Drosophila_melanogaster Locus pncr012:2L
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster pncr012:2L
Drosophila_melanogaster
pncr012:2L
2L
snoRNA:Me28S-C2645a, snoRNA:Me28S-C2645b, snoRNA:Me28S-C2645c
1285..1359, 1519..1593, 1750..1824
3318
AAAGAAGCCTCCACATCCGAAGCAGCAAGTTCAGGCTCGTCCACATCCACATCAGCGGA
TCAGGACTCCGGCGAAGTTAAGCCCACGACCAACTACAAGGCCAAGTATGCCCACCTCAT
CGGAGAGTCGGCCGCACTGCAGGCGGCCCGTAAGACGGAGACCAACCAAAGCTACGGATT
CGTGCCTAGCAAGAATAAGAAGGATGTGCGCTCCATCGAACAAACTTTGGCCGACATCCA
GGCCAAAAAGCGTCTGCGATTGGCTCAGCAGCAGGAGCTGGAGCAAGAGCAGCAAGCGCA
AGAGGCAACCACATCCACAGAGGACCCATGAGTCGCCTGTGACCCAATTAGTATACAGAT
AGCTCACTTAATGCAAGACTGTCGCAACCAAAAAAAAGGATTATACTTCTTAAATCAGAA
TCAGAGAATCAGACATGACATGCTCGTCTTGTTCGCAAACTCCTGCTCGATAACATCGAC
AATATTTGACAAAACAGAGCAGTAATCATCTTCAGGGAGCCAAAGATTTTTAAATTTATA
GTATTCATACTATGTTTTTGCCCACATTAATCGTATTTGGTAATAGGCTTGATACTAATT
TTTATCTTAGGTTAGCCCCATTAAATTAAATGCCCTTTTTTTTTGAGTAATGACAGCCTT
GTATCGAGTGAGATTAGTTTTGTTGATTCAGATTAGTCACATGAAAGGTCTCTGACTGCC
ATGTAAATCATAAGTAATAAGCAATTTCATTTGTTGGCCAATTAAGATCCGAAAGTTGTA
CATGTTTTAAGCAAGTTATGTGTCCGTAGCAGAGTCCGAATCGCAATATCTATTTATATA
ATAAAAACCTAAAAAAAAAAACGTCGCAAGGTTCAAAAAAATCTTAAAAACGGGGCGCCA
CTCAAAAATCACCAAAAAATACAGAATATTTCCATTCCAGTATTTTCTTGTTCGTCACTT
CTTTCTTGTCACGGTGGTGAAGAAGCAGTCACAGTTTAATGCCAGCCGAAAGCCGCACCA
CGTGTTGCCCATTCCAAGAAAAATAAACTAAATTAGCACGATGGCTAATAGAAAACGCAA
CAAAATTTTGCTTAATACAATAGAGAAAGATATGTCAAATAGCTGAAAGTTATATGGTAA
CTAAAAGATGTGCGGATCACGAGAAACGAGCAATTCACTTTGACAGCCTGGCAGCTGTGA
CCCAAAGAGTCTCACTTTGAGACTTCTTGGGACCAACCAGCATGGGAAGTTTACGCGGTA
AGAATAATACAGAAAGAAGATCTCCACAACCATGATGAAATCGTTAGATGGGGACAACTG
ATTACTGTGACTGATTCATCTCGATAGTAGATCTGATTTTAAAAATGTTGCTAGCCTACG
TGCTTTCATGTTCAACAGCACTAAAATAACTCGTTCTTTTTATATAATGCAGAAAACTGA
TGTTTCTGACTGAAAACCGACGAAAGAATGGTTTCCACACTTGTAAGTATAATGATTGCT
AAAGATTTATGATTTTTTTTTTTTTGTGATGAAATCGTTAGATAGGGACGTCTGATATCT
GTGACTGATTTATCTCGATAGTAGATCTGATTTTAAAAATACTGTTAGCTTGCGTGATTT
TATGTTCAACAACACTACAATAACTCTTTCTTTTTAGATAATGCAGAAAAACTGATGTTT
CTGACTGAAAACCGACGAAAGAATGATTTCCACACTTGTAAGTATAATGATTGCTAAAGA
TTTATGATTTTTTTTTGTGATGAAATCGTTAGATAGGGACGTCTGATATCTGTGACTGAT
TTATCTCGATAGTAGATCTGATTTTTAAAATATTGTTAGCTTGCGTGATTTTATGTTCAA
CAACACTACAATAACTCTTTCTTTTTAGATAATGCTGAAACCCGAATTTCTCTGACAGAA
ACCCTACGTAAGAAGGATTTCCACACTTGTAAGTTTAAAGTGTTATGTGTACGTATATAT
AAATATGGGAGTATTTGAGGCCAAGTCTTAAGCTATTGTCTAGGAAACAAAATACCAAAT
ACAAAAACGAAACTAAGGGTATTCTTTAAAACAACATGAATTTTGTTTGTATTTATTAAA
TCTATGAAAATGATCCGTAAACAAAAGTAAAGAAAAATAATTTTGCACATATTTTTTTTA
GGAAATCTTTAGAACTGTCTGTAAAAATATATATTTAGAGTAACCCCTGAATAATGATTA
AATACTTATGCATAATTTTTATTTATTTTACAGGGCTCCCTTGCATGATGCCAGAAAAGT
GGACGTAAAAAATCTAATAAAATTATATTTATAGAAACAGAATGCAGCTTGCCATAGTTT
TATTTTTTAAATATTTTTGAGAGACGGTTGGGAAAAGGGAGAAAAAATATTGATACATCG
TGTAGGCTGGAATAACTAATTCAAAGTCACACCAATACTTTTTCCAAACCAGTTTTGCAA
TCTGCAGTAAAGTTTTTACAAATTGATCAAATCACTTTCGTTATAATGAGGTTTCGGTCG
CTGAAGAACATATGGCCAAAAGAGAAGTTGGAGCAATTCCTATTTTTGTTCATTTTATGT
GGCTTGCCCGCCATATACTATGTTCTAATGGAGATAATTCTGCCGGAGTTGTCGGATTAT
TGGTCACCTGGTTACGTATTTCAGCTGCTGCTGGGACTGTTCCTCTTTTCGAATGTGATG
TCCAACTATGTCATGTGCATCCTGGTGGACCCCAGCATCGATCCCAAGCTTATGAAGAAT
CAGTTGGTGCGCGGACAGCACAGTGAGGACTGGCACGAGTGCGACAAGTGCGGGATTCTT
GCTCCACCCCGGTCACGTCACTGCAGGAAGTGTGGCGTCTGTGTCCTGATGCGAGATCAT
CACTGCTTCTTTACTGGTTGCTGCATCGGTCATGAGAACTATAGATACTTTTTCTATTTT
CTTATCTACTTTTTTCTAAGCTGCATGATTTCACTAACGTCATCTTCGATATTTATTTAC
GTTCTGCATGGGGGCAGATACCAGCTCTTTATGCTGACACATCCCGCACCGAACTCTGCC
TATTTTAACTCGCTTATTATCAGGATAATCTACTTTAAGTTGCCCGATATATACGAGCTG
GTGTTCACTCTGGTATTCGTCCTGCTGTGGATCGGGGTATGCGTAGCTACCTATGTGGCT
TATGATCAGTGGTCTCGTGGCTATTTTTGCTATGATTTTGAACTTCAAAACATTCCTTTT
GACCGAAAACTGCGCCGAAACTTCAAGACGTTCTTGGGCAGGCGAATGAAGTGGACCTGG
ATCTCCGGATTTGTTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1256, 1432..1481, 1657..1947, 2253..2318
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved