGTTTTACCTTGGGACACCTATGAAATGCCTTGATTAG
TGTAAAGTTATGTTTTTCTGATAACAAATTCAAGCGTTTATTGATTGAAAAGCAAAGAAA
TGTTATTAATTTTGTATTTCTCTTTCTATTGCAGTTTTCGTGGGCAAAACCAACAAACGC
TGCACCTAAAACGTTTTAAAGGTAAGAAATTGTAACGATTAAGCCACATTTTCGTTGAGT
TAAACAATGATGTTATTTTACATATGTTAGACTAATGAAATGATTTGATTGTAAATTAGT
AACTGAGAATGTTTTTAAAATTAAAAATTTCAATACTTATTTATGATAATTACTGGATCG
ATTAGTAAATTGATGCTTTCTTTGCAGTTTAATCGGAAAATTCCAATGACCATTAGACCA
TTACATTAGGAACACTTTCAAGGTACGTAATATATATTTAAACCACTTCAATTTAAATAA
GCTCTATGATGTTATTTTACATATGTTAGACTAATGAAATGATTTGATTGTAATTTAGTA
ACTGAGCTTATAGCTATATTTCACTGTGTTTAGCATTTTAATCGTGGTTAAATCATAACT
AATTTCCTTTCTTCACTTGCAGATCTTCTTACGTTGGGGTATGTTGTGGCGCTTAATTCT
AACTAAATTATACACTAGGTAAGTGATTAAACAAACAGTGCGCTTTGAATTGAAACTAAT
TCACAATTTCCTTTGCAGATCGTACATCTATACTAACTGCACATTAAATCACCGATCAAC
CACTAATCGACTGCCGCATATTTAAACTAGCATATAAGTCAGTGCAAACTCGACAAATTG
CACAACCTAAATATAAACCCCTAATCATAAGCAATTTTTAACTTAAATAAAAGTAACTGA
AAACAAAGCCAAGAATGCGAGGTGATTTTGTTGTGTGGTTCTGGCGGAGACGACGACACG
CTTTGCATAATTCCATTTGAAGTTCGCCTGTCTTGTTGCGGCCTGATTATGGCCATTACC
ATGTGTCTTGGCCATTACATCTCGGCCTTGTTTGCACTGCTCTTCATTTTCCCGGCACGG
AGAGTCCCGTTATGGGACAGATAGGCAGATATTTGCTAAACGCCTCGCTTTCCATCCATC
CGCCCGGTATGTACATACGCAAAATCGTTGTAATTTGTTATGTTTGCGGCATAAGCACGG
TAGTTATGCAAATTGTCTGTCGGCCCGGTGGTCGATCACTTGCTGCTCCCAAACGAGGCG
AGTGGGGCCAGAAATGGCAACTTGGACTTTTACTAGCCAACGCTCAAGGCGGAGCAGCAT
TATTGGTCTGGATCACCCAGTTTAGAAAGTCAAAAGAAATATAATGAAAATCAAAGTAAG
AGTGTAGAATTTAAAGGTATAATACCTTGTAAATTGGTTTCAGTAAATCAATTTGTGCAT
CCAAAATATATAGTATCTATAGTATCCATAAAATCGGACATCTCTGACATTCCATACTGT
CTCGTTCCTGAAAATCCACAGAAGCAGCCTTGTTTGCGATCTGGAAAAGAGCTGTGCCAT
CTGGCTAAACGATTTATTAACTTCATTTCTAGATCATTAGATCGCATAACACGGACATTC
GTCACTTGGCACTGGTTTTTCTCGGCTAGCCTCTTTTTTGCCCGACTGGCACGCAAGTGC
AGTCTGCAATCTCCAATCTCTAGGCAGCATCTACGCATGCGATTCGCGCCGCCTTTCCTG
TTCAGCTCCGCGATCTGTGCCTTCGATAAGGACAATCAGCGCTTGGCGCAAACACTTGGC
ACCCTTGGACAAAGGGGTGGAGGTGGGGAATGGATGGGGAGAACAGCCAGCCCTGCAAAC
ACCTGCCACGCCCCTTCTGCGGCGCCTTGAAGCAGTTGCCATTTCTTCTGGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 1428..1688, 1996..2361, 2613..3087, 3161..3495, 4062..4369, 4552..6526, 6706..6757, 6934..6980, 7167..7221, 7402..7457, 7518..7693
1463..1688, 1996..2361, 2613..3087, 3161..3495, 4062..4369, 4552..6522
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved