Drosophila_melanogaster Locus Arc-p34
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Arc-p34
Drosophila_melanogaster
Arc-p34
2L
snoRNA:Psi18S-525a, snoRNA:Psi18S-640a, snoRNA:Psi18S-525b, snoRNA:Psi18S-525c, snoRNA:Psi18S-640b, snoRNA:Psi18S-525d, snoRNA:Psi18S-640c, snoRNA:Psi18S-525e, snoRNA:Psi18S-640d, snoRNA:Psi18S-525f, snoRNA:Psi18S-525g, snoRNA:Psi18S-640e, snoRNA:Psi18S-525h, snoRNA:Psi18S-640f, snoRNA:Psi18S-525i, snoRNA:Psi18S-640g, snoRNA:Psi18S-525j
2288..2421, 2463..2594, 2610..2744, 2774..2907, 2937..3073, 3085..3221, 3243..3370, 3396..3525, 3566..3696, 3714..3848, 3872..4005, 5091..5214, 5244..5378, 5415..5540, 5557..5692, 5721..5849, 5868..6003
7974
CCGAAACGATCACGCAGCTTCTTCCAGCGGTTGTAGCAAAGTTCCTCTATTGAAAATTA
TCGGCATTAAGGGCTGAAGATCAAGAGGGTTACCCCGAGCTCACCCGACACATTTAGGTT
TTCAGAAATCTCTCGCCAGGCTTCGTTTTTCGCTGCTAGGTTCTTGGAGACTCTGATCTT
GTGACGATCATACAGCACGGGATGAGACTTGACCAGCTCAATGAGCTGCTCGTTCAGCAG
GTCATCCTGGGAGTCCTCCTCCTCCTCGTCCTTTCTCCGCCTCTCCTGCTCCATGTCCAC
TTTTGTGCGCTTTTTCCGCTCCCTGGGCTCAAAACGCATCCCGTCGAGACTCTCGTTCCT
TGCCAGTCCCTGTTTGTAGTGATCCTTGAGAAAGAGCAGTCGCGGAAACATGTCCCAGTA
GGTGGGCTCATCCGGACGCTCCTGGAAACGGCGAAACTCCTTGCCGAAACGATCGCGAAT
GCTCTTCCAGCGCGTAATGCACGCCCGTTCCGAGGCTCCTAACTTCTGGGAGATGGCCTT
CCAGGCCGCGTCCTTTTGCGCCGCATTCTTCACGCTCCTCGCGCAGTCCTTGTCGTACAG
GATCGGGTGTCTCTCTATCAATTTAATCAGCTCATCGTCGTCCATTGATTTTCGCTATTA
TTTGTTTTTATTTATTCTGAACGATCCGGCAGCCTGGCGGGAAATATTGATAGTCGATAG
GCGATGGGTCATCGCACAAAAAGGGCTGCCAGATTATTCTGTTAAAAAAATGTGCCTCTT
AGTTTTATAGCACCGTTATTATAACAATGTTAAATAAAATATTTGTGTGTTTGTCTTAAA
ATGTCTTAATACATATTTATAATTTAAAGTTCGTGTGTACGAATTTCGTTTAAAATATAT
TCTATTTTATATATTTTAAAGAAAATTCTCTTTATGTTTGTTAAAATCTGCTGGTTTGAA
TTTCTGTGTAACCTGATAACATTGATGGTCGATAGCTCGATACTTCAATCTTTCCATCGG
TGAGTTTGCCCCATCTCTATTGTGCTACCTGGCAACGCTGTGAGCAAGGAAAATACGGCA
GCGTGCTCCCCGTTTTCCATCCACGTTTTGTTATAATTTTATAAGTATTACGGTCTGAGA
CCGATTTTGCACTGCATCGTGCGCGCTGCAAGTACTGGCGATTGGAAATTGGAGGCGCGA
AAAGAGGATAAGGTGGATTTTCTTGCAACTGTGTGTGTGAGCATTGGAATTCGCCCGTGT
GTGTGGCGAGAGTGCGTCCATGTGTGTGTGACGGACCAAAAAAGCCGACATCAGCGCCCA
TTTTTTGTTGTTGATTCATTAATACGCCCGTCATGCACCAGTATTGGTGAGTTGGAGCAG
CGCACCGTCTTACTCGCACTCAACGGAGCGCAGAAAGAGCGCAGGGAGCGGCAGAAGAAG
AAGCAGCGAGCAGCAGCACCATTAGCGGCAGTCAACGTCATATAATTTGTCATCGAAATT
GGCACACTAAAAATAACAGTTAACTTCAACCGCCATGATCCTGCTGGAAATCAATAATCG
GATTATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGGTAAGTCAATGC
CTTCCAGTCCCGTTTCCCCAATTTCCATTCCACCATTTTGATTTCTATGCTGCATTCCCC
ACCGTTCTGTTATCACCAGTCGGCTTTGTTATCAATTTCGTTAGCTCTCTCTTTCCTCGG
GAATAAATTTGGGTGTAGTTCCAGCCTTGGAACACTCATCGCTGCAGCTCTCTCCCTCCC
ACACACGTACCCAAGTACAGTGCAGCCCCCTTACGTCGACAGCGTATTAGTTAATTCATT
ACAACTCGCTATTCGCATCATCGGTGCTGAAAATCTGCAAAACTGACTCATCCATTGACG
TGCATTCAAACGCATACGCTTGTGATGATCGAAAATATTAGTATTTATTTGTTCCTAATC
CCGAAAAAGGATATTATTATTGAAGAAACATTATCAAAGGAGTCGTGTTACGAAAGAAAT
ATGTTTAAGCTAAACGGTTTAGAAGAAGCTTAGACGAAGCTTACAGACTAACAAAATTAT
TAAAATTAGTAAAATAACTTATTGTACTAACAGCACTATCAGCAGAAAGAGGTATTTGTG
TTTGGTAGCGAATGATTAAGATCTCACATAAATAAATGTATTTAAATGCTAATAGTTATG
ATGCCATTAGTTTATTCCCGATAAGATTGCAGTGTAATGCCTGAAATTAAGGCAATAAAA
GTTATAAATTGTGGAACAAAAGTGGCATACTTGGAAAAAATCTCCTGTTGTGTCTCAAAT
GTTCCAAAATAAACCAAAAGGACGAACGGCATCCTGAATAATCAATCATATTATAGCAGA
TGACTTGTGTTCGTGTACATAAAAACTAATAGTTTCAATATTACTCCCCTATTATCTGTA
TTCTTGGGAGACAAAGTTTACATGCTAAAGATTCTCCATTTTCCGTGTCTACAACGCTCC
GATATAAATTGTAACGCTTAAATCATCTTGAGTAATTCTTTTTGTTTCTTAAGATAAATA
CTTTCGTGTACATTATTGCAAATTTTAGGCTTTGGAGCCAAAGTGGCATTCTTCAAAAAC
AATATTTGATCTGTGTCTCAAAAGCTCCAACATTAACTAGAAAGACGAACGGCATCCTGA
ATAATCAATCATATTATAACAGATGACTTGTGTTCGTGTACATTTGCCATAAAATGTTCA
ACTTTTGTAATATTCTGGAGTCAAAGTGGCACGTCTTACGATCTTCCTGTAACTTGTGTC
TCAAATGCTCCAATATCAAACGAAAGGACGAACGGCATCCTGAATAATCAATCATATTAT
AGCAGATGACTTGTGTTCGACTACAATAGTATTCGATTTATTAGACCAATAATGCCTCGG
GAGACAAAGTTTACATGTTGAAGATGATGTGGCTTCTTTTTCGTGTCTACAATGCTCCAA
AATAAATTGTTCGTTTAAATCGTCTTATTCGATTTATTTTATTGCCTAAGATGGTTGCCA
ACTGCACAACAACTAATTAAATATTTGGGTGGAGTTAAAGTGGCATATTTTATAGCTTTC
CTTTGATCTGTGTCTCTATCGCTCCAATATCAATTTTATAAGCGAACGGCATCCTGTTTA
ATTACTTATATTAAGACAGACGACTTGTGTTCGTGCACAACTTCAAAATGCTTCAATAGT
CATATGGAGAAAAAGTTTACATGCTAAAGTATTTTTCTTTTCCGTGTCTACAATGCTCCA
ATATTAATTGAACGTCTAAATCATCTTGGATATAATTATATTTCCATAGATAAATACATT
CGTTCACAATACATTCGTTGTTCATATGAAAATGGATTGGAGTCAAAGTGGCACACTTAA
TCCATTTTTATTTGTGTCTCAAATGCTCCAATATCAAATGCAAAGGCGAACGGCATCCTG
AATAATTATGCATATTATAACAGATGACTTGTGTTCGCCTACAATAGCTCCTGATAGCTT
TACATTCCTTTATAAGACTCCCGTCTTCGGAGACAAAGTTTACATGCTAAGGATAAGATC
TTTTTCGTGTCTACAATGCTCCAAGAGCAAATGTTCGTTTAAATCATCCTTGGCATTCAA
TATTTTTGCTGTGGATGCATTTAATTCGTGCACATATTTATAGATATGTATGTCGTGGAG
GTAAAGTGGCATTCTCGGGATATATAAACCTGCCTGTGTCTCAAACACTCCCAAATCAAC
TTGGTTGGCGAACGGCATCCTGAGTAATTAATAATATTACATCAGATGACTTGAGTTCGC
GCACAATCGCTTTAAGATCGCAAAGTACGATTTAGGAGCCAAAGTGGCATGCCTTGGAAC
TTTTATCCAATTTGTGTCTCTAATGCTCCGATACTAATTATACAAACGAACGGCATCCTG
TTTGATCCTACATATCACAATAGATGACTTGAGTTCGTGTACATTATTCAGAAATATTTG
TTTAGTTCTTGTAATTGAATTAAACTAAATTTAGATATCGGCTTAGCGATCCAGATACAA
ATACATACGGATGTTTTAATTTATTCGAAAACGCAAAATATAATTTTATTGCTGCTGGTT
TCTTTTGGAAAAATAATCGGGTATAAACGAGTTTATGTGATAAGATACGGTGGAGTGTGG
GGAGCATGACTAATAAGCAAGAAAATAAATGAGAATTTACTTTTTAATTCTCTTTCCAGA
CTGAAGCCTGAATCGATAGACATACGAATAGCAGACTTCGACGGCGTCCTTTATCACATT
TCCAATGTGAATGGCGATAAAACAAAAGTTCGGGTAAGTGTACCGCGTACTATTCATTTA
GGATAAATCCAACATTAACGATTTCTCACTTTTCTTGGGCTGCGAAACAGATCAGCATAT
CGCTGAAGTTCTACAAACAGCTGCAAGAACATGGAGCCGACGAGTTGCTGAAGCGTGAAT
ATGGCAGTCTGCTTACAGACACGGAAGAAGGTACGTTCGTGTTTAAGTTCGGCATTTAAA
GAAGTTAATTACTCTCGTCTAATTGCAGGCTACAATGTTTCCGTACTTATCAACCTGGAG
GAGATTCCCGAGGACTGCGAGCAAATCGCAAAGAGAATCGGACTGCTGAAGCGCAACTGT
TTCGCATCGGTTTTTGAAAAGTATTTTGACTATCAGGAGCAGGGCGAAGAGGGCCAAAAG
CGTGCCGTCATTAACTACCGCAACGATGAGACTTTGTAAGTCAGAAAAATATGTTTTTGA
CTCGTCCAAGCGCTGACAATCTACAATCGATTTGCAGATATGTGGAAGCCAAGCCTGATC
GTGTCACCGTCGTCTTTAGTACCATTTTCCGGGACGAAGACGATGTCATTATCGGCAAAG
TATTTATGCAGGAATTGAGGGAAGGTCGGCGTGCCTCGCACACCGCACCACAAGTGCTCT
TTTCGCACCGAGAACCACCATTGGAATTGGCCAACACGGACGCTAGGGTGGGCGACAACA
TTGGCTATGTCACATTCGGTATGTTAAAGGTTGAATGGTAAACCATGTGCTGTGGAGCCA
AAGTTTACACGTTAAAGTGCATTTGTCTTTTCCATGTCTACAAGGCTCCATATAAATAGT
ATCGTTAAAATCATCTTGAACATTCTAGTTTATAAATATATCCAATGATAAATACTTCCG
CGCACAATAATGCATTAAAGTCACCTGTGGAGTCAAAGTGGCATGTTTTAAATTACAATT
TGAATTGTGTCTCAAATGCTCCAATATCAACAAGATATGCGAACGGCATCCTGAATAATC
AATCATATTATAGCAGATGACTTGTGTTTGTGTACAGTAACACACCAACCCAGAATCCCC
AAGCTGAATTGTTCAGTGGAGACAAAGTTTACATTTTAACAGTATTATCGTTTTTATGTC
TACAATGCTCCGAAATCAATATCCGATCCAATTATCCAAAGCAGTCTTATATTTCCTTGG
ATGATTTCTTTCGTTACAAAAATGTCAGTATATTCCATATGGAGTTAAAGTGGCATATTT
TTAATACTTACCCTAAATCTGTGTCTCTAAAGCTCCAATATTAAATAAATAGACAATCGG
CATCCTGAATAATCAATCATATTATAGCAGATGACTTGTGTTTGTGTACAGTAAAAGAAT
ATCTTAGACTGCCTTTTTTAAATGGAGACAAAGTTTACATGTTAACAATATTATCGTTTT
CGTGTCTACAATGCTCCAAAATCAATATATTCGATCGAATCATCCGAAGCAGTCTTATAT
TTCCTTGGATGATTTCTTTGGTGCACAGTGCACAGCTAATGTAATCCCAATGGAGTTAAA
GTGGCATATTTTGTATACCTTCCTTCAATTTGTGTCTCTAATGCTCCAATATTAAATAAG
TAGACGAACGGCATCCTGAATAATCAATCATATTATCGCAGATGACTTGTGTTTGTGTAC
AGTACTTCTTAGAATTGAACCGATGTTACACTTTGAAATATCCAAAAGAAACAAAATAGT
AACGACTCATACTTGTTTTTTGCAGTACTCTTCCCTCGGCATACCAACAAAGAAACAAGG
GACAATACCATTAACTTAATTCACATGTTCCGAGATTACTTGCACTACCACATTAAGGTA
AGTGTTGTATGCAGCTATGCAAAAATATCTTTTATATATTTGAAATATGCATTTTTGAGC
AGTGTTCAAAGGCTTACATTCATTCGCGCATGCGAGCAAAAACCTCGGATTTCCTCAAGG
TGCTAAATCGTGCAAGGCCAGAGCCCAAAAACACGGAGAAGAAAACTATAACGTGAGCAT
TGGACTTTCCATAACGAATTCTGATTACTAACTCGTGTTCTTTTTGCAGGGGGAGAACTT
TCAAGCGCATCGATTGATGTGTTCAGTATATTTAGTTGTTTTTATATAAATACAAAAAAT
AAATTGTGTATTAAAATTCGATATCCGAATGGTGAATCCAACATAAACTAAACCAGATTG
CAAGACAAACCCAAGTATTCCAAACAGAACCGTAAGGCTAAATGTAAGCTCAGCAAAATA
ATGATCAAAGAATTAATAGTTACGCGTTAGTAAATGAATTGTGTGTGTTTGTGTCGAGTC
ATCGTCAAATCCGTGTCTCCGCCAATTTGTTACAGTCATAGGCCGAGTCAGCGCCACAGC
TGAGCCGCATTTTAAACAAATAAACGTAGACTTAAGTGCAACATGAGAACTAAAACTACC
ATGTCAAAGCGAGCAACACGACTAAGGGATGCCACCAACTTGTTATATAGTCGCAATGGA
GGATTCATCCCCGCAATTAGCCTGTATGTGTAGAAAGCGCATTTAAAAACGTACTGCAAA
TATTAACAAACCTTTGATACAGCAATCGGAATTAATAAAAACGAGAAAATCAAACTGCAA
TGTAAAATAAAAAAAGGGACACTCTTTTAATCTCTAGCTAGCTGCAGACGCTCGAATACA
CTTTATTTTCTAGCTTATTAGCTTTTAATTGCACATAATGTCTTAAATGTTACTAATATT
TCGCTTAGGTATACCATCTCCGCTGCACAATACTATAACAGGCACTTAGATCTTAAACTT
AACATTCTGCTTCGCGTTCATGCTCTCCATGCTGACCTGGAAGTTGAGATAGTCGCTCTG
GATGCGGGCACACACTGAAAGAAATGTGTTGGGTAAACTAAGTTGGGACTGAGGAGCGCT
TTGACTGTTACTATTGAGATGTGCTACTTACTTACAGTGGCAGTGTTCATTGCGATAGAG
AGTTTACTGCTTAAGTACTTCCGATAGTTTGTACAGGGTGCGGGTGAATTTACAGAGCCC
CTAGGGATCATCGTACTGTTCCAATTTGATATAAGCAAGTGCTGTGATAGAGAAGCGGCA
GGGCGAGATGGATAGAATAAGTGAGTAAATCGCTTAACACTGGGAAAAATTCGTTCCAAG
CATGCGAAGAGTTCTCATAAATTTGGAACAAGTCCAAAACTCAAGAAGATACTGACTTGA
AATGCAATTTTGATTATTATTCTATTAGAAGAAGATAACTGAGAGTGAATATTTTGAATT
TGAAATATTTTAAAATAACGTAACAATATTAAAAAACCATTTCAGTCGAAATTAAATTGA
TTACTGGTGGGATAACTGAAGATCAAAGTTTTGTATCGCAAGCTACTACTTTTCCGTTTA
TGTTATTTTAAGCCCCTTTTTATAAATTTGCTATCAAGATTGGAAAACAGAAGTGCTTTT
CGTCCAATTGTGGTTCGGAACTTATCTTAAATGGTTGTAATGCCATAAAATACTACAATT
AACAAGTTATTTAGACACCTAATTATTCAGCTGACTAGCATCTCTCTATAAGAAATCCCT
TCACATTCAAAAACTTCAGAAAGAATTTTTCTCAGTGTGAGGTAACTAGCGTGCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1607, 4259..4352, 4430..4529, 4588..4774, 4837..5057, 6085..6176, 6242..6351, 6409..6974
1534..1607, 4259..4352, 4430..4529, 4588..4774, 4837..5057, 6085..6176, 6242..6351, 6409..6433
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved