Drosophila_melanogaster Locus Tudor-SN
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Tudor-SN
Drosophila_melanogaster
Tudor-SN
3L
snoRNA:Psi18S-996
3426..3576
7093
GTGCAGCAGATTCCGGTTCTGAGAATGATCCGCCGCCAGCGAAGGGTAGGGATTGCCCC
GAAGCTCCAGCACAGACCGCCTGTAGTAAATGCCAGGATACTCCCGAGGGGCTTTGTACA
TGCGAGTGTAGGACACATTGTAAGTCTCATAGCGCGGTACCAGCACCTTGAAGAGCTTAT
GAACCAGTTGCTTTTCCAGCAGCCAATAGTCCGCCAGTTCCATGGTGGCTTGGTGTCGGT
CCCCATGGCGTATGGCATTGGAAATGAGCTGCGAGGGGAGGAAACTTTATTTGGATTCCA
GCCTTTGGCGTATCGCCGGTGGTCTCTTACCAGTTCGGCGTAGCCACGAGCTTCATCGGC
ACGGTTGTAGAACAGTTCAATACGCTCGTGCTTCACCAACGCAGTGACGGTCTTACGCAG
CTTCAGCAGCCGACCTTCCGGGCCATCGACATTCTTCAGATGGCGCTTGTTGGGCCTGAC
CGCTATACGCAGCTGTGACATGAGCTTTGTTACATCGGCTTGATTCATTTTACTCGATTT
TTAGCAATGTTACAAATAGGAAATCACGTAACATTCGCCGAACAGCTGGCGACCATTTAT
CGATAGCGATACTCTTTTGGCGCCTGGATCTATCGACACTATGGCCTGCAATGTGAACAT
CTAAGGCTGCCCCCACAGATAAATTTAAAGTAAACATAATATAGATATGCACTCGTTAAG
CGAATTAAAATTAGTTTTGAAATGAAACAAAAAAATCTAGAATTATTGGAAATTCCAAAG
TTCGTCTGATAAATTACGCATAAATACAATTAAAATAAATATGAATATATAAAAATTCCC
AATATAAAGGATCCCAAATCCCTCTCAATTTTACCGTCATTCATATTTTTTGTAAATTAA
GTTGGCAATTAAGAAAAATGTTTAGCACTACCTATCGGATGACAAGCGTGTCACGAAAAT
ATCGATGCTATCGCGCTGACTTCTCAGCTCTAGCTAGCAGTGTCACTTCAGTGAAAATTT
TTTAGATTTTGAGAGCGGTTCTTCTCTTGGTCAAACTTCATTAGGTTGAAAGCGGTGTTT
AGCTCCGAAACGCAATCAACGCAATATTCCGCTATTGAAGCCTAGTGCCACGGCCCTCTG
CTAGTATCTCCCCCGCATTCAATAAAAAAATGGCAACAGCAGCGAACACCGCGACAGCTG
CCGGAGCAGCTAAAGACGCCCCGCCAGCGCCTACAAAGTCGTTGTCCGGCATTGTAAAGC
AGGTAAGTCGGATTGGTCTGCGGCTCTGGGATGAAACTCGTGGCTAGGATTTCAGTGCGC
AGACTCCTTGAAAAGAAAGTTCGTCCAAACTAAGAGGTACTATCCTCCTATCGGCGTGGC
AAACGCGGCAGCGCCTACCAAAGCAGCTCTAGTGCAACTCTGACAAGTGCGAGTGAGACG
CGTATAGACTCTGTGCGTGTGTGACACGTTGCACACGCTGTCCGATCCAAAGAAATGAAA
GTTATCGTAGGTGCCAAGCTGGCAGATTTTCTTCGACGCGGTGTCTTTGGCGGTAGATGT
TCTGGCTGTTGTTGTCACAGAGGGACAGCTAACTAGTACGGCCCCATTTACCGGCATTAT
AAACCATCTATTGCAAAGCTGTAGTTTTTTTCGCCCGCCCACACACTTGCTGAGAACTGA
TTTGTGTGCCGAACGGTTCGTTTCTAACCTCCTTGGCGTATACGGAGACCGTGTCCGGCG
CCCAATGCTGATAATTGTCCCTGGGAGTGGGTAGTTCATCATATACTTTTACTTCTGGGT
GGCTTTGTGACCAGCGCCCAAAGATTACCGGCTGTTTTCAGTCAGCACTTTATCCAACGA
CTCTGATAACAACTGAGTTTCCAGCGGCTGTAGAGATTTACAGGCGTAATCTGATTTGGT
GACGTTGGCACCCTGCAACCAAAGAAAACATCCCGAAATTCATTCAACCTTGCATTTGGA
TGATTCCCATTTTCAAAAAAACCTGTTGCTTTTACAGGTAATATCTGACGCCCTTATCAG
TAACACCTTGCATGTTTTCCCTTGGACATTTGGTATTTGCTCCCAATTACAAGACCATTA
TTTTCTTTTTATGTCGATTTTTTGTATCTAGAAGAGATTTGAGCTGCACTCTTGCACGTT
GCCTCCGTTTTGGGCACCCTAAACCGGTTTGGCAACAATTTTGTTTTCAGTTGGATTAAC
GGAATGCATTTGCAGTACGAATAAATTCAATAAAATACCGTTGCTCGCATTTTCCATAGG
ACAAACCAAGAAGATTTGTGCGCAGGCGCTGTCTATGAGGAACTGTTATGTTAGTTAAAT
AGCACGTCCTTGCTCAGCAGAGTTCATTTTTATATGTAAATAATATCAAAACAGCTAGAA
AGTAGTTTTCCTTTTTACGTGAGCCGATCTAAAATATTACATATATCGATAGTGTGTTTG
GTCGCTTAGGACCCAGATCCAAAAGGGCAATCGATACTATTCCACCTCTAGTGACCCCAC
ACGTGCATTTTATTTTAACCTCACTCCTCGCTCTGATTCAGGTTCTCTCCGGCGATACGG
TAGTTATTCGCGCAACTAAGGGTGCCCCGCCTCCGGAGAAACAAATTACTTTCTCGCATG
TCCTTGCCCCGAAGTTGGCCCGTCGTCCTGGCGCTGGCGGAGACGAGACCAAGGACGAGC
CCTGGGCTTGGGAGTCGCGGGAATTCTTGCGTAAAAAGTTGATAGGTGTGGAGGTGACTT
TCACGTTTGACAAGCCAGCCAACTCGAACCGGGAGTACGGTTTTGTGTGGATCGGTAAGG
ACAAGGAAACCGGTGAAAATGTGGTCGAGTCGATTGTCCGAGAGGGCCTGGTGTCGGTCC
GTCGAGAGGGACGTCCCACAGCCGAGCAGCAAACACTCATCGAGTTGGAGGACCAGGCGC
GTGCAGCAGGCCGCGGAAAATGGTCGCCCACCGCAAGTGCCGCCGACAAGGTTCGCAACA
TCAAGTGGTCCCATGAGAATCCCGCACACCTGGTCGACATCTACGGAGGAAACCCCGTGA
AGGCGATCATCGAGCACGTGCGCGATGGATCCACGGTCCGAGCATTCTTGCTGCCGGACT
TCCACTACATAACGCTAATGATTTCGGGCATCCGTTGTCCAGGAGTGAAATTAGATGCTG
ATGGCAAGCCCGACCTCAGTGTAAAGGTGCCTTTTGCTGACGAAGCTCGCTACTATGTGG
AAACCCGCCTGTTGCAACGCGATGTGGAAATCCGACTGGAATCGGTTAACAACTCTAACT
TCATTGGAACTATTCTGTATCCCAAGGGAAACATTGCAGAATCACTCCTGCGAGAGGGAC
TTGCCAAGTGTGTGGACTGGTCAATGGCTGTTATGAAGACAGGTAAGACCAGAATCAAGT
TAAGTTCGCAGCTCGCTTGCACAGCACAGCACCAAATTGGTAAATAACCTATCGTCGTGC
TGTTTACTGTTTGCAATCGGCTGCCAGAAAAACGACGGATTCCAAGAACTTTGCGACTGA
TTATTGTCGCTGCGTTCATTTCACCCCGACGACATTGCATTTTATTAACAATTTTTCGTA
TTTCAACTCTGACTAATTCGCTTTTCTCTTCAGGCACCGATAAACTGCGGGCTGCGGAGC
GTTTTGCCAAGGAGAAGCGTCTTCGCCAATGGCAGGACTACCAAGCTAAAACTCCTGCTT
TCAACTCGAAGGAGAAAGACTTCTCTGGAACAGTGGTGGAAGTCTTCAATGGCGATGCTA
TTAATGTACGTCTTTCCAATGGACAAGTAAAGAAGGTTTTCTTCTCGTCTATCAGGCCGC
CGCGTGACCAACGCGCGGTTGTTGGCACCGATGGCGAGGAAATCGTCAAGGCACCACCAC
GCGGAAAAAACTACAGACCACTTTACGAAATTCCACACATGTTCGATGCCCGTGAGTTTC
TGCGTAAAAAACTAATTAATAAAAAAGTTCAATGCAACCTGGACTACATCTCACCGCCGC
GCGAAAACTTCCCTGAGAAATACTGCTATACCGTCTCTATTGGCGGTCAGAACGTGGCTG
AGGCAATGGTAGCCAAAGGTTTGGCAACATGTGTTCGCTATCGCCAGGACGACGATCAGA
GATCTTCCGCCTATGATCAATTGATTGCCGCCGAACAGCAAGCCATCAAGGGACTAAAGG
GACTGCACGCAAAGAAGGATAACGCCACACTGCGTGTTAACGACCTGACTGTTGATCATT
CCCGAATTAAAGTTCAATACTTGCCATCGTGGCAGCGTGCTTTGCGTACTGAAGCCATTG
TAGAGTTTGTCGCCAGCGGATCCCGCCTCCGAATCTTTGTACCGAAGGACAGTTGCCTGG
TAACATTCCTGCTTGCTGGGATTTCATGTCCGCGTTCCTCTCGTCCAGCGCTTAATGGCG
TTCCTGCCCAAGAGGGGGAACCATTTGGCGACGAGGCTTTGACCTTTACCAGGGAGCGTG
TCTTGCAACGCGACGTTTCTGTTCATATCGATACCACCGACAAGGCAGGATCTTCAGTGA
TTGGTTGGCTCTGGACGGACAGCGGCGCCAACTTGTCAGTTGCTCTTGTCGAAGAGGGTC
TTGCTGAAGTGCACTTTAGTGCTGAAAAATCTGAATACTACCGCCAGTTGAAGATTGCTG
AAGACCGTGCCAAGGCCGCCAAAAAGAACATCTGGACAAACTACGTAGAAGAAGTGCCTA
AAGAAAAAACTGTCACCGAGGAAGAAAAGGAGGACAAGGTAGTGGCGGAGCGTAAAGTCA
ACTACGAAAACGTTATTGTCACTGAGATCACCGAAACTCTGACATTCTTCGCGCAATCTG
TGGAGAGCGGATCCAAGCTAGAGTCGCTTATGAGCAAACTTCACGCCGATTTCCAGTCCA
ACCCACCCATCGCTGGATCGTACACGCCAAAGCGTGGTGACCTGGTGGCCGCTCAGTTTA
CACTTGATAATCAGTGGTATCGTGCCAAGGTGGAACGCGTGCAGGGCAGTAATGCTACAG
TCCTGTACATCGATTATGGAAACAAGGAGGTAAGTGTCGCTTTGACTAACATTTAAATTA
CTGCAAGTTCCTTAGATCCGTTTCCGGCTTGAAGTGAAACGCATGAGTCATAAGCTTGCC
ACATTAAATAGGCTTCATCGAATGATTTTATAAGATTCGTGATGGCGTAAGCAAACCCTA
CAGCTGCGTTAAATGCGTTCGCCGTTTCAAGTCGTGTGGCATCCTCTTCAACGGTGCAAA
GGTAGTTCCATATTTTTTGGGTCAACCATTGTCCAAAGTAGCAGGTTTAAAATACGCGAG
AAACAAGAGCACTGAGTAGCTGGGGGCGCCAGAACCACGCTTCAAAAGTATTCGAGTTGC
GACACACTCATACCAAAACCATTGTGATTTTTTCCTGGCAGTATTAACACTCGTTTCCAT
TTTTAGACACTTCCGACCAACCGTTTGGCAGCCCTGCCACCAGCCTTCAGCAGCGAAAAG
CCCTACGCTACGGAGTATGCTTTGGCCTTAGTCGCCCTGCCAACTGACAACGAAGATAAG
GAAGAAGCCTTGCGTGCCTTTTCCGAAGACGTTTTGAACCATAAGGTTCAACTCAATGTC
GAGCTAAAGGTGACTGGGTCGCCGAACTTGGCCACTCTTCGCGATCCAACTACTAAAGTC
GATTTTGGAAAGCAGCTTGTAGCCGAGGGCCTTGTTCTGGCCGAACAGCGTGGAGAGCGG
AAGCTCAAGGAACTAGTGGACCAGTACAAAGCCGCGCAGGAAGCAGCTCGGGTCGCGCAT
CTGGCCATCTGGAAGTACGGTGACATAACGCAAGATGATGCGCCCGAGTTCCGCTAAAAG
ATGCCCGGAAACGTGGAGTAGGCCTGTGGCGTGGAGCGCGTTGCTAGCCGAAAAGATTGT
CTGCCACATACCCGCCCTTTATATACATAACAACAAGCAAGAACTTAAAGAATATGAAAT
TACTAATTCTATCTATACACCAATATATATGATACATATACCACATTGGAAATACACAAA
TACATACATATGAGCAATGGCATGGAAGAACACGGTACACTTTTTGTATGCTTTAAGCAG
CTGGCAAATTATTATTTGGTCTTCTAGTTTTCCTATCATGATACTTTAAATAAATATTTG
ACACAACCTAGCAACAATTGGAACGTTTTTAAAATGCGTACAATAACCAAAATAAGTGCA
CCCTCTGATTGTGTAGTGTTCCAAGTTGTAAACCTCAACATTCATCTTTAAAATTTGCAG
ATTTTATGTTTTTGTAAAGTGTTTTGCATTACTGAGTAAATACAATTAAATAATTTTTTA
AAAACGAAAGCAATTCACTTCTTTAGCGCTGCTCCAGCGAATCTACCTTCTCGATGACAC
TTTCAATGCTAAAATCCTTTGGGATCTTAAGGGTTTTTTGCCGGTCCAGTAAGGCCTGTT
TTGTTGCAAGCTGTTGGGCGTTTCGCTGCATTACGACGATATCCGGGATGAGCCGCTCTT
CCGCAGCAGCATTAAATCTGCAGAAGAATGGTTTTGGTCAGGGATTCAACTATTAAAGGG
ATTTGTTCACCAATACCTCTCCAACATAACTACGTCCCTAGTCGCCTCCTCGATGGACGA
GAGGATGCGCTGCAGCTCTACGCGTTGCTGCACTGTGGTCTGCCGGTTTTCTATGCATTC
CCTCTTCTTGGCACAATAGAAGTCGCGCAAGTAGTTCAGATTGATGTCGTGAATGTGCAA
AAGTGAATAATATTGGGCGCATTTGTCAAGGAGCGCCAGGTCATCGTCCGAGAAATCGCC
CAACTCGACGCTAGCCAGCTTTAACTGGTCATCGAAGTGCTGGCCTAGACGCATCAATGA
ATTGACTTCCTCTTGGATCTTCAAGTTCTCTGCATCATAAGAATAATTAGTTGTATGCCT
AGCGTTTTTTTTAAATAAACTCACGCATTTTTACTGGAGATGACAAGCTATCGATGGTTC
CGAAAAAGATACTACCGCTTTGCTCAAAACGCAGGCGTATAGGCAGCCGGCTTAGAAACA
ATTTAGACTAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1261, 2561..3401, 3633..5068, 5466..6093
1169..1261, 2561..3401, 3633..5068, 5466..5873
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved