Drosophila_melanogaster Locus CG5953
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG5953
Drosophila_melanogaster
CG5953
2L
snoRNA:Me28S-C1237
4956..5055
25758
ATTTAATAAATAACTCAGCGATTTTAGTAATAAAAATCACAATTCTATTATGAAGTAAG
ACCGCATTCATTGAACTTTCTTTTGTTTAATTTTTTTGGGTCTTAGGAATTTTACTACGA
CGTAGTAGACATTTCGTGTCATTTTGGCGCGAAGCAGATTGTGATTATGGCTTTTTATTG
TTATTTTTGTTATTTTGTCTCGACCTCGGTTCGTTCAACTCGTTTTTTTCACTGAACCGC
TCCTGTCTACTTGTTTGTTTAATTTTTTGCCATTTCTGCTTCACATTTTATTTGTTTGTT
TGACTCGGCTGCGCGCGTGTCGTTGTATGTGTGTGCGGCCCAAGAAGCGGTCCGCCACCC
CTCCCCCTCTCCAGCCGACACCCCCTCACCAACCGACCATTCATCCCATCCTATCCCCCC
CCCTTTTGTTGTTGTTGTTGCTGTCGTGTTTCTTTTGCTCTTTATCAAAACAACTGCGCT
GTCGACGTCAACGCTGCGCCGCAGTCAGCCTTCACACAGCAGAGGTAACAAAGAAAAGCA
CGCATGATGCACATCAAATATATATCACTTACGTGATGAGAAAGATTACCAAACATTTAA
GTAAACGGAGTTGTTCATTTAATAACAGACAATTTAATTAAGTTTTTGTAATTTTTGTAT
TTTTATGGCAACAACTGTTTTGGCAAAGAGAGCAAAAGCTTAGGTAAATACTATTTTCTT
AGCCGCTCCTGTATGTCTGCCAATGTTTTTTTTTGGCGCGCACTGCACTGCTCTCTCTCT
CTCCCGCAATAACTCTCTCCGCCGCTCTCTTAACCCCCCACCCACCCTCAACCGACGTTG
TTGTTGCCTTAAGCATGACAAGGCACTGTAGAATTTCACAACAGGCCAAAGAGAACTTCA
TTACGATGTTCGTTTTGTTTTTCCACGAAACAACTGTTTACTCTGCCTCTGCTTCTTCTT
CTGCGTCGGCAGCGCAGTCGGTGCGTTTACAAATCGATGCCAATAGGTTTGCGACTGTTT
GCCCGAACAGTCGACGAAATCCGGTACTCGCGAGCGGTTGTAATTAACGGTAAAGCTGTA
GTTGTTTCGATGAAATATTGCGCGCGTAACGGGAAAAATACGGAGCCGTAAAAGCGCAAC
AGCGCCTTTGAAATAGCGGTAAATATCGACAGTACGTGTGTTTTTTGCGTGAAGGATGTT
TGTTTTCGTCAGAGCCTCCTTTTTGCTTGCCAAACAAATAACGGAGAAGTGATAGCAGAA
ACCAAAAATATCGAATTATTTTCTAATTCAAACGGTATTTATGGACGGGAATATCAGTGT
GAAATATTATTCCCTTTTTTAGAAAAGCGGCGAAAACTGTAATGTACGCAATTAAGTTAT
TATCAGCATAATTCTTTTAAAGGGCATAATTAAAATAAAGGTGCATAAAAATGAATGTAG
TTCAAAACTGTGTAAACGTATCAATTAAATATTAATGAAAACATCACATATGTACTTAAA
AATTTAAAAAAAATTTAAGTATGGATGTTACCTAAAATATAAGAAACCTACTTTCAAATT
GTGAGACAAAAATAATTGTTTACGAATGGAAAAATCAAGTAATCATTGTGAAACTTAAAC
TTTAAAAATATTTTCAAAAATATTTTTTAAATAAAAACCATGTATCGAAATACATCAAAT
ATGTTGAAACCCCTGGAAAACCTTGTGCAGCTTCGAAAACAAATATTTATGTTGGTTTAA
TAAAGAAAGAAACACCCCTAATAAGTCAACAAATATTTAACAAAAAGTGTTTTTCAAATT
TATTTCAAAACACATATAGCATGTGCGTTCGCGAGTGTGTCTGCGTTCGATTGTAAATTG
TTTTTTATTTCATTCCGCCCGCCTTGAAATGTATTTTTAAGTTTCTGTGCTCAATTTCGC
GTTGGATGTTGTTTACTTTTTGCGTTGTTTAATTTGTTTTGGCCTGTGTTGTGTTTCTCT
CCCTGAGTTTCTTCTTTATTCAAAATGACAAAAGGCGAAAACAAACTAAATTGTGGATAA
CATGGATTTTATGCAAATTCAACGTTTTCTGATTCAGACCTTTATTTCGGCAGCGCTGTT
AAATGAATTCAAAATGGTCGAAGAAATCAGTCAAATAAAGCGTGAAGTATCAAAAAATCT
GTGCAATCAAAATGCTTCGTTTTAAGATCAATTAGATTATATAACTCTCAATATTAAAAT
CCGAAGCAAACACACTACACTACAGAAATTCAGCAAAGTTCAGAAACAATTAAAGTAAAA
TCAAGAAGTTATGAACAACACACCTTATTTATAAATAAACATCCAATAAAATGGCAACCT
AAGCATTTCCGTCCTGACTCACATTACAAGACAATAAAAACGGTGACATTTAGAAATTCC
TGATAAATTCTCCATACAGTCGCACATTTTCTTGGTAATCAAATAACAAATCAAAGCTTC
GAGACATGCAAATTAATTTTGAACGCAGAAAAACCCAAATTCTACTATTCACAATCAGTA
AACAACAAGAGTACAAATATAAGACCGCAGAATTCCAAGAAAATCCCTCAAAACTGTGCT
ACTTAAAAATACCACGAGGTCGCAAACGAAATGCAAGGAAAAAACAAAAAAAAAACAGCC
AAAATGGCATTTAGAGTATTTCCAGCTTAAAGCTACAACGGAAAATAATTGGAAAATCAC
TTGAAAAAAAGACAAGAGCGAAAAAGTGCGTAAAAAAAGCAACGTGGCGTAAAAAACAAG
TCCTAAAAATAGACCAAAATGTGTCGCGTCTAAAAATTGAGGCATAGTGCGGCGCAAACA
ACAAAAGCAAACAACTAAACACAATAAAAAAAAAACACACACGGATAAAACACAAACAAT
AAAAACCACACGAAACGAACTAAAAACAAATTAAGGTTTATCGCCCGTCTCTTTTTAACT
CTGCTTGTGTGTGTGTGTGAGTACCGTGCGCGAGTTTACCGTTATGATTCATCCAGCTGT
TTGCGCAGCGTAGCAATCTGCGCAAAAAGAAATACTTCTCGAACTTTTGTTCGAGAGACA
AAAACCGATTACTAAACGATTTATTTCATAAAATGATGTGTGCTAATTCGTGTACTAAAA
CACAAAGACATTTATGTACTTGTAATTATAGTTGCGGTTGCTGATTAAGATTCAGTTATA
AAGTCCCACCAATAAGTTTACAGTTTTCAGCTTTAATATGCAGTTTGATTATATAAATAA
ATTATAATTGTATTTCGGGGTAAATGTTTATGCTTACCAAGCAAAATTTAGCAGTCTAGC
ACATGAAGCATTATTTTCTGCAGTATTTCTAGTAAATATAGAGTACATTTATTGTCTTGT
TCTAAAAATTCATAAAAGGATCTCCCAAAGCCTTGATCCCTTCCGAAATCCCTATTATGC
TGGCCGCTTTTGTGCTTTGTAAGCACGAACGACAAGTGCTAAAACGTAAAGCAAATTGCG
CTCGTCGCCAAAACCAGGAAGCAAAAAATCTACGTTCGACAAAGATTGATGTAAAAGCGA
GATGCCGCATAGTATAAAGCCCCATGCGCTTGTATTGGTGCGAGTGAAAGCGCACGTGTC
CCTGGGTGCAGATTGTGTGTGTGCGAAATACACTTCCGTCTATTGTGAATGACGAGGCGC
GAGCAGTTGCCTTGCCATCTTTGTTATCGTTTGTTGTTGCCTCTGATTCGGCTTCTGTTG
ACTTGTGACATTTACACACACGATTACGAGGAAAAAAAAGCATTTACCACTCACGCGTTT
TTCTTGGCAGAATTTTCTCCGTTCGCTGAAACTGCCGTATTTCGCTCAACACAAAAGCCA
TTAAAAGTAATTTTAAATTGTGGTCTAAAATTCCTACCTAAGAAAGGTCCGGGTTCGACA
CCCACTATTATAAACTAGTATAAAAAGTATAAAATTTAAAAACATTCAAATACTTATCTT
AAAATTCGATATTTGTGCCCGTGTAAAGACTGTTACGCGCCGAAATGCTAATGCCTAAAA
ATCTGCTTTGTCATCCGCTGCGGAATTTATTCGACTATTTAATTTGCTCTATACCTAGCT
AGCTACGTATATACTATAATATAGTGCCACTGACCTAGGCAGACGATGACGTGTGTTCCG
TAAAAAAAAAACTGATTATAAGAAATTGCTGGGAATTTATATAAGGGAACGTGCTGAATG
GAAAATGCTAGTTTCGATTGTTTTCACTGTTTGCCAAGATTACAAATGTCGATCGATCCG
ATCAGTCAGTTATGGTTCAGATAATGGCGATCATTACAAGGAACGCAATTTAACTTTTTG
GTTTTTCCCAGCACTGATCTGAGAGCATTATAAACACTTATGGAATTTCCTCAGCAATGC
ATGTGATATTTAATAGATAAAGCTACGTCACGGCTACGGGCGTATTTCATAATTTTGCGT
CACATTATGGTTTAGATAAAAATTTCGCCTAATCTATCCTTGGAGACGTACCCGATAAGC
TCGAAGGCTGAGATTATTTTTGGCTGTGGGTAACAGATATATTAGTTGGTTTTAGGGATT
TGAATGAGGCTAATAGCTTTGTGGAATTGTCAAAAATAAGTGAATTACGAAATGGTTTTT
AATTATACCATATAAGTTAATTAAAAGTTAATGTAATAATTAAATACATTCGCAACTGTC
AATTAGCTCAGTAAACAATTAAAAGAGTTTGATATATGCCCGTTTTGTTTTCAAAGCAAT
TACGAAAATCGGAGTAAATGTTAGAATTTTAAAATATGTACTTTTCTTTTCCCTTCCGTA
CAATCAACTTTCTGCCCTCCTCCGTTTACATAAAATGTCATTCGAAATTTATCAATTAGA
TGTCAAATCAAATAAAAAAAAACCCCAGCAATTAGCACGTTTGACTGCCACTGGAATTAC
AAATATAACTATTGCAATAGAAGGGAATGTTTCTGTAGGTTGATGATGATCGTCTTAGGT
TTTAAAGTTTGCTGTTGTTAAGTTGGCTTTGCCCATGCTTGGCTTGTTGGCCACAAAATT
TCCCATTACTGATTAACACTTTCGCGCACAAATAAGTTAACAGAGAACATAGGCCCGTAT
GAAATGAAATCATAATACACTGACCAATGGCGATCGATTCGACAGCAAGTATTTGGCCGC
AAACAGCTCGCTGAAAATGTTTCGAGTGGTGAATGAGTGTGTGGCATGACTCATGGGTAT
CATTCGATTCGGGGACGGAATGTTTGACGTGCGGGAAAAACCCGGCGATAACGTAAACAA
AACGATATATGCCGAACTAAACTTGTTTTCGCCGCTTTCGAATTGAGGATTATTTAAGTA
ATGTGTGAAAAGTGGCTCAAGAGTAGGAAACTATTTTAAACAACTATTTCGGATCGTTTG
AATGACCAATTTTGTCTTTTATTTTCTCTGTGTTTTCAGTTAATGAAAGATAGTGAACAC
AGTGCTAAATGAAAGATAATGAGACCCAGTCGACAGGACCCAAGAAGACGATGTTGATTG
AGTGCATTTCGCGTGACATTCCCTGAGAGTCAGCTTCGCAAATCGCCAGAAAGCAGAAGT
AAAGCTCAAGTGTCGAGCTCGGCTGCACAGATCTGTACATATATATATATATATATAAAC
ATATACATATATAAGGCAATCAACCATCCAACGATCGGTTGAGAGGCGTGGCAAATGAAC
TTCAATCCGGCCAGCGTGGTAGCCGCCGCAGCAGCAGCCGCACATCAGACGACCCATCTT
CACCACCATCACCATCATCATCCGTATTTAAGCCATCACCAGAGCAGCATCACCCAACCA
CAAGGACAGCAACAACAGCTGATCCCACTGCCTGTCGGCGGAGGAGGCGGAAGTTTACCA
GTGGGTGGCAGTGGCGGTGGCGATACATCGCCCAAGATCATGGAGTGGACCAACGACGAT
GCTCTGGAGCTGATTGAGCAGTATCGCTGCCATACAGAGCTATGGAATCGTGCCGATCCC
AAGTACAAGGATAAACTATGTCGATTCCGGGCATGGTCGGAAATAGCCGAGCGTTTCGGT
TGTAGCAAGGCGGAAGTGGAGCGGAAGATGAACGTACTGCTCACACAGTATCGCCGGGAG
AAGCACAAGATGTTCGTGAAGATATACCAGGGCATACAGCCCAATCCGTCCAAATGGTAT
GCCTTCAAGCGATTCGATTTCATGGAGGCGGGCGGCGGCAGCCTGAGCGGCGGTGGGTCC
GTGGGATCCGGTGTTAATGCCGCCAGCGGAAACCTGGTGCCGAATCCCGTTTCCTCATCC
GCTGCCGCTGCCGCCCACAACGGGCTAAACGGACTGGCTGCCGCGGCAGCGGCCTACGAA
AGCGGTACGATTGCGGCGGCGGGCAACGGAGGAGCACCACCCACTGTACCAGGTGGCGGA
GCACCTGGCTCACAGACCGTCATGCAGCACAGACGCATCAAGACCAAAGAGCTGAAATAT
TTCGGAGCGGTAAGCGAATATTCTAGTTTAAACAAATTCCATTAACTTCCATCGGTGCAT
GAGAAAACAAATGACGCACGTCAAGCACAAAAGGTTCGAAAAAATCCCCAATAGGAATTA
AACAAAATGTTGGTTATATATAATTATCAATTTATTTTGATTAAAGACAAATCAATGGGA
TTTTTATACTGTTTATAAAAATGGTTCGACTTATAGATGATCAGTTTTCTCAATAGTTAC
TGTTTTTTACATGTACATATGTATTATGTTGAAAAATTTTAATACTCATCCAATTACTCA
AGGGTGATCAATTGTAGAAAATCTTTTTTGAGTGTGCCCCAATAATTTGTTAAAGATTTT
TATTTCATTGAGTAGAGTGCCGTTCTTATCGTATTTACACACACATTCGTGTGTATTATT
TACGAAAACCAAAGTCCACAATGTGAAAAATTAACCAGAATTAAAACAGATCTTAACCCA
AGGAGGTTAAAATTTAAAAACACACACAAACGGTATTAAGCAAACATTTTCCACGTTTTT
TTTTTTTATTGTTTTCCAGTGAAAAAATTTTACTTCTACAAAACTGAAAAGTGCTATTTG
TAAAATCACATGGAAACCAAGGGAAGTCGCCTTTTTTTGCGAAATCGTTGGACATTTCAT
TCGAAATATCCGTATTTCATTATATTCCTTAGAACTCTTATCACAATCAACTTCAATAGA
AAAAGTTTTCAGCATTAGAGGAGCACACACGTGTGACGTGTGACCAATTTTTCGGCTTAG
CAACCAATATTTATTTTACACATTTCATTTTATATTTTCGGAAGCTTATCACTTCAATTG
AATATTTTAAAAGCAAACATGAATTTCTAGTGTTAATTTCAATCAAAACAACGGCTTCGA
GTTAACTGTGAAATAAGATGGAGAGTCGGCGTAAGAGAGCGACCACGGTCTGCACTCTCT
TTGGCGCTAGCGCTCAGGCAAACATGTGCGCAAGTGACTTGCTATTTCTGCACTGGCCCC
ACTCTCTGGCGCTCTCTTATTGGCGGTAGTGTTAGTGTGCTCGGCTTGTTTGTGCTCTTT
TTTTTGTTGTTGTTGACGATCAAAACAGAATTAAAATTTTACGCATAAATTTTTCTTAGA
AATGCGCAGTGGTGTGTGTGCGAGGCATTGGCCCCAGCTCTCTCCCGCGCCTCCTCCCTC
TCCATCAGCAAATCTTCCCCTCCCTCTCGCACTGTCTGCCTGCTTGTTGTTGGTATTTTT
GTTGCTTTTATATGCGTTGTCGCGCCAGGCAAGCAAAAAGTGTGCGAGGATGAGGAAGGG
GGTGTCTTGTGGCTGGGGGGCCCTGACATTTCGTCGCCGAACTCTTCTTCGTCTTCTCCT
TCGCCTGTTTTTGCTGTTATTGTTGTTGTTGTTTCTGTTTCTCTGAATGATGAAATGTTT
GTTTTGCACAGCGAAATGTGTTGGCGACTGCGACGCCAGCAGAGGAGCAGCAGCACTTGC
TATGGTGATTTTTTCACCAGTTTCATTTTCTTCTGTTTGTTATTTTGAGTCCCCTAACTG
TAAGGTTGAGATTACCTGTGGGGTTATCAATATGCATATCCATTTTATAGGCACTACCTG
TTAAAAAAGTTTTCCATTGCATTCTACACCAAATGAACATACATATTTAACTTTAATAAC
ACTTAGACTTAATTAAGATAGTAACTGAAAACTAGAAATTAGAAATGTGCTGGAGCAGCC
CATTTTGCTAGCTAACTTGAAAAGAATAATGCCAAACTAGTTTGCTCAAATAATACTTTC
TTTAATTATTTTCAAGTGGTGTATTTAAATTAATTAACAAAAAACCACCGTAGCTATTGA
CTTTTAACCAATTAATGATTCATACTAACTGGCAACTTCGGGTCTCGAAACTCCGCTACG
AACTGGCTCTTTGTTTTGCTGTTGCTGTAGTGACGTTTTGTTTTGTGGTTACCCAGTGGA
CACCACCTTATGCCCCAACCAACCCCAAGTTTCCACAAACCCCCCTCCCACCCCTTTGCG
CCGTGATTCGCTGGAAGCTTTTGTTTTTACTTGGCTCTGTTGTTTGTCAGACTTATCAAA
ACAAAATGCCAGGAGTTGTTGCTGGCTGCTGCCGTTGCTGTTCGCCGACTTTGACTCTCT
TCTGGCTGTTTTCGCTTGTTTTTTGCTGCCGTTTCTGGAAAACAAATGAAATTTTTGCAA
GCCAAAGAATATAAAACTTGGCGCCTGGACTTTTTCTCAGCTTTTTGTTTTTACTTTTCC
TCGTACTGCGGATTGAGTAGGGCGGGAGGGGGAGGGGGGCGGAAGGCATGGGGCGATCGG
GGGCGTGGCTTGTCTAAATGCATGCAACTTGTTTGTCCAAGTCGTGTCACCTTTGGTTTT
CTGGTTTTGCGGTCTCAATACAAATTTCGGCACTTACGGTCATCAAAATAGAGCTGTTTA
AAAAGTAAAATAAAAAAATTCCTTAAAATATTCTTAAAAGAACTATTTTTTTAAGCTATA
ATATTCTAATTTGCAAATAATTTGTTCTTAAATGAAATGAAAATAAATTTTATTATGTTT
TATGTACGTACATATTATTTATGTATGTACACATAAGCTTGTTTTAAACCTGCTAAGAAT
GTTAAGTTATTGCATCATTTTTTATTTATAATAGATAAAATATAAAATTGTATTATTTCT
TATATGATGCATTATTTTCAAATATATAGTATATTTTGTTTGTTTCTTGCTCTTTGAAAG
GGCGTAGTTATCCATGAGCTAATTCGTTTAATGTCTGTTTTTTTGTTGTGATTTTTTTTG
TATCTCACTTTGGACAGGATAAAATCGGTTCACACTGGACGTGCTCCCATTTAATCCACT
TCCTATGGCATTTTTTTAAAAAACTTTTTCTTCTTCTTCTACCGTTGCTCCGTTTTTTAT
GTTTTGGTTTGGCTTTGGTCTCGTGTTGTTTTTCTATTTCTGCGTCATTATTATTTGCGT
GTGCAGGCAGCACTAACAACGACGCCCACGCCCCCTTTTCAGAACGCCCACCTACGAACA
GAGCACCCCGCTCCACCACCACCCACGCCCACCGCCCACCTCCCACTTATTGTTATGTAT
TTTTGTTCATATTTTGCAATTGTTTTGCTCTGCGGTATTTTCCTCAAGACAAGTGAACAG
TAAAAACAAAAACAAGATGATGAAGCCGAAGAGGAGCTGGTGTTTTTGTTATTATTGTTG
TTTCGGTTGTTGTCCCGCAATGTTGTGGCTAGCAAACGACTCACGCACCGTCTCACATTT
ACCACCCACAATTTGCAGCACCCAAATTGAAACACCTGCAAAAAAATAAAAAGTTATTAG
CTTGAAAGTAGCCTATTTATTGGAGATATTGGCAAAACGCGTTTTCTTTAGTTTAGGTAC
GAAGTAAAGTTGATACTTCATTATTTACAGGTTAAGTTGAGTTTTTTAATTTAAAATTGA
TTTTAAGTACCTTAGTAATTTACCTTTGTTTACATCACCTTTATAGTTTAAATATGAACT
CTTCCCTTGAGATATCACGTAAACTGTGTTCTTCATTAAGATATTAAATTAATTGAAAGT
TGTTGTAAATATCTAAACTAAAGTCCTTGTCATCAATAATTAAATTAAATGTAAGTCTTA
AACACAGATCGATCTGTAGTGTGTAAATTGTTGTCATTAGGCATGTGCATCCCCAATATA
CAATAGATAAAAAAATATATATAATAAGTATGATTCTTCACTAAATCACTGTTAAAATTC
GAAATATTGCTTTGATTTTGAGACTTCTTAACGGTTTTATGTTTGAATCGACCTCGATTT
TGAAGTTAATTTATGTTTTGCACGTCCACGACAGCTTGAACTTGACTCGTTTCTCGGCAA
TGTGTTTTCGAGTGTAGTTTTCTCTTGTTTGTGTTTTCCTACTGTTGTTGTAGCAGTAGC
CGAGTATCAAGCTGTTGTTGTAATTCGCGTTGTTTTGTTTTCCCTCGCATTGCCTATAAA
CCACCCACTACCCACTACCCGCCCCCGCGGTGGTGGAATGAAAAGTGCAAGGCAAATATG
CAGCAACTGCGACGCCGGCAGCGAAGTCAGCGTTTGTTTTTGTTTACTCATTCATTGCAA
AGTTGTTTAGAGCCGAGCGCGCAGCGTATGGTTTTTTTTTCTATGCATATGTACATATGT
ATGTATGTATGTACATACATATGTGTGTAGTATGTAGATGGTAATGATGATAGTGATGAT
GATAGGGTATAGGGTTTGTTGTAGTGGGCGGCAAATCTGGGGCTTTTTGGTGGGAAATTT
GCTTGGAATTCGCCAAAGTAGTGATTCTAAATTTAAGCAAGAATTTTGAAGTTTTGGACA
CAGGAGTGCTAAAAAATTTAATGGCCCTGACAACTCTAGAATTTGATCCTGTGTAATAGT
GACAAAAAAGGAGTTTAAGGTTTTTGAAAGTTTTTGAAAAGATGTTCAATATTATGATAT
TGAAAGATTTGAAAGACCTGGCAACTCTAGAAATCGTACCTGTAAATAGATAAAAAAATA
AACAGTTTCAATTCGGGTTGAGGCGCAGTCAGACAGTTCGAACAATAGGAAAAAGCAGAT
GAAGTTCCCGGAAATAAGTGCTTTTAAGTTATTTTCTTTGGCTTTGGCAACTCTAGAAAT
CGCACCTGCGTTTTAGTGAGAAAATACAAGACGTTCAAATCCACGTTCGAATACAAATAC
AAAAATATGTGGGAATAGTGGGGAACTTTCCCAGCAACTAGGGAGCAAAGCTTAATGGGG
ATTAACCCGTTAACCGAAACACTTGGCAACTCTGGTATTGGCACCTGCCAGGTGACGAAG
CCATCTTACACACACACACACACCGCAATGCATTTTCAATTGCAATTTGTTCCACTGTTA
ATTTTACGACTCCCCTTTCCAGTGTAAATCCCCCATTTTAGATGGTGGTAGTGTGATGGA
AGACGAGGGGTTTGGGGGCTTTGTTTGCGGCGCTTGCGCTTGCGGTTTTCATGGCAGTTT
CATTAATGTTAGTGTAGCAGTTATTTTTGTTGTTGTTGCGGTGTATGCGCTTTTGCGAAA
ATATCGCCGTCGTACTTCAAAAACATTGGCGTGAGCAGCCGGATAGATACAGTATAACTT
TGGTAATGGAAACTTCTTCGAAATACTCCTTAATATATTTGGTAAAATAACTTGAATTTT
TCAAATAAATATGCCAGATAGAATTTCCTGAGATATGTATATTATATAAATACATTTTTT
TTATTTCCGAACAGAAAAGATATTTTTTCAATAATCCTCTAATATTTTTTAATCTAAAGA
GCAGAGTAGTAACTTCAATATCTTTGTTTTATTAATAGTGTTTTTTCCAGATTAAATGAA
TATTAGCTTTTAAAATCCAATAAAGTCACTGATAATAGCTCCAGTCCACAGAAATGTTTT
AATATTTATGATAAAAACTAAGGCAACGGAATATTGATCTTGTTAGTGTTGAGCGAAAAG
AGTTTGGAATGCTTTACTGTAGCAGTGGAAAGAGGTAGCTTGCGACAATTGTGAATGGGG
CGGTGTGGAGAAGGGGGGCGTTGGTGATGAGTGAGAGAGGTGTGCGGGGTGTGTGGTGTG
TGGTGTGGGCAAGAGGGGGAGGCAGTAGGACTGGGGCGGATTTCGTGCCAAAGGAGTAGA
AGCAGCGACGACGACGACGACGCGTAGTTTGTGTAGTGTGTTATTTATTCATTGGATTGG
ATGATAATCAGTTTGTTTACATTTTTCAGTTGCACACACAATCCGAGCGAAAGAGCGAGC
GGGCGCGAGTGTATGCGCGAGCGAGAGCGGGCGAGTTCATTCTCTTGTCTGTTTTATTTT
ATTTGCCTTAACAAAATAATAATACAGACATGCAAACACGCACACAGCGCACTCACTCAC
ACACACACGCACGCACACTCTGCTCCGAATGCGTAAACAACAAAAGCAGCTGCAACAACA
ATAGCAACAAGCAGCGGAAAAGAGATGGCGATAGCGGTGGAATGATGGGAAAGGGGGGAT
TGGGCGGCGTAGTTGAGGAAACTTAAAAACAGCAGCGGGAGCAACAACAAATAAACAACC
CAGGTTGAACTCTTATTCTCGGGATGCCCCAATAGGCAACATTCGATTTTTGACATTTGT
AGGCGTTTGACGGAAAATAATGGAAAATCGAAAATGGAAAAAGAAAAATATGTACAAAAT
CATACATTTTAATTTTCAATAGGCAATGTCGGAAGTCTTAGATCGACACTTTTGACAGCT
ATGTGTTTAGATACATGTGGACATACCATATAACGATAGAAAAGTAATTTCGTAAAAAAT
AGAGCATATTGTTATTCGGGTTTTCCAAAATGTTGAGGCCCATTTGCTTTGTCGCAGCAT
TTTGATGGAAAGTTCTAGGCGCCACAACCCAGACAGACAGAAAGGCAAAATCAAAGAGAT
CGTCGCAGACAGAAAGGGATGGCGCTAGCCAGGGTGGAGCGGGCAGAAAGAGAGGGAGAG
CCCGCTTTGATCGCCGCTGACCACATTAAACTTTTTATTGTAGTTGTTGCTGAATTATTT
TCGTGTGAGGCCCCAAACGTGGGGTAGGTTAATGCTAATGCCGCGCCTGACCATTAAAAA
CCCTCTCCGGTTAACTCTCCATCTTTCTGTCCCACTCTTTGGCTTCTTCTAGAAGAAGAA
TTCTTCGTGCGCTCTCTTTCGCGTGTCAGAAGAGTCTTTGTGAAATAACGCTGACATTTG
CAAAAGTTTCTACAAAGAAGAACAACCAAGATGCAGTCTTTACATATCTTTGAATCTAAT
AATTCAATTAGAAATGCGTTTTTTTTTTAGCTAAAAAAAAGAATATTACATTACCAAATG
CATTTTAAAAGTATCCAAAAATAAGTAGAGTTTTGAATCAACAAATTTAATTTGTTACGT
TTGTTTAGTTATTTCCTTAATTTTCGATAAATAGACCGTTAATTGCCGTTCTATCGGGCT
CTTAATGAGTCACCCGGACTTTGCTTAAAAAAGCACGCTTCTCTTAAATCGTTCTCTTCA
GGCCGCAGCTTTTTACTCTCTCTCTCTCTTGGTCGTTCACTCTCTTCCGCGCTCGCACGT
TTCGGCTCTTCGAAAATTTTTACTACGCCGCTAGAATAATTTCGGACAAAAATATTACGA
GTTCGAGTCGCGTTGTCGTCGCTTTCGCGCACAGCAAACAAAAAAAAGTCTAGCTACAAC
AAGTGTAAATAGCGATCCCAAGCAAACAAAAAAAAAAAAAAAAAAAACAAAAGCCGAAAT
GCATTATCAAAACAATAATAATAATAATAATAATGTCATTAATCTGAGATCCCCTGCAAT
TCCACACAGAATTTCCCCGGAATCCGTAGCAACTACAAATTCTTCAAACGTAAGTTTCTG
CATTATTCGATTTGCCGGGGGGAGCTGAGGGGCTCTTTCACAAGGCGATTGTTTGGAAAG
TTCGCGCACTTTGCCACCTGTGTGCGTGTTTTGATGATACCCTTCCCGAAGGGTAGACCG
ATTTATTCAGAACATCGATCAAAAATTATGAACAAGTTCAGGCTTATTTGGTGCTTATAT
TAGCATGTAGGTTCATAAAATAAATATTTTATTTAATATAATACAAATACAAAACATCGT
TAACATTATTTAATGTCCATGATTCGTTACGGTTAAATATTATTTTTATACCTAGAAGAG
CATACAAACATCGCCACTCTTAACTTTCTTTCATGTTGTTTTGCTTTTTTCAACTGTGTG
CGTGCGTGTGTCTGCTAATTTGTTTTGATCGCTTCGTGTGTTTGTCCATATATGGATATA
CATTCATACATCTATTGGGTAAAAGCAACAAAAACACGATTTGAGCGCAGTCAAATTATT
ATTTATTTACCATTATTATCATAATTCGGTACGACTTCGCACTCTTTCGGTTTTAATTTA
TGTTTCGAATTCACTCAGAACAATGACAAAAACAACTTTTCGCCGAGGATTTGACCGGCA
TTGGAATGCGATGAGAAAAAAAAAAAACAGAATCCGAAATTTCTAATTCAATTCGTTTTG
GGGATATCAATTAGTATTATTATATGCAAATTGCTTTCGACTTTTAACGCGACAGTGCAG
CAGGTATGCAAAACGAAATGTTCTCAACAATTTGTTAAGAAAAAGACGTTAATCTCTTGT
TTTCCATCGAATTCTTTAATAAAACAAAGTAGAATCGAGTTTGATATAAATTTGGTTCTT
ATCAAGATATTGTTAAGAATTGTCTTTAATACTTTATTTGTACAAGTTAATAATTACAGT
TATCGATTTGATTTTGAAGATCGCAAGCGACCGTTTATTGCAATTTATCATTTGAAACTA
AATCTAGCGTACAAAATGTTTCCCTAAGTCCCTAGCAATCAAGTGAAGTCGTCGGCAGCG
GCGCAGCAGGCGTCGGCCGCGGCGCAGCGCAGAAGTGTCGATGTCGCGCTTAACCGTTCG
TTGGCGTTGATGGCAGCGGAGACTATGTGGAACCACAAGATGTTAGAGAATCAATTGCAG
GGCAATAACTCCTCCCCTCTTAATTGACGCTTGTCCTCGAGCGGTCATCATAAGGATGGG
ATGTTTTTGAGTCGCATCGTTGGTGGGGTGATTCGTGGTAGTTTGGGCACAGCATTAATG
GTTTGAATGCCAGGTGTTTATTGTTGCGTGCGTTCGAGGTTTGTGCAACTCGGATGTGTT
CTGCATTGACAACTTGATTGCTTCTATTAAAATTCTGGTTTTTACTAAATTACTAATGAA
TTTATATCTACATATTTTTAGACCATTGGAACCTTTGCAGAAGGCATTGATTCCGTACAT
TTCGTCTTTAATTGGTAAATTTTATTATTATTCAAATTAAATTATTATTTATTTATTATT
ATTAGTTTCCTTTACTGATCATGTTTTAAAATATAAGAAATAAGGAATTAACTGATTCAA
TATGGAGATTTCAATGGCATTCAAATTGTAGTTCCGTTGTGTAAAGCGAGAACGTGTGAA
AGTTTTAACATTTATTTGACCGTCAAGGCAGAAATCGGTATATTGTTTTCAAGTAGGCTA
CTGGTCTCATTCAATTTAAACTCGCTCCGCAGAAACGCATTCACAACGCAATCTCTTCTT
TCACGAGCCCAATCTAATTCTGCAAACCTATGGCCAACTCGTCTGTCAAAGTCGAATCGT
TTCAAATTTAATTCTCGTGGTTACGTTAATCAGTATGTTTAATGTTTCTATGTTCTACTT
GTCTATCGATGTGGCCACAGTAATTATTCTGAAGCAATCATGATCTTATGTTACTTTTAT
GTACTAATTTCCCTGATTCTGTTAATATTGTGGTACTTCGGTCTTCCTTAACTAGTTCCT
TCCTAAATCTACTTGATAACTTAGAACCTAATCTTGTATTAACCCTAACGAAAATTTCTT
GCCCTTTGATATAGGTTTTTATGGGCTTTCTTGTCCGGTTGTGGTATTCTATGTCGGTTT
CCTGTTTTTGCCTAAGTCGGTCTATATTGTCCAGTCTAGCTTGTTCATATTTTTCTGGAG
CTACGGTAGCTATCCTGCCGAAGAACACCTCTAGAGGTCGTTTTTTTGTGACAGAATGGA
CAGTGTAGTTATATTCATAGATGGCCCTATCGAGAAGTTCCTCGAAGCCCCTATGTGTTC
CATCTCCTTTCAAACATCTCATTATTTCAGAGAGTGTGGAGTGAAATCTTTCTATCTGTC
CATTTACTGTACTCTTATACGGAGGTGCTTTGTAGAGCTCAATACCCAGCTGGTCTGTCA
ACATGAATTTGATAGAGGCTGAGTTGAGGGACTTTTCATTGTCCATTACTATTAATTTAG
GCACTCCATAATAAAACACGATATCTCTTAGGGCTTTCCTAATGTCTTCTACAGCTTTGG
ATTTGATAACTCTTCCCATGGCCAGTTTGGAAAATTTATCAATCGCCGTGAGCACCAGAT
GTCGTTCTGTCGAGTAGATGTCAATATGAATAATTTGTCCGGGGTATTCTGGCAAGGGAG
TTTGTCTTATTTCTGGATGCGTGGGATGTCTGTCATATTTAGCAGTCTTACACACCAAAC
ACTGATTCACGATAGCCGAAACTTTTTTCCTCATTTTAGGAAAGTATACTCTTTCGGACA
ACTGAGCTTTATTTTCCACAGCATTTCTGTGTGCTCTGTTATGTGTCCTAAGTATTTCTT
CCTCTTGTTCGGCTTCGTTAACAAGGTCTTTGACTTTGCTTTGGCAGAATCTAATCTTGA
AACCCTGAAAATGGATGGGGTAGAGAATTTGAATTTTCCCCATTACATCCTCGGATGTGA
AAATTCCATTAATCACGGATGGGTTAAGATATTCTTTCAAATCTGACAAGAGACTATCGG
GTGTGAACAAGTTGCGATCTACTAAATGCCTTTGAAATGTCGGGAATGGAATGCTAAATG
AGTAGTTCTCTGACTCGGACTCCCTGAAGAAAATTTGATTCTTGAATGCGTTTATCGGGG
CTTCAACGCTAGGTATCAGCCCATGGCTCGAACTGTCAGAGCTGTGCATTGTTGAGGCTA
CTGTGTTAATTTGTTCGACTGTCGGTCCTCTGGACAGAGCGTCGGCTACAGTATTTTCTC
TGCCTGGCTTGTAGAAAATTTCGTAGTCATATTCCTCAAGGTATGCTTTCCATCTCTTAA
TCCTCGCATTTCCATTCCAACTACTGAGAGAATGGGTCAAAGGCTGATGGTCAGTAAAGA
TTTTCACCTTTGCTTTACCGTAAAGGTAAATTTTTAGCTTTTTTAGAGCCCAGATAATGG
CTAACATTTCCTTCTCATTCGTGGCATAATTTTCTTCCGCCTTCGAGAGTGTTCTCGATA
AAAATGAGATGGGTCTGTTCTCTTGTGAAAGAACAGCACCTACTGCGAAATTGGAAGCAT
CCGTTGTTAGGTGAAATTCTTTCTTAAAGTCCGGGTAGTGGAGTATTACGTCTGGAGAAA
CCAAGCTGCTCTTCAATTTCTTGAAGGCTTCTATTGCTTCGCGATTAAGGGAGACGGATT
TTTTTGACGATAATGTCCTGGAAATTCGACCATCCTCCCCTCTCAAAAGCGAGCTAAGTG
GTTTTGCTAACTTAGCGTAGTTAGGAATAAATCGCCTGTAATATCCGGATAATCCCAAGA
ATGATCTCAGTTCTTTGAGTGTCCTTGGAATTGGAAAGTCTGAGATTGCCTGTACCTTGG
TTGGGCTGGTTTCAATGCCCTTGTCGGACACGACGAAGCCTAGGAACTCCACTTTTCTCT
TCATGAACTCGCATTTATCCAACTGACATTTCATGTTGGCTTGCTGAAGAGTTCTGAAAA
TAGTGTCAAGGTTCTGGTAATGTGTTTCATCATCTTTACTAAAGATGATGATGTCGTCAA
TATAAATGAAACATATCTTACCGATATGTTCGTGAAGAATATCGTCCAGTGCGCGCTGGA
AAATTGACGGTGCATTTTTCAGACCGAATGGGAGTCGTGTAAACTCATATTTTCCATTAT
TGATGGAGAAGGCGGTCTTTTCGATATCAGATTCCTTTAAAAGAATCTGATGAAACCCAC
TTTTCAGATCGAGCACTGAGAAAATCTTGTTGTCTCCCAATTGGGCCAACACTTCATTAA
TGTCAGGGATAGGGTATCTGTCCGCTACCGTTACCATGTTAAGTTTTCGATAGTCAATTA
CCACCCTGTATTTTTTCTTGCCAGAGGAGTCGAGTTTTTTTGGTACAATCCACACTGGTG
AATTGTAAGGTGACCTTGAGGGTCGAATGATTCCATCGTGTAAAAGTTCGGAAATTTGTT
TGTGTACCTCGTCTTTAAGAGACATTGGGTACTGATAGAATTTTGAGTATATTGGCGTAT
CCGATATAGTTCGGATTGCTGCCCTTACACTTGTTGTGTAGGTTAGTTTTTGATTCGGGT
CTGCGAAGAGACCTGGATACGAATCAATTATTTTATTCAATATCATTCTCTGTTCCACCT
CTAAGTGTTTTATTCTCGGACTAATTGTGCTAACAGCCTCGAACTGTTTTTCTTTGAGAA
CAACTCTTTTCCCGTTTTCCAGTGTCATGGTTAGGTTCTTCAAATCAATTTGCGCTCCCA
TTCCCTTCATTGTGTCTTTGCCAAGTATGGCGTCAAAAGTCTTCAGCGTTGGTAACAAAA
AAAATTTTATTTCGAAATCGAAAAGGCTTGCTCTTTTGTAATGCGATATTTTTACATCAC
CGCCTGGAGTATCAGCTATGTAAGGCTTGTTATTTGGTATCGCGTTCGTCACCAAATTGG
GCTGGATGTAATTTTTATTAGAGCCTGTGTCAATCAACACCCTTAAAACCTTTCCACTCC
CCACTCTACATTCGAAGTATGGTAGTGAGGAGTCTTCTACTCTAAAAAATGCAACACGTG
GTCTCGTTGTTCGCTGTCCAAATTGTCTATTTGTCCATCACAGTATTCATTTAGTGTGCC
GTTTATATTGTTCTGGGTTTCATAATCTTGCATCGACCGTTGATAGCCTGTCATGCTTGA
ACTGGACCCAGTTACTTCAATACTTGGCTGTCTCATGTTCACTGTTTGGATGTTGTAGTT
CTTTTGTCGTTTGTTTATGTCCGAGTGTGGTCTATTCATATAATTAATGTTTCGCGTCTG
TACACTGCCGTCCACGTCCATTGGTTCTGGTCTTGGTTGTGGTTTGGTCGCAAAGGGACG
GGGTGGGGCATTGTATTGTTGCCATTGCTGTTGATAGTTTTGTCGGGGTGGAATGAACGG
TGCATTACCGAAGTTAGACACGTGTTGCCTTGGCGCCGGGAATGGCTGGCCTAAATATTG
TGGAGGTCTCCTCATGGGATGTCGTGGAGGGACCGGTGGAGGCTGTCGATGGCCAAAGGC
ATTCGACGGCTGAAAATTGCGGGGTGCCGGAATGGGTTTTTCGTTTCCTCTGAAACTCGA
CTGTTGACCCTTATTCGCCGCATGGTTTGACCTGAAAGTTTGATTTTCAAGTTTAAGGCA
ATAATGTAAAGCTGAGGGGAGATCAGCTGGCTCTTTTATTGCCAAAAGGCGAGGTAAATC
TCCTCGAAGGCCTCTGATAAAAGTATCCAGAGCTTTTTCTCTGTACATTTTTGTAACAAA
GTGCTCGGATTCTCGGCTCATTTGCATGCAGCCGACTTTATTTAGAATAAGCGACAGATT
TTTGTAGACGTCTTGGTGGAAGTCTTCCACCGACTGCTGGTGGCCTTGAACCAAAGTTGA
CATTTGGTATTCCAAGGTAGTTATGTCCCGTTTATCTGCGTAATGCAGAGTGAGACATCT
CGACATGGCCTTCCAGTCCAGCGGAATGCTGTAGGACTCGAGTGCCACATCAGCACTTCC
AACAATTTTATTTCTTATGGTATGAAGTATACCATAATATTTTGGAGTACCCACAAATGG
GGTATAAGTCTCCATGATTCTATCAACGCTCTTTTTCCAAGACCCGAATTCTGCTGGATT
TCCAGAGAATTCCCTGATCGATTTTACGATATCAGGCACCCTGTCAAAGTCCGCTAAATT
ATTTCTGTATTCGGGCTCGACGACCTGGTCGCTCACGTCAGTAAAGTCAAGAGTATTGTT
GTTCATTTGTTTTATCAATCCAGGTAAAACTTGGGCCACCGTTTGGCCAATTAATGCTGT
CAACTGTTCGACACTCATGTCTACGCGATGCTGTTCAGGCAGGTCGTGTCTTTCTGAGGG
CACCGGTCTTTCGTTTGAACTAAAAGCTGATGGTCTTATTATATTATTAGGATTTGCCAT
ACTGATTTTTAATTCGGACAACACCTGCACAAAACAAGCCTAAACCAATTTGAACTTAAC
AAAAGTTGTGGGCAGAAAATATGGAATGCGTGTGTATGTGTTTGCTTATTTATCTTTTGT
TTTTGTTTTTTTATTTTTTATTTTTATATTTTTTTTTTATTTTTGCATGCAATAAATTTT
AGCTCACCGCGGTTATTTTGCTTTGAGAACAGTGTACCAGAAAGGAACAGTAAATAGGAA
AATTTTCCTTTCAGAAGATCTCTAGGAACTGGGTTGAAAATATAGTATTAATAATAATAT
CAATAATAATAATAAAATAATAATAATAATATAATAATAATAATGTAATAATAATAATAT
AATAATAATAATATAATAATAATAATATAATACTAATAATATAATAATAAAAATATAATA
ATAATAATAATATTATAATAATAATATAATAATAATAATATACTTAAATTTTTTTTTTTT
TTTTTTTTTTTTGGTATACTTATGTTTTATTATGGGTGGATGCCTGAATTTCAAATTGCT
GATGTTTTTTCCAGTGTACTTTCCAGGTTCTTGTAGTCTCTCTGCCTCCTCTTCGGTTGT
TTCAGCTTCAGCTTCTTCGTCGTCAACGTGTTCTTATTCCTGTTCTTTTTGGCGGGCTGC
TGCTGCTGCTACGGCTGTGCTGTTGTTGTTCTTTTTTTTTCCTTCTTGTCTGCACTTTGG
TTCACGCAGCCGTTCTCTGCCGTTCGTCGTCTTTACCTCTGCCGTTACGTTTTGGGTTGC
ACTGTTAACTGTTATCCGTGTTGCTCTTCTGTAGTTCCGTTATTCTCGGCGTTCTACTTC
TACTTTTCCTTCTCCTTTTCGATGAAATTGCTGTTCTTCGTTTTGCATTTATTTAACATA
GAATTGTTGCGGTCACTCCTCCTGGCTGGGTGAATGTTGTCCTTTTTGCCTGGGCTACTG
GGGAATCCACGTCAGCACTCCAAAGAAGGTTTTCTGCGGGCTGGCCTGACAGAAACTGTG
ATCCACCAATGGGCAATGCTATGCCGATAAGTATTTTCCTCTTCCGGAAAATCTGTTTTT
TTCTCAAACAATTTTATTTTATAGCCGACCGTGAATTTTGTTTGTTAATAACTCGCGGGA
GTTTCTTCGGCACAATTTAACCAACGAATATTTTTTAGCAAAATTTTGATTTTGCTCCGC
GACTTAGAATTTTGTCTTTCGTTCGCGTTTATTCGCTGGTCCCTGTTCGGGCGCCAGTTA
ATAATTACAGTTATCGATTTGATTTTGAAGATCGCAAGCGACCGTTTATTGCAATTTATC
ATTTGAAACTAAATCTAGCGTACAAAATGTTTCCCTAAGTCCCTAGCAATCAAGTGAAGT
CGTCGGCAGCGGCGCAGCAGGCGTCGGCCGCGGCGCAGCGCAGAAGTGTCGATGTCGCGC
TTAACCGTTCGTTGGCGTTGATGGCAGCGGAGACTATGTGGAACCACAAGATGTTAGAGA
ATCAATTGCAGGGCAATAACTTACATGTACAAAAGAACTAAAATATTAAAAAGAAACTCG
AAGGCCTCTTTAAGTCAGTAATTTTCCTATCAAACATCAATGCGCCTATCCATGATGATT
GGGCAAAAATATAGTAAGAGACCATAAATATTGCTTAGCCATAATGATTTCACTTAACAA
TCATCGTTACGCTTTAGTTTTAAAAATCGAATTTTTCTGCTATCTCGACAATTTGTTAGA
ATCACAATTATGGCAGAATCACAATTATGTTCCACTAAATTTTCTTAAAATTTACGAAAT
TGAAGATAAATATATATATTTTAAAAATATTGTGTATATTTGATTCGATTTTGAAACCGG
ATTCCCTTTTTATCGGGAGCAAAGCTCTTAATTAAACAATTTCGTACTTAATTACTTTAT
GAGCTCCGCATTATAGTTCTCAAGTAGCCAGTGTCCCTGTGTTGGTTATCTTGATCGTTC
AATGTTTTGGACTGCGTCACGATGACGAAGTGAGGAACCTTTGAACACCCCACCCGACTG
CAAATGCACTATCTCTAATCTCCGCGTACTCGTTCCGTTTCTCTACTTCCAGATGGGCCT
GAACATACCCATGTTGATAGCGAGCAGCCAGACGCTGGACAGTTGGAATACGGCGGGTCA
GTACTCGCCACCGATATCGGGATCCGGCGGCGGTGGATCCGAGCGAGGAGGAAGTGCTGG
AGGCGGCGGAGTGCCGCCACAGCAACTGCGAGTACCGCTGCCGATGAGCTATCATGGCGG
AGCTGGTGGTGGAAGCAGCAGTAGTGATTTCCAGCAGAGTCCCCTGAAGACCATGGACAC
CTCGGACAATGAGGATAATAACAATACCAAGGAGGATGTGGCGGCGGCAGCGGCACTGGG
ACAACTGGCTGCCAAGGTCGAGCTGCGATCGCCGGCGGGCGCAGGTCCTGGCGGTGGCGG
TGGTTCGAGCAGTAGGGAAGCCAATGATCCAACCAGCGATCCCATCAAGCCCGACCGCAC
TCTAAGCGAAGCTGGCAGCAGTCCCATACCGAATACCAATATGCACGAGGCGCACAAGAA
TCACCTGCTAAACAGTCCCGCCGGCGGAAGGTCAGTCACGCCGCGGCAGGCGCATGAGCA
GCTGCATCACCATCCGCACACGCAACACCACCTGCAACAGCAGCAGCAACAACTGCAGCA
GCAGCATCAGCAGTTGCAGCAGCAACAACTGCAACAGCATCAGCAACAGCAGCAGCTGCA
TCACGGCCACGAGGAATTGGACATCAAGCAGGAGTTGGTGGACTATTTCCATGGTCAGGC
GGCTGGCGGTGGTGGTGGTGGTGGTGGTGGTGTTGTTGGTCCTGCACCACCGCCACCACC
CGAATCGCATCGTTCCTATAGCTCAGCGGGCGAGGAGAGTCGGCTCCAATTGGTGGACAT
GGCCCAGGACCTGAGAGTCGCCCAGGCGAAGGCCAATTTCGGTGCTTTCATCCTGCCACC
CAGAGGCAGTGATGCCAGCACACCCGCCATGCCCTTAAATATGCGAAAACTGACCGGCGC
CGGCAGTGCGGGTCATATGCTAATGAATTCGCTGCTGGGCTCCAGGGAGAGCATGTCGGA
TGGCGAGGAACCCGATCCGGATAACGATGAGGCCACCGAATCGGCCGCCAGTCCGGGTCA
CATCAAGAGCAGCGTTTCCGCCCAGGCGGCCGTTGCAGCGTCTGCCTTTTATGCCGAGTC
CCTGAATCGAGATGATTGCGATTTTATTGGATCGAATGTGTCCCTCAAACTGCGGACCAT
GGATCGCACGCAACGAATCATTGCGGAGAAGCTAATCAGCGAGGTGTTGTACTATGGGCA
ATTCAACGAGCTGGAACGCTCGGCGCGGATACAGCCCAAGTGACAGTGGCGCCCCAAGAA
GTGGACGGCTGCGATGGGTAACGGAAGTAGTGGGGCCGTTGGTCTGGGCATCGGTGTGGG
TTTGAGCAGGATCAGGCTGGGCAGGAGCCTTCTCGCCCCGCAGCATGGCAAGTGAATTCC
ATTTGATGAAATAGTCGACAGAGAGTAGTAGGCAAATACAGAGAACACAGTACAACTTAT
TTTTAGTTTGGCCAGGATCGGGGTCACCACTTGTACAAAGCTTGGCTTGAACGGGGGCAG
TGTTACTTAGCCGGAAAGAAAGTGGGAGAGAAGTGGGAGAGTGGGAATGAAAGCAGAGAA
GGGCTTGGAGAAAGGTACTTATGCAACAGGGAGGGAGAGATGCCGATGCTGAAGGGTTCA
ATCACGTTTTGTCATACTTCAAAAACTAGCTAATTGAAAAGATGGTCGTCAAGCAATTAG
GAGTAGAACAATTATGTCATATGGTTTGAACATTCGAAATGTGCTTTTAATGCGTGCAAC
GTTTAAATTATTAAGACCAAAATTTATTTAGGTTTATTTATAGAAAACATTAGGCGAATG
TGTATTTTGTTAGCGTGAATTAATTTATTCTGTCTGTGTAAAGTTTAGACCATCTGCCAT
CTCTCCCTGAGGAAAAAACACAAAAACCACAATATAGAACACAAACCAAAGTTACTTTCT
ATTCTGTTCGAAGGGCTGCCTAAACAATAGTTTAGCTTGTGTGTCCACCAACTTCAATAT
TAAAATACATGAAATACATAAAATACATAGATACTAGATAGGTTACAAATATGGGTCTGG
GGACTGGGGATCAGCGACACACCTGAGACGTCTAACTAGCAGAATCTCAGTATTAACTAT
AAAATACACTTTACATAGGGATCCAAGCATTTGCCATAGATCGTTTCCTTTGGGGCCCGA
TCGTCCACTTCTGGGTGTTCTTCTCTGATTGCTGGGTTCGAGCCCCTCGAGCCACAAACA
AACCAGACCTCGCCCCCTAGAGCAGAAATACAGAAATTCAAAAAAAGAAAAAAAACTAAC
AATAAAGAAGAGGAAAAGTAAGCAAAACTAGCGTAAAGACAAGGAAAAGCGGCTGCTAAA
AAGTCAAGCTCCAATTTGGGCATCACTGAAACTCATGTTCCCGAGAAAAGCTAACCGTTG
AGAAAGGCACTTATAAAATGTATATGTTTTCTATACATATATCTGCATATGGAGGATATA
TGTATGTGTATGTAAATGGATAAAAAAATATATAATATATATCATTGTACCTTATTTTGA
AACAGAGATGTTTTTTTTAGTCACTTAAGTAAGTCTGGTCGTCGAAAAGTCACCACGATC
CAAACCCAACAACTGAAACCAACCAAGAAAACCAACAAACAAAAAGCAACCGCAAACTTT
TACCTATATTATACAAATACAAATACAAATACAAAATACTGTCGTCACTAGTTCGTTAAA
GAAACAACAAAAAACCAACGCAAATGCAGAAACAAAGGCGAAATATTGTACATTTTCGTG
TTTATTTTTTAGGTCCTATTGATTTTTGCATAATATTTAAGTAGCTTTTATTTTTATATG
CAAAGCAAAGCAGAGCAAAAACAGAAACATTGAATTAATTTATATGAATATATATACATA
TATATATATAGATACATAAACCTAATAAAATATGGGCAAATTAGTTAGTCACATAAACGA
GAGAAAGAGATAGCTGGTTAGTTGAGGATGATGAAATGCAGTTCGGCTTTTGCTGCTGCG
TTTTTTAGCCCTAGTTTTTACCTTAGCATAGAACAACAAAATCAAAAAAAAAAAAACAAA
AAAACAAAAACAGCATAAGTCCAAACCGAAATGAAAAGTCATGTGTAAAAAAAATGGAAA
ACTATATGTGAATAAATTAATTGTGTGTAAAATTAGCGAGAATTTGTTTGGCATCAATAT
GCAAATCGTGTGTTTGTGTGAGTGCGTATGAAATGCAAACCAAAATTAGTTTTTCCTGAA
TGTGTAAGCAGCAGCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1419, 5439..6488, 22432..24758
5694..6488, 22432..23739
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved