Drosophila_melanogaster Locus CG9253
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG9253
Drosophila_melanogaster
CG9253
2L
snoRNA:Me18S-A469
1623..1710
3920
TGCTTACTTTTCATCGGAACAAGAAAATTTTGTATTTGCGTAAATTTTAATCAATATTT
TATATGATAGGATCCTATATCGACGAACGATAGGCTCCGATAGGTACGGACTAATAATCG
AAGGAGGGTGACCGTCGCTTGTTTCTGTGATTATAGCAAGCAAGTGTTGAAAAGTACGGT
GACCTTAAGTTGGATGTGACTATTCTGCAACGTTTTTGTTTTTAGCCGCTAACGGATTTT
TAAATAAATGAAACAACTACTGACTATGAGTAATATATTAATTATATTACTTCTACAGTG
AACCTCATAAAAATTATGTCGGCAGTATGATGCATTTAACACAATACGAAAATGTATACC
TAACCAAAACATCAACAGATCGCAATAAACAAAATCGAAGATTAAAATTCGAATATCCAA
AATTATAAGAAAATGTTAAGTACAAGTCAGTTAAATTATTTCAACTATTTTTTTCTTTTA
TTGTCTTTAATATTTCTATACAATTAAAAATGACAATTATTCAGAAATCTTTTGTTCCGG
ATTTAACGGAATTGTTAATAATAGCATCAATAACATTTGTGTATGAAAATGTCAAACAGT
TTTTATTCGTTGACAGTTCATGACAGACAACCCTCTAATTGGCGTTTCATTAATTTAAAA
TTGCGCGATGGAAAAAGATGTATACCAAATTTGTATTCACCATCTATTTTCAAACATTGT
TATATTAACTGAAATGACAAAATCACAATATTAAACAATTTTCTAACAAATTACGATTTT
ATACAAATGTGAATATATTTCCGAAACAAACTATTTGCACTATAACTAAGTCCTGTAATT
AAGATCATGGTTCAGTATGAATGAGTTACAAATTTTATTAAGTGTGCATGTGATATATCG
CACATTAGCTATCGAAAGTTATCATGAATCTGCACTGTTTTAAAGACGCAACTATATCGA
TAATATCGCAAATAGTTCTATTTCTATTTTACCGCCTCTAATTCTTTTATTTCGACCACG
TGCTGCTATTGGTAATGTCCGTACCGTGAAATTTTTCTGAAACTCATGTAACAAAATGTC
GGAAACTTCAGAGGACGAACAGACGCAGCTACAAACGAGTGACGAAGAGGAGGATCTAGG
TAGCGAGGAGGAGCAGGAAGATGAAGATAACAATCATAAGGAAGGGGACAGCGAGGCGGC
ACTAAGTGGTGAAGATGATAAAGGCTCCGAGGACGACGCAGCCGAGGAACAGAAGCTAAC
CTGGAAAGATCTCGTATGAGCCCCACTATTAATTTAAATTAAAATTTAATCGAATGGCCA
TATTTCTTCAAAGGGTCTCAATGAGGCTTTGTGTCAAGCATGTGACGAATTGAAGTGGAA
GGCGCCTTCGAAGATCCAACGTGAGGCCATTCCGGTCGCCTTACAGGGCAAGGATGTAAT
TGGCCTAGCGGAGACCGGTTCCGGCAAGACGGGCGCCTTCGCTCTGCCAATTTTACACGC
CCTTCTCGAGAATCCGCAGCGGTATTTTGCCCTCGTGCTAACCCCCACGAGGGAACTGGC
ATTTCAAATTGGCGAGCAGTTTGAAGCCCTTGGTGAGTTTTCGCATAGTTTATGTGCTTT
TAATTCGCAGTGATGTTAAACCTGTTTTGATTTTGTGTATCAACGAAAATATGAAATTAT
AATTTTCTTATTCGTCACTACCTCTGAGTAAAAAAACCTTCCCATTTATCGTATTCTTGA
ATTTCCTTCTGCCAAACTTATGCTAGCTCTGTTTTTTTCAGGTAGCGGGATTGGCATAAA
GTGTTGCGTGGTAGTCGGCGGCATGGACATGGTAGCCCAGGGTCTTCAACTGGCCAAGAA
GCCGCATATTATAATTGCCACACCGGGTCGCTTGGTTGATCATCTAGAAAACATGAAAGG
TTTTAACCTTAAGGCTATTAAATACTTGGTCATGGACGAGGCGGATCGCATTCTTAACAT
GGATTTTGAGGTGGAGCTGGACAAGATTCTGAAGGTATTGCCGCGTGAACGACGAACCTT
TCTGTTCAGTGCGACCATGACCAAGAAAGTAAAGAAACTGCAGCGTGCCTCCCTTAAGGA
TCCCGTAAAGGTAGAGGTGTCTAACAAGTATCAGACGGTTGAGCAGCTGCAGCAATCATA
TTTGTTTATCCCTGTCAAATACAAGGATGTGTATTTGGTTCATATCCTTAATGAGCTGGC
AGGCAACAGTTTCATGATATTTTGCAGCACCTGCAACAACACGGTTAAGACAGCGTTAAT
GCTTCGTGCGTTGGGATTGGCTGCTATTCCGCTGCACGGTCAAATGTCGCAAAACAAGCG
ACTAGCTGCTTTAAACAAATTCAAGGCCAAAAACCGGTCAATACTCATTTCGACGGACGT
GGCGTCCCGCGGCTTGGACATTCCTCATGTGGATGTCGTCGTTAATTTCGACATACCAAC
GCACAGCAAAGACTACATTCACCGCGTGGGAAGAACAGCAAGAGCAGGTCGCTCCGGCAA
AGCCATAACCCTCGTGAGCCAGTACGACATTGAGTTGTATCAGCGCATCGAACATCTACT
GGGGAAGCAACTGACACTGTATAAGTGCGAGGAGGATGAGGTGATGGCCCTTCAAGAACG
AGTAGCCGAAGCACAGCGCACTGCAAAACTGGAGCTGAAGGATCTGGAAGATACAAGGGG
TGGTCACAAGAGGGGCGGGGACACCCACGATGATTCGGAGAACTTCACGGGCGCACGCAA
ACGCATGAAACCGATGGGCGGCACTGGCGGTGGTGGAAGAAAGAGCTTTGGCAAAAAGAA
TTGGAGCAAGGGCAAGCAGAAGAGATAGGTCAGATCAGTCTCGATTTTTATTAGTGCTAC
TCTAAGAATAATGTAATAAAAGTTTTAAATAGAAAGTATAACGCAAATTTTACTTTATTG
ATATTTGTAATAATCAAATAGGAACAATAATTTGATAACTTAATTTATTCAATTATGTGC
ATCAATAATGAAGAGATTATGATATATGTCAAGTATATGTTAGATACTTTTCATTCATTT
TCATTTGCTTAATCAAAATTATGTATATTGATCGCATATTCATTGGAATAATGAAAGCTA
GGGTTTGGCAAATATCCAAAATTAGGAACTGTGGTGTGTGGAGGCTGAATAGCAGCAGGT
GGTGCAAGAAACGAGGCCGCTCCTGGCGGCCCCTGGCTTGCGCTCGCACTTTCATTATGC
ATGTAGCTGTAGCTTTTCGATGCGTTGCTTAAAATCGACATAATAGTTTCGTTGGTACGA
ATAGAATTTGGATGGAGGGTGATCAACTTAAGGGCGTTTGCAAATTTATCTGAGCAGTCT
ACGGAGGATTTAAGTATGGTAATCAAGTTCTTATGGGGTATCTCAAAGTTATAATCCTTG
TCCAGCTGAGTTAGCTTATCGCAATAATCCTCCCAGTTGGCGTTGGACAGAATATTTAGA
GTCGTTAGCATCAGATCCCGATATTTGTGAGCTTTGCATGGCAACCACACATGCTCCATT
ATCCTTTTCACTGCCTCTTTCTGCATACCGCACTTACTGAGAGCTTCATAGACGTGTGCC
AGTAGGGGAGCTGAAATGCTTTTGTACAAGCGGCAGTCGACCAGCATGATTAGCAGATAC
TGCCAGAGATTGCGAAATTTGAAGATATCCACGAACGAGGTGTAGTAGGTCTGAAACAGG
AAAAAGCTTCGTATCGTTTGTCGGTATAGGCTCAGCAAAGTGTCCTCGTCCATCCTCATC
AGTCGTTTCTGTACTTCACCCAAACTGTTCATCGTATGATCACAATTAATAGAGATGCAT
TTGTTGTCTACACTTTGCATGCACCTTATCCCAAACACATCTTTGATCCAATTAACACCA
TCTTGGTTGGAGGTGGAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1272, 1333..1591, 1781..2920
1075..1272, 1333..1591, 1781..2844
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved