Drosophila_melanogaster Locus RpL30
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL30
Drosophila_melanogaster
RpL30
2L
snoRNA:28S-A2113
1591..1663
3041
ggtgcaggcggcaatcattcctgacagcatgcggccacgtaaatggcgttgaattacag
cccgacaatcgaagtgttgaagtcccgaactgaaaagttcactcctgcccgtccggcagc
ggcagcagcagcagcctgtgcatcattcataagccggcccaggccacagattgtctggaa
gcgagtcgagtgcgcacgcacgcaacgagccgatgatgatgagctcaggactcccaaaca
ggcaactttatgactgtgggccatgggttggcattgggttgtggtgtcgtcacgtgccgg
tagccgtctgcgactgactctgactccggatgtggatgcggatgaggatgcggatgagga
tgctccgtgccgccctccttggagctccctaatccacgttgtataattcatttggcgttg
ccgacccgttcgccgtgcggaactatttattcaataattcgacgtaaaagcttgacacag
caatccggggttgtgagccgtcacaaagcaactgggtctcttccaatcacgcagttgtag
ataccttaatgcccacacccactgtttagtgttttaagctctatcacaaatagattttaa
ataaaacacatgctatagttcaacactttgggtgcttggccaacatttaaaggttcaaag
agctaaagcatagaatcatattaagattgttggcattgcatatgtttcgcatcaataaac
gccgtgccatctaattttagcttagattgttgctcgacgcattatcacgatttaaaaaaa
tttaaattcacgcacgcatacaatcttcaagaaggttggcaactacaaatattcgaagtc
gaaaacggcgttaccaatcgtcataactttggaggttgtactggctaaaagatagtttcg
gtgcgtgtccacgctaattgtggattgtgtacacgctaattggtattttaaccctatttg
tattaattggtggtattttctcgcatccccccgtcggtcacACCAACACAAACGTGGTAC
CCATTTCCGCCTGTTCTTCCTCTTTCTTTTGCCATTGTCAGCCGACGAAGgtgggtgttt
taatttttcatccggctccacagaatcactcgactaactaatttctatcgcctgcagTGC
TTTAACCCAAACTATCAACATGGTGGCCGTTAAGAAACAAAAGAAGGCTCTGGAGAGCAC
CAACGCCCGTCTGGCGCTGGTGATGAAGTCCGGCAAATACTGCCTGGGCTACAAGCAGAC
CTTGAAGACCCTGCGCCAGGGCAAGGCCAAACTGGTGCTCATCGCCAGCAACACGCCCGC
CCTGAGgtgagatgcccatgcgtctgctgctaagcagtaggtttccactgtgcccaagtg
accacgtttttgatggaaccatatggagtctgcccttaaagctgactgagaagtatgatt
ccgagtagtggagcagtgcaatcaatcaatctcaagcttcgggactggttcgctttagtc
tacggcgcttccaaatggttcctccaacaacgggcatgcacatcacttggggtaagaagc
cggcatataaacacctagctgtagtctactgcccataatgatgatcctattgattccgaa
tgccttgacgaatcctttttatactagagactctttctgacgctcgaaccaatggctcat
ctgttccaagcgcctttatatcggtactaacatgtgctcttcacattgcagGAAGTCCGA
GATCGAGTACTACGCTATGCTGGCCAAGACTGAAGTCCAGCACTACAGCGGCACCAACAT
CGAGCTGGGCACCGCCTGTGGTAAATACTTCCGCGTGTGCACCCTGTCCATCACCGATCC
TGGAGATTCGGACATCATCCGCTCGCTGGAGACGGCCTAAACATTTATTTTTAATCGAAC
AAGACGACACAATAAAGTTTTGTATGAGCAGAGATAAAGTTTAAAATAAAAACACTATTG
TTTTGGTAAATTCAGTGAAAGCAATGTTGGGATTATCATCAAAAGATTTGGCACGTGATT
CTtgttgtttaagtagcattttatttaaaagaaaacattgtcattttgctttactccctt
aagtacaaacgttttgtattctataaaactgaatctatgaccacgaaattccctttccat
tacaattgggcccaatatacattacgtagacaaacacattaatatgataaaaatgttagc
ttcaaatatggttttgtttggtctaaaatagaaggaaaagttagtttattaatgaaattt
tcgactttagtacttacattctctgcaactttcagtagatgatcaaagctggcctttccc
gtctgcataaccattccatggaacactttagcctttgacgcggtcaacagctcatatgga
gaaccgaactcgacgacgtgaccagcatccatcaccaaaactttgtcggagtccataatg
gtgtttagacgatgagctatcgtgagtactgtgcagtccttgaatttgtttcgaatggtg
gcctgaatcagggcgtccgtctgaggatccacatttgccgttgcctcgtccataactagg
attctattctcgcgcagaatggcccttgccaagcagactaactggcgttggcctacgcta
aagttggtcccgccctcagatatgatgctctgcagacccgaaggcaactccgaaatttcc
tccttgaggtggacgtcctcgagggccttccaaagcttatcatcgggatattgctcgaag
ggatccaagttgtatcgcattgtgccggagaacagaacgggttcctgtggaataatggat
atcttgctacgtaaatcgtgcagaccgatatcatttgtgtccagactgtcgatgagtatt
gctccatcgttgtaggatagtctgaaaagtgcattgataagggacgactttcccgcacct
gtgcgtcctacgatgcccactttctccatgggctgaatcgtgaagctcagtcccttcagc
acacaaggcgaattggtatcgggctcatatctcaggctcaag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 1137..1325, 1731..2041
1159..1325, 1731..1899
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved