Drosophila_melanogaster Locus rtGEF
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster rtGEF
Drosophila_melanogaster
rtGEF
2L
snoRNA:Me28S-A3365
4047..4147
16826
GCTAATCTGCGAATCTAGGGGGAAGCCCTTGGCGTATGCGGTCCGCTCCTGGATCTCCT
TGCGCCGCTCTTCGTTGTGCTCTGGAATAGGACGCTCCGGATGGCGACGCAGGCTAAGTT
TGTCTTCGCTAATCTCCACGAGGCCCTCCTCGGATTTGTTCAGGGCAGCCACGATCTCAG
ATAAGTCCGTGGACAGGGAGGCCAATCTCTTGAAGGTAACGAGCACCGACAGGGGCACCC
AGCCGTCCTCGTTCTTGCCGATCTGCTCGCGCAGAAACTTGTCCCGATTCAGATTGGCAT
CGCCGAAGTAGTACTCTACCTGCCGGATTATGGCGCGCTCCTGTTTGGTGAAGCCGCCAG
CGGCTTCCTCTGCTGCGGGAGCCGGGTCCTTCTTGGCGTCGCCGTTCTTCGCCTCCAGCA
CCTGCGCCTCGGCGGGCTGTGCTACCTCTTCCTGGGCTTCCACACTCGGGGTTTCAGCAA
CTTCGGCCATTTTAGCTGTGAAAATTTCGCAAAGAACTGAAATGTGCGCTCACTGAAACA
CGTGTGAAATCGGTAAAATGAGTCACGGCGTTTGACAACACTAGCCCCGAAATGCCGTGA
TAGAGATGCACAGGTCAAAAACCGTGACTAGCGCCAAGCATTAACTTGAAAATGCAGTGC
GGACATCTTGACCAAAGACCCTAGAATTCTAGTGTCTTTGTCTTGACTATGTATTATTTA
AAGGCTTTGAAAATATACGTTTGATTATTTAATTTTTGTAGTAGTGGTAATGGTAATATA
TCAACAAGAATTAAAAAAAAACCTTTACTCATTTACAATTACCGCGATATTCAAAAACAA
GAACATACCAAACTAAAACTTATAATTCAAAATATATGTGACGAAAAGTGGTTTATATTA
TTTTTGAATGTGATTTATCAATTTACTCCAAAACTATCGATGCAAAGTTACGGAATGCTC
CCCGATAGCCCTATCGATGCCGAGGACCTGTTGGCACGTACACATCTTTAGTTTGGCTGC
GGCCGATTGCAGCCCTGGTTTTCTAGGTTTCTATTTTGGTCGAGCGCTGTGTTTTATTTA
TGTTTGCCATGGGAAAAGAGAGTTGCTAAAAGTGCCTAAATACGTGCACCTGGTTCACAA
ACGGGCGCTCCAACCAGTTGACCCCAGCCCCACGGAATCGGCATATGAGTAAACAAGTAT
TTGAAAAAAATAGTGAGAGCAGTTCAAATCGCGTCGGCCTAGAAAAGAAACCAAAAAATC
GGGCAATAAATAGTGAAAAGTGTGCTCCTTTTGCTATATAACCAATTGTGTATATATAAT
AACAAGGGTGGATAAGTCGCGCAATCAACGAAACTTGGAAAACTAAACTATTAGTCACTA
TTCTATTATTGCTCAACGAACGACAGGGAACAACAACAAACGGATCAACAAATGTTTGAT
AAAACGCAACGCAGCTGAAGGTGAGCGAAAAACTAAAGTGGTTAAGAAAACCCTTCAGAC
AGCTTGGCTGCAATATATCTAGCCGTGGAAATGAATCAGGTTTTCCAATAACTGCTCGTC
TGGCCAAAGGTTCAGTGGCATCTGAAAATTCACCCCACTATGCGTCATCCAAGTAGAGGC
ATCATAGACATCCCCACAACGGCAGACACAATCAAGCCTTCCTATAAGAACCGCCATGGG
TTTTTACATACATATATGGCATATATAATAATAGAGCGGGTTTTCTTCCTTATTTCCCCT
TGAGATTTTAATATACCCATACTGCTAAATTCTTCATCGATGAAGATATCTCTTACAAGA
AGCATTTAGTTGACTGAATTATTGGTTTTTTTTTTTTTTTTTTTTTTTTTTTGTATTTCA
ACACTTTCTTTTAAGCAACATATTTATATAGAAAATCTAATACATTTTTAGACACATGAC
AAAATCCTATTTACGTTAAAAACAGTTTCAATCGTTTAGTCCCAACAAAGGACATTTAAA
GCTTAAAGCTCAAGAATACATTTTATGTAATGACTCCTGTACTTTCGGCACAACTGTTGT
TCAACTTGCTGCTGCTCGTGCAATAGTAATTTGTTGCCGGTTTCTGGAGTTCAGAGGTCC
GCCTGCATAATCCATTGGGTCAATAGCAGGGCTCCTCGTGGGGCATCCGTTCCAGCTCCT
CCCGAAAAGCGTTTGTTTGCTAGCACTCGCTGCGAAAGTAAAATGCACTGCCGGACGACG
ACGGAGGCACGTTCTGCCTGCCGCTGCCTGCCGCATGCCACCTGCCTCCCGGCCCCAAAC
TCCCCCATTGGATTCCCAGAACCAACAAGCATCATTACCCGAACAATTTTGAACCGCTGC
CAAGAGAATTTCCTATGAAAGGTGGTGGCAAGCTGAATGCAAATTCATGCTTTTCTTTAC
TCTCACATGATCTTGGTTTCGGCCACCAGGTCAAAAGCAGTTTGCAAAATAAATAGCTAC
CCTAGAAAATATTATTTAAATCAAATTGAATTATTTCATGGTTTAAAAAGTTATATTTGT
TTGTATATATTTATGTGGGGAATGTGAAAAAGTCTAGGGTAAGATCTCGTCGAACCACTT
GGCTCTTTGCGCCCTATGGTTGTTATTCTTACGCTTTAATGAAAGCATGTTGGCAATATC
TGTATGTGGGCCTGTGATTTCCCAAAACAAACATTGGCCGTCAAATCATGCGCCTGATTT
TCACTCGTGTCTGCTGGGAAACCGCGTTTCTTCATATTTCCGCTGCTGACCTCGTTCTTG
GTGTGTTGGTGTCGAGAACAGCGGATCCCCACAAGCTATTGGAACTCCCACTCGCTCACC
TCTTCGGTGTGCCCACAGCCACCGATGACTTCCTCCGCCACGAAGTATCTATAAATACGG
CGAGCGACGCAATCAAACTATATTACGTCCATATATCTGAGGAAATGCATCTCAAGTGGC
GGCTGTGCAGCCTGTAAATCTCGGTATTGACACATTGAAGAGGCCTTATTGAGTGCAGTT
CGGCTGAGCTAGTAGGGATAGCGATTCGGATCCGGTCCCGACCAGGCAGAACTGCATAAA
TTTGGTTTGTCTTTGGCTGACTTTGTTTGTCTTTGCCGCTGACTTTGCCAAGCAAAACAA
TCCACTCGCCTTTCTTTTACATCTCTCGTCTTTGTTGTTTACGTTCCCCAGTGTCCCACG
AAAATAAACATTCGGTGATTTGATTTGGGGTGCTCCCCTCCGATGGATGCGACGTTTTAC
TCGCCAAATTGCGCATTTCCGGAAGCGGCAGGGATATTCATTTGAATTTCGCCTTCGGCG
ACGGATCGTTAATAACCGAAAGAGTTGTCTCTTATACTCAGAGAGCGTGGGCCCGGTGTA
TCTGTATCTGAAACTTGTATCTGTATCTGTATCTGGATATGGGGCCGCATAGCCGATCCG
CGCGGCGCCATGTGCAAGTTTAATGAATTAATTAAAATTTGGTTCCGAGAGCTTCAATGG
GGTATGTATGCATCTTTGTATGTGCCCACATATCTGCGTGTGTGCCGCTCGGTATCTGCA
TTTATGCATCTGCTCATCTGACCTCCGATGCATCGTTTGGAGCACCACCACCTACGGAAA
TTTGATTGTGCCCGGCCATGGACTTAAAGTGATTTCAGGGTTAAACGAAGCGAAGGAAAG
TGACATACATTCGGCTTGGGTTTGGCGCTGCACTTATAAAGCATATTTTTTGCCGACATT
CTGATCTCGGCAGATTTGAATACGAATATTCTGTGGAAAAAATATTTAGTTCTTGGTCAC
TCTAGCTCAAAAATTCTCCGTCGGTCTATAAGCTTCAACATCTTTATTCAGTAGAGTTTA
CAGTTCCAGCCTCCTTGTTTGTCTCAGAATGAAAGTCTTTGGGTTAAATTTGATTTATAT
TCTATCTTAAATTCTAAAAATATGACGAATTTAACATTTCCTGAGGCCATAATCCCATTA
AAACCACAATGTGTGTCGCACGATTCTAAATTTTAGATTATACAAGTCTACACATTCCAT
AAACGTTTCCTATGATTCACGGGCATATATTGTATGATCAACAGGAAACTGAGCGGAACA
GGTGAATTTTTCTGAAATAATTCTAAAATGCTTGAATATGAAGAAGTTTTCGATTGATGA
CTGAATCCACAAACATGGAAGATCTCACATCCAATAGGCAACCCACATATATTTTGGCAC
AAATATTTTTATGTGGTTTTTTTGAATAGACAATACAAAAGCACAGCGAGTGTCGCTTAT
TTCTCAATGAAATACAATTAAGATCCTCATTTTGGAAACGCAGATGAAAAGGTTGTCCCC
GGATTCATATTTTTTGTCACATCTCTGTTGATTTTTCATGAAAATATGCGATGTGTCCGG
TCGAAAACGCTCGCGTACATGTGAAAATATATTCGAATCTCCTGCGATCCGACGAGACTC
TCAGAAAATGACTGCGAGAGTGGCACTTTCGGTTGCCGTGGAAAATTCGTCTGCCATATG
TCGCCAGCTTTTCGGTATTTTCCGCTTTTCTCGGCAGTTTCGCTGAAGCAATGAACGCGT
GCGGTGCATCGTCTGAGAGCAGAAAAACGGCGAAAAACGTCAAATTGTCGTACCACAATT
TATTGTCGAAAAAGTATATATCACCCATCTATACAAAAGAGTAGCGGGTATATGTATTCG
AGTGCCTAGATGGCGAAAAAGTGACATTTTAAGAAATTTTCATGCGTTTGTGCAACCAAA
ACGTGACCTTGCCTTAGGGAAATATTCTCATCAGCCTATAAATCTTGACAATCTCATGAG
AGCGGTAATAATTCGTGAAAAACTACACGTTCCAGTTTGGCATATAGAACTTGCGATCCG
CCAATATGTACACTTTCGTCTGTTTTTTATTTTTAGTATTCTAGAAAACTATTTGGGCAA
AATAAACCAAGTTGTTCATATTTTTGCGTTTACTCATTGCGGCAATAGCAAACAAATGTG
ATGCATCTATTTTTAGAAAATATATCACTTTTTAACATTTTCAGTCCAGAATTGAATTTT
TGCATAAACATAGGAATTCCTATATTAATAAAAGCACACGTCGCGCTGCCAATTTTAAAT
AGTACCAACGAATAGACTAGGCTAAAGACTTTTATAAACGACTTTAAAAATAATGACATC
CACTAACTAGCCCCCTAGTGCCACTCATACAAGAGACCATTTCAATTAAGCTTTGGAATA
TTGGGGGTTTTTGTGAGTAACAATGTCGTAATATAATTTTCGAGGCATTCGAAAATATTG
CGATTTTACTTCTTTCTATAGATATCTGATGTATAGAGTGCACTTGCCTTTAGAATCCAA
TGTGCCAATCCCATTTCCGTCAACGAAAGTGTTTAACGATTGAATGAAATGTTGATCTCT
TAAAGAGTTGTTCGAACAAACCAAATAAAAAAGGTCGTAAATATTTTTAGACGCGACGTG
GCCGTTGTTTATGATTTATATGTTGGCCTGTCCTGTCCGGCTATTCAAATTGTTTTTATG
GCCCGAAAAGTTTTTCTTTCACAATACGCGCGAGTGATTTTTACCCAATTTTTTAATGGA
TCCTCGCAGCTTGTGTGACCTTGGCCATCGTGTAGCGCACGAGTTTTCCAGACACTTGCA
GTAAACTAGGAAAGAAAAGCCGGAGGGGAGTCGCCGGAAAAGTGTCAAGAAACTTGCGCA
CGCGTTTCTCGACAGATGTTTTCAAAATGTTTTCTTCTTTGGGGCCATAATTATTGCTCG
GCTAATTCCAAGAGGCTGAGGAATGCCGAGCGATCGACGATGATGTAGCTCATCGCTGCA
ATAATGCGTAGGTGCTGTATATAACGAGCGATATGCTCACATATGCTTTTTCATTGAGCA
AATTGCCTGGCTGATGTTTCAAGTTCAATACCCATCGCCTCGTTTCAGTTGAATCAATCT
AGTGCGCACTCGGATCAGCCCTGAACAATCCGATAATGGATCAGCCACTGGTGGTGCAGG
CGGAGTACTCCTTCATGGGCAGCAATAACGACGAGCTGTGCTTCCAGAAGGGCGATGTCA
TCACGGTTACCCAGCGCGAGGATGGTGGCTGGTGGGAGGGAACGCTGAACGATAAGACTG
GCTGGTTTCCCAGCAACTATGTGAATGAGTGCAAGGTGCAGCTGCCTCTAACGGAGACCA
TAAGGCCGCCGGAGGAGATCCAGGAGTATCGGTCTGTGGTGCTCAAGGATCTGCTTGACT
CGGAGCGCGCCCATGTGGCCGAGCTGCAGGGTCTGCTCGAGAATTTCTTGGAGCCCATGC
AACAGACGCAAATGTAAGTTCTCTATTCTCTGACATAATTTGAATATAATCTAAAAGGGC
TTCTTCTACAGACTCAGTCAGGATGAGTACGCCCAGCTGATGTGTAACTTTGTAGAGATT
GTGCGTACGCACGAGGATTTGCTTATCCAGATCGAGGAGTGCAACGATCGAGTGGGAAAA
CTATTTCTCACCAGCGCCCCCTTGATGAAGAAGGTGCACCAGGCGTACTGCGCTGCCCAT
CCAAAGGCCATTGTCATACTGGATAAGTACAAGTATGTGCTCCTCGCTTTATATACATAT
ATTGTGGTGTTCAATTGTTAATAAATATAAATTTTTTTCTATTCCAAAAGGGACGAGCTG
GAAAAGTATATGGAACGACAGGGCGCAGCCACTCCTGGATTACTTGTGCTCACGACGGGT
CTATCAAAGCCCTTCCGGCGACTGGACAAATACTCGGCCATGCTGCAGGAGCTGGAGCGG
CATATGGAGAGCAGTCATCCGGATCGCGGCGACACCCAGCGGAGTGTTGCCGTGTACAAA
GACATAGCTGCCACCTGCTCGGCCACCCGTCGCCAAAAGGAGCTGGAGCTGCAAGTGCTC
ACGGGGCCAGTGCGTGGATGGCAGGGCCAAGAGCTGAGCACCCTCGGGGACATCATCCAC
ATGGGCAGCGTTGCAGTTGGAGCTGATCATCGCGACCGATACTTTGTGCTCTTCCCTCAA
ACATTGCTATTCCTTAGCGTTAGTCAGCGGATGAGTGCATTCATCTATGAGGTGGGAAAC
ACAAGCACAACATGGCGAATTTGTTTGTAATCTGTTTTCACACGCAGGGCAAGCTACCCT
TAACTGGGATCATAGTGAATCGCCTGGAGGACACGGATGCCCTGAAGAACGCCTTTGAGA
TAAGCAGTCCCTTGATCGATCGCATTGTAGCAGTTTGTCAGGGTCCGAATGAGGCCAACA
AGTGGGTGGAGCTGCTCAATGCCAATAATCCCAGCTTGCCGATGGGCATCAAACGGCAAT
TGAGTAACTTGAGCAACTCTTCGCTAGGACACCTAAATGCCGCTCATGTAAGTAGTATAT
TTCTCCTATATATTCACCTTTATTATCGTTTCGTTTTGGCGACACTTTAAACCGTGAGCA
GCTGAGTCAACATTTGGATTCACGGGGCTACTGCACGCGATTCTCGCTGTGTGCCTATTA
CTCCAGCCCCCCGTGCCATGTGCGACCTCTCCGTGTGACTCTTCCCCCAAGCAATTACCC
AGCAACAGCTCCGTACGCCAATCTTAGTGCTCACTTTGCCAGGCTTGTTAAAGGCGGCGG
ACTGAGGAGTGCTATCGTAAAGATGCTTCTGTATCCGCAGGCTCGCCAGAGCATCGATCT
CAAAAGGATTGCGTTGCGCAAAAGGCGTTGTCACAAGGCATCTGCAAAGTTAAAAGATCT
CAATACCAATCAGGATTCGGGGCAGTCCGAGTTGGAACGACAGGATGCAATTGAACTACC
AACGGACTCGGAGAGCTATGACGATGACTTTGAAGATGATTTTTTGCATTCCTGCGACTC
GGATCCGTTTGAATATGTGCAGTTTTACCAAAACAAGCGGAACGATTCCATGTGCAACTC
CACAGGCACATTCGTGGACCATGGCACGGGTGCCAGGAGGCACTGTTCCTCTATCAACCT
CATTAAATTGGATTCCGCGGACACGGACGAAGTTCTAGCGCTCAACGAGTTAAAAAAGGA
GTCTCTTGTTATAGGATCCAGAGCACTAAGAGCTTTGGCTCGGAAGTCCACGACTCGAAA
TTCCAGTGTGCACACATCCACGGCAACTTTGGAGCTAGGTGTGGGTGGCAGCATCACAAA
CTGTGTTGAGGAAGAGCCAATTCTTAAGGTCAAGCCATCGTTCTCCCTGCAACAACAAAG
TTCCGATGCGAGTTCCATTTTTGCAGCTAGATTGGGCGGTGCATTCACCGCCTGCGAGAA
TCTGGCCAGTATGCCTGATGATCTCAGCAGGGAGTCGAGTATCCAAGAGCCACCCACTCC
TCTGCCAGCTTCACCGACAGAACGGCACAGCATGCCGACCATATTTGTGGGCAATCGGTT
CAACCACAGCAAAAATACAGAGGTATATGTACCGACGTGGCGAGATCGCCAGGAAATGCA
GAATCAGAGTGTGGATGCGAAGCAGGATGAAGAGTTGCACTCCAGTTCCATTGATCTACC
CGCCGCCTGTCTATCTGCTCCGGATAAACTGCAAGCAGAACTACTCTACAATTACGACGA
GATCCTAGAAAAACCTCTACAGCTGCATCGGGAGCTAACGCCCTTTCCGGGCCATAATCT
TAACTCGGATAAGCGAGTTTCCCACAAAAGCGACAGTCCGTCGACAGGAAATGCAAAGAC
AGATCCAAATCTTGCCACAAGAAGTAGTTCCACCACCGAACTCTGCATCGATACCACTTC
AAAAAAGCGCACAACCCCGTCAGAGAGAAGCCGGGATTCCATTAGGCGCTGCATTAGCTA
TCAGTTCCTGCAGATGTCCAATCGACCGCCCCCTCCACCACCGCCACGCAGGGATCCGGA
TCTACACTTAGACACCAAATGCCGCTGCTGCGAAAACTCCCAGTGTCCCAGTCCGCGATC
GAGTGACAGCGGAATGGCTGGCAGTTGCACTATTACATCACCGGATCCGCCCAATCCGGA
ATCATACTTTCCCATGGAGGCCGCAGGCCACGATATGCTGGATAATGTGGAGCCAGAGAG
GTTTGATGTGTGCGGAATGTTCAGAGAGAAGTTCCTCACTCCGGAGGCTACTCAGGATGT
TGTTGATCTATCAGAGGAGCAGCCTCAACTATCAGATGAACCCACTACCCCTACCAATCG
CAAAGAGGAACCTACTTGCATCACCTCTGCTCAAGTGCAAGTGAACACAAGGAGTATTTT
TCTGCCCTCCAGCTCGAGCATGGATGAGACTAACAGGAATGTCCCAGCCAACAATATCCT
ATTTAGCTCGAGTTCCGCGGATCAGTTGGAACCGCAGGCCACCTTTCGCTCGGGGATGTA
TGCGCACTGGTGGAAGAAAGAGCGCCTTCCGCCGGAGGTGGTGCGTGGCATAGCCCACGC
CTACAATAAGAGCTTGCCCTCCAAGGACTCAAAAGATTCGGGATCGGTGTGCTCCAGCTG
CTTCTGTTCCCTGGGAGCTAGCGGTTACAGCGAGGGCGCACTCTACTGCTCGGTGTGCCA
AAACTGTGCGGACTACTACAACGGCAGTGTCACCAGCACAACCAACACGACGACCACCAC
ATCATCCGCCAGTTGCCCACTGTGCAGTGAGGACGAGGGCATGATTGCCCCCACACACGA
CTCGTCCTCGCTCGACTGTCCCATATGTAATGGCCGCATTGCTTCCGGCGCCGAAGAAGG
CAAGCAATCCGAAATGGATCGACGGCCAGGTAATCTAAGGATTCCTGTCGAATGGTATCC
GGTTTACCTGGCTGGCGGCGTTTGTTCCGTGCACGTGTTACGTTTGATTGTTTTGTAAAT
TCGTTTTGCTCTCATGTTCACCAAATTCAAAAATCCCTTATGCTCTACCAGCAACCATTT
GGCCAAATGCAGCACGTCCAAAAAAGTCATCACACATTGCTTCCTCATCAGCACATCCTT
TGACTAACCCAGTGCGAGTTCATTATTTGCCCAAATTTCCAATGGAATTGGTAATAAAAC
AATAAGTAATGGCTTTTAAATAAATTTCTTTAAAGACCAGTCTGAAATAAACATTTAAAA
TTTCATCAAGTCAACAAATTTATTAAATGTGTAAATAAGTGAAACTAAAGCATATGATGT
TTGACTTCAATTAATATTTGAATATGATGATTTCTGAATTTTCGGACTTGCAAATGGCAT
TCAATGAACATTGGTTCTGTTTTTCCTCCCTCCGCTCTGGGCGGTAATTTCATCCGTCGT
AAAGCTAAACGAATTACAAAACATTAATCTAACGCTCTACAACACAAAAATTCGAAATGA
GAATGAAAATTACAACCAAAAACCAATCAAACGCATTCGATTCGATTTGCTTGCTGCGCT
TAACTCGCTGCAGGATTTGCCTGAAGGATTCACCTGCTGTTGTACGTTTTCTTGTTGCTA
TTGCACCGCTGATCCTGTTGACGGCGGGCCACATAGAGATTCTTTGATTAAAACTAACTT
ACAGTATTTTATGCGTTAAGATTAAATTAGAGAAACACAAACACTGTTAACCAGAACCCT
TCATCTCTTGCATTGTAGATGTCGCCGCCATCAAGCCACATACTCCTACCGCCCGGCGGC
CGTCCGCCAGCCACTCCCAGCAGCATCCCGGCCGGCAGCAGCAGCGGAGGGAGCCACAGC
CACCAGGGGTCTCCGGCCACCAACTCGATGTCGCATCACAAACGGAGCCAGTCGTTCAAC
CACCATCTCAGCTACAATCAGTACACGCCCACTCAGCCTCCACCACATCATCTGCATCCA
CCACAACCACCAAGTCTGCCAAGTCATCTGGGGGCATCCGGCCCCAGATCAAGTTCAGCC
CAGACACCAAACAGCAAGACAGCAGCTCCACTCCAGGCGTCATCCATGGACGCCAGTCCA
GCAATTCAGGCAGCGGCAGCAGCAGCGGCGGCAGCGGTGGGAATGGGGGTGCCAAGCGCA
AGGAAAGGAAGCACAAAGGGTGAGAAATTGAGACCTTACTCCGGGATTTGTATGTTTTCT
ACTTACTACTCACTCCCTGCCTGGTTTTCTAAATTTCCCATCACATATTAATATTTAAAC
TAAGCATCAAATGTGTTTTGCATCTGCAGCTAACTGGACCATCAGCTGCCTGCGACCCAC
GCCGCCGTTGCGACCCAGTTTATTGAATGCCACCAGCGGATCGGGAAGTGGCAGCGGTGG
CAGCGGTGGCGGCGGCAGCAGCTCCAGCAATGCCCTGGCCAGCTACTGCAGCGGAAGGAA
GAACCAGCCCACCTATGAGGAGGACGCCCTGGTGCTCCGGGTTTTCGAGGCCTACTGTGC
CGCCTATCAGAACAATGCCAGGAACACCATCCACTCGGGTAAGTGGCGAAGCCCATCCCA
GATGTGCTTCATATAGCTGTAAGGATTTCTATGTGCTCCCGAACCAAGTTTGATTATAAT
TTGCTGAAGAACAAAAGCTACAACCTGTTAGCCAAGTTGCTTATTTACACCCACACTCAC
ACACATTATACACAGCTGTATAATCCTCACACAAAACACAGACTCACTTAAGAGTTCAGC
CGCTAAACAAACCACTTATCATTTTGTTGGTTTGGTTGCTCTATAATTTCATGGTTTTAT
TCACTTTTCACAAGGCGTTGCACTATACCAAGAAGAATTTTCCAAATTTAATCAAAAATA
TTGTAATAGGCTTAGTTGAACCATTAACTTTAAGCTTACGAATTGTTAACCAGTTACCAA
ATTATGTTTAAGAGAAAAGATTGATTTTTTGGTTGAACCATTGGCCACTGATTTCGTTTT
AAGATCAACAAACTCAACTCTGCAATTGGTGCTAAGCAGCGAACAAAGGAATCCAAAGTT
TTTGCTTTAAAAGATGTCAATTATTCTGTATCTCTATAGCTATTATTTGTATTGACAACC
ATTGAATTCGAATTACTTTGTTTCTTACTTAAATAAACATTATTTTTGTTATCCCATTAC
CCGTGTAAACCTTAGTTTAATTTATTCTTGCCGCCTTTCGTCCGAACTCCCATTCCCAGG
CTCACATTATCCTCATTTCGACTAATTTGTTACCATTAACATCAAGCTGCACATTCTGTA
TATATGTTGGATTTTTGGTTTAGGTTTTTGCTAACCATTTTGCACACTCATCCCACAGTC
CTGATTCAACTGCAACTGGTACTGTTGTGGTCCCCTGCTAATGGTACTGGTACTATTTCG
GGTATCCTGTAGGCGATTTCTATCCTCGGTGTCGTACTCATCATTGTAGAAAAACACTAT
CATTATTCTCATATCCCTGCTTCATTCACCTTCTCCACCTTCATTTGGTTGTTGTGGTTG
TCTCCCTTTTGGCGTTGTGATCCCCTTGCTTTTTTGTTTGGGTCTTTGGTTCTCATTGGT
TTCACCCGTTGTCGTTGTCGTTGTTGGTATTTCGTTTTCCGTTTCTTCAAATCTCTTCAT
TTTTCTCTCTCTCTTTATTCCACTCCGACCTGATCCAAACCGATCTATATATAGCCTTGC
AACCCTGGACCCCGTGTCTGCCCATCCGCGGTGGCAAGCTGAAAACGAGCAAAACCTTCT
CGACCTCCAATCCACAGCTGCCTTTCATAGCCAATGTCGGCAACTCAGCCTACCTCAATC
AGCACCAGCAGCAGCATCTGCAGCAGCAGCACCTGCAGCAGCAACACTTGCAGCAGCAAC
ATCTTGCCCAGCAGCAACCAGGTCGTCAGCACTCCGCCGGCAGTTTGAACTCCTCATTTA
TTTGGCGCGAGGCGAGCCCGAACAACTTCAACCTATACTCCAGTTCGGTGTCCTCCTCGC
TGAATGCGACACCTGCCCAACGCTACTCCTTATCCGGAACTGCGGGAGGATCGACGTCCA
TCAAGGACTACCAGAGAGCGCTCTCCGAGGAGAGGGCAACCAGAAAGTCTCTGAATCGCC
TTAAAAGTGGCTTTGGTTCGGGCTACGACAATGTGTGTACATCACCTCTGCTGCCGAGGA
AAAACAAACCGGCACCAAAGTTGGTGGCCCAGCAGTCGTATCAGAGATCCCCGGGAAACG
CCACAGCCACCACTATAGTGAAGCCGAATCCGCCAGGACACCCAGGACTTTACGATCGCC
GCTTGAACCGCTCCTTTGAGACCTCCACTTCGCACCGCTATGCCGGGTATGGAGCGGGCT
ACTTGATGAATTGCGGCGGAGCCTTGCGGACCAGTACGCTCCAGAGGAGCACTCCGCAAC
TGGCCGGTGGTGAAAGATCCGATGACAGCGATGTGGAGCGGGAACTGCTGCGGGGTAATG
GAGCTGGGCCCACGGCCAGTTTGGAACTTAATCCCGATGGCAGCAAACGGCAGTCGGGCA
GCTGGTGTTGCGGTAATTTTGTGATGAAGCAGTGGCGCAAGATCAACCATGTTTGAGTCT
GGGCTTGGGGCACCACCCACCATGCCTTCATCAATCATCCGCATCACATCGCATCCGCAT
ATCGCATCCCGCCGCTCCAGCTCCAGATACAGATACAGATGCTTTGCTTTGAATGCGCTC
TGTGTGCGAATCTATATTGATTTTTAGTTGATTTACTGGCTGCGCAAAAGCTTCCAATGC
CACAAGCCTTAGATTCTAGACCAGCGAACTATATGAAGTTGTAAGCGAATGGCCGATTGA
CTTCTGCTCGCTTTGATTGTCTTAGCCTTAAGCTGCGCCTTGATGTGTCTGCGGTGAAAT
TCGGCCAACTGCCTGAGGTTATATTCAATGCATATCAGGCGGCCAAGCGAATTTCACGGC
ACCTAGACTGTAACTAGAGTTTGTGCTTAGCTTATATTGACACCTACACCTAACTTAGCT
TATTATTAATATGTAATCTGTGAAAAGACTTGGCGAAAAAGCGACTAGTTTAGAAGATGA
TGATGCTTGCCACTGAGTGCAACTCCTAGTTCCGTTTTGAATTTTTATGGAATTTAGTTC
GGCTTAATAAGGGCAGTCCTTAAATTTCCGTCCACGCGCTAACGAATTCTATTTTTACGT
GGCCAATCGAGTGCGGATCACAATTTTGCCATAGGAATTGCCTAATAGCCATAGTCCAAA
CTATCTACTAGATATACTCGTACTTCCTAATGCATCTGTGTTCTTGGAGGACGTTGACCT
AGTGAGTTTTTTATTAAATGTCCGTTACCTGCCTAGCAAGCAATTAAATCAAAGAGTGTG
CAATGTGTAATCAAAGAGTGCGCTTTAAGTGTTAGTCATAGCTAGAATCAGCAACTAAAT
CAAAGTAACCAACTGTTGTGCATTATTGATCGATGGATAAACGAACTTATTTTGTAAGTG
TTTTGTGTAACAACCAAATTAACTACTATATGCTCTTAAATACTATTAACCAGTTTATAC
GTTTGTACTGTAATTGAGTTGATATTTGTCGACGCGAAAGAGGGATGGATAACTAAAGGA
ATCCAAACGAACCATGAATAAAATTCTTTACAAGACGAATCTTCCTTTGTTTGTCTATGT
GGTTGTGTGCTTTGTTATTAATAGTTATAGCGATAACTTAGATATACCCTTAAACTTTTA
GAGTATCCCATAGATTGATGTCCTGTAGTCGGAAGCCCTTTGTTTTGGCACCCTAGCCAT
ATGACATTTAAGATATACACTTCTTATATTATCCAAGCAATAGCTTATAGTTTATAGTTT
TTATCACTTACGCCTAAACATTTTTCTACACCTACACGATCATATTTTGTACATTACCAT
TAATCCACCCTTCTTCCCATCCGATCTCTCGCACACAACACTAACATATTTTGTTCTCTG
TTCGATTTTCTTTTATCCACCGAAACACACACCGGCATGCAGGCCTTGAAAACGAGGACA
TGACCCCCACCCTGCGCCAACTGTGGACCGCCATCCGCCAGATGCAGCAGGACATGTCCC
AGATCAAACTGCAGATCAATGAGGAGCGGGCCCTGCGAGCCGATCTCCAACAGCTGCTCA
TGCAGCACTTGGAGACGAGCAGTGTGAGCAGCGGGGCCAACACCCCCAAGTGTTGACTAT
GCAAGTGACCCGGAGGGTTCTGGAGGGGATTCCTCGGTACCGATACATCGAAACAATACC
CGCCGCTGCTTTTAGCTTTAATTCATTCTTAGACACTTTTACTTTGCATCTTCGGGGGGC
AGTGGGTCAATTACCAAAAAATTATCTACATATGGACTTTGTAATCGTATATGGATTGTA
TTTACCGAGTACTATTTATGTGTATGTATACTTGTGAACGGACAATATGCCAATTGTATG
TAGTATTAACAAGCATCTGCTTCTATCTTATTATCATGCGATCTATCAAAGAGGTTTCGG
TATGTCTGAGAAATTTGCATGTTAGTCAAAAATACTTTGCAGATCGCATGCATAATTTGA
ACTTCGGGCAAATTTAACAACATCGAACATCTGCTTATAGCCCATCAGAACATAAATAAT
TCGTTATAATGCCTAGATTTAATCTTCATTGTAAGAGCCTAGCACAACATGCATATTTTA
CTGGCATAGATTCTACACATATTAGACTTATTGTATTTTACCTATTTTACGACGTTGCCA
CCATGCAACTTTTGAGAGCTGCTTGTGTAAGTTATACGAATAGATAGACCCAGTTTTGAT
CTTAACTTTGACGATGATTTCAAATGGACAATGCAAAATTATTAAAAATGTGCCAATACT
TTAGTAAGATGCAGCAACGTACGAAGAATCGCTCAAAAAGTTGTATTTACCGATTATACC
TAGAACATTTATTGGATTAATATACACGCACAGAAAATGTAAATGAATTCGAGGCTTTCA
TTGAGTTAGTACATACATTCGCAAGTGGCAGCATCTAGAGATTGCAATCGAAACCCACAT
AAGCAGAACAGAACAGAACCACTCCGGATCCCAAGAATGCCTAACGATTTAACGAGTCTA
AAACAATGTATAACCGCTATCGCTTGTCTGACAATTTTTGCTGAATAATTCGGAGTGCCA
GGCGGCTTTTCTGCTCTGCTTCGTGCGACTTGGCAAGAGGAAACCCGTGTCCGACTGCAG
GGGAGCATAATGAGATTGCAATCAGTCAGCGTCAGCGGGAACATGGAGTGGCAATGGCGC
TGGTAGTGACGGTGGTAGTGGCGGTGGCAGCGGCAGATGGCGACAAATGAGCAACAAACC
ACGTCAAGAGCGAGCGACATTGTTGGCAAAACAATTTCAGTGTGTCAGTAAGGATTTGAG
AACAATGCAGGCTGCCTGCTTGGTTGGTTCCCTGGCTGACTCGTTGGCTGGCTGACTTGG
CCGGAATGTGTCACTTCCACTGCCTGGGCTCGGAGGGCCGTGGAACCCGGGTGCGCGGTA
ACTTTGGACTTGCGGATACGAAGGCTGGCGGAAGTTTTCGCATGCAATCTGAGAGGTTGG
TCCTCCCTCTGCTTGTTGGCCGAAATTTATTGCAGCTGCTTAGTTAAACGGTTAGATATT
GTGGCACCTAGGGCCTGTGGCTACACTCCGGCTTTAATGGCAATCATTAGTGCCTTGCTC
TCTGGCTGGCTGCTCTTCATATTTTCCAGCTATTAAATTATTAATAATTAGCAATTACCG
CCTGGTTAGCAATTTATTAAGACCTACACGGAGAGAAAGAGGATGCTGGCTGCTTTGGAG
GGGGATGTTGCAATAAATTAAAACTAGGTGTATCGCTAATATATTCCATCGAGAATGTAT
TCTTTTTTGTTATTCAGAAGAAGTATGCCTAAGTTTACTTAGCTCACATAAGATACTTCA
ATTACTATTGCGAAAAGGTTTGAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1459, 5928..6312, 6371..6571, 6650..7070, 7127..7366, 10578..10998, 11129..11377, 14862..15826
5975..6312, 6371..6571, 6650..7070, 7127..7366, 10578..10998, 11129..11377, 14862..15052
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved