Drosophila_melanogaster Locus CG5888
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG5888
Drosophila_melanogaster
CG5888
2L
snoRNA:Me28S-A2958
31582..31716
50297
CCAATTTGACGAACCTTCTCGCCCTCCAGCAGATCGATATACTTGTTGGGATGATCAGG
GTCGATGTCATGATCGCCGCCCACACTCAACAAAACTTTCAGGTGGGGATACTTCCTCTT
GAGGGAGGTAACCTCGGAGAACTGATGCTTGTATATGTCCAGGTTCTCGTTCATACTGTA
CGCCTGTAGGTTTTCACCTCTCAGCCCAGCATAGCCGTAGACCAAGTGGCTGCAGAATTG
CAAGGCGATCTCCAGATCGGGATTGAGCAGCTTGCCCAGACCTGGAAAAAACACAGTTTA
AATTCAAAAGATGGCATATTTAGTATGCACGAAAAGTACAACGAGCTGCACTCGAATAAC
AAATAATCCCAGAGACTCGAAGTGGTCATTGCTGTGGGACACTATCTGCGCACAGTGATC
CGACACCCAACACTCTCGCTCTCGGTGAAAACTACCGGAGAGCGGAGATCGGAGATCGGT
GTATCTCCCCCTGACCAGAGCCACCTCCTCTCGGATGCTGATCCATTGTCTCGTCGACTT
CAGTGGCTTAATTGAACGCCAACAGTGTGAGCCCAGCGAGCGGTTTATTATTGTTTGGCT
CGGCTGCAGAGCACAGTGGGTTGAGTTGTGTTAAGAGCTTAATGTAAAATATAATCATTT
GCATTTATATAAGAATATTTAATTAAACGTTATTTGAAAGCAGAATTTATAAATGAACTT
TTCGGTTTGTACCTAAACATATTTCTGAACATACATTTGAGCTGCTAACAAATCAACTTC
AGTCATTTTAACTTCTACCTGTTTTAAAAATTTTTACAAATTTAAATTTATTTAATTAAT
TATTAATTTTATTTATTTACCTATCGAATGCATCTATTGGACGATATTTATCTCATTTTT
CCCCTATCCTAAGGACACTGTGCAGCGCTGCTGAGTCACTTGGTGCTCTGCTTGCCACTT
GCTCGGATCGCTGGTGCCAAGTCAGCGTCCGCTGGCGGGGCAGTTGTCGTGCTGGACTCG
CTGTGTGTTGAACGCTCTGGTTTTTCATTTCGAATGCGTGGGATCGGCTCAATAATATAG
ACTTAACTCGCCCTATACCAAAATAATCAACTAATTGCCATATTTTGAGAATTCATTCCA
TTATTTTTGTTTGGTAAGTTACACCCGCTCAAATTAGCTTGTTAATCCGATCAGAACTTC
TGCTTTTTATCGCTTTGCGAGCGAAACTCTGCGGGAGAGCCAGTCTCTGTGTTTTATTTT
TGAAAAAGAAATAAACTGGCCAGATAAGCCACTGACCTCTATAAAACTAGCTTTGGCTCT
CTTTATCTCTCTGTTTCGCTCGCCAGGCGATAAGCACTGCAAGTTGAATTAAATTAAGTC
CGAGTTTTGTTTTGAATCAGAAATGGTTATGTAACTCGATTAGGATGCTTTTGTTTTCAT
TCGTCTGTAAATTTGGCACACGCTACTCAAAAGACAGGCGGTATTTTGGTAGGCTTTTTG
GATAACTTTGAATAAATGATTAATACTTTCAATTTTACTCCCATTCCTCATATTTTAGTT
CATTTACTAAATGTGTCGTTCAGTTCAAACGTGGCTTAGTTGGTTAATAAGGTTTTACCA
GAATTACTGTTTTTCAAAGCTTTTCAAAAGGCATTTTGGATGACAATCAAGTGTGTATAT
TCATAAAACCTAAGTTGGTCAGTTTTCATTCATTAAAAGAATTTAAAACAGATCAACAAC
ATTTTAGTGAGTAATACTTATAATACTCTAGTGCTAAATGGAACCAGTTTGAACAACTAA
ATTGTTTTTACGTTGTAACTTTTTCTGTGTTTGATTGCTAGATAGAATATTTTACAACAA
GTTAAAACCTCATCGATCTGTGATCTAAGTTTTCTAAAGCTATGTATATATTATTTGTCT
GTCATATTCACTTTCTGGAGTATTCCGACCACCTCACTCACCTTCCCTGGTGTAACTCGA
AGAGTCATAGTAGCAGACTAAGTTGGAGGCAGCTTCTGTACTTGCCGCAAAGAGGCACGC
GACAAACGTAAACCAGATCCACGCCTTCATGGTGCCAGGGATATATCTCTATAGGCACAA
CCGCAGAGCAGATCAAATGAAATCGAACTGAGACTGAAATCGAAATGGAAAACGAAACCG
AAACCAAAACCCCAGCCCCAAGCCGATGACAAAAAGCTTGAGCGGAGCTTTAAGAGGGGT
CTGAAAGCCGATCTGAAGCCGAGCTCATTGCCTTACTTATTCTCGCAATGACTTAATTGT
GTACACAGAAATTAATGACGACGATTGCGACGAGGCAGACGCAGGGTCAAAACGTTGTGA
CCTCTAAAATTAAAAAAAAAAAAACAAGCAAATAATCTGAAAACATTGAAACGCGCTTGC
TGATTAGAATTCGAAAACAGTGTTTCTGATTGGTTTCGTAAGTGTACATATATAGAACTA
AAAGCGGTGGAAATACCCGTCTATACCACATGATTTAGTTTATCACACGCACTATAGAAT
TCAGTTTTGTTTTGCAACTCGTATGTGTTTGAATATATTATTGTGGGTTTTTAGTAAATT
ACAAACCAATGATTTGTATTTTTGCCAAAAAGGTTTTTTCTCACTGAGACCGATTATTAA
ATAATGTGTTCAACCGCAAACATGCGCTTCAATATTTGTAATTCAAATGAAACATTTATT
AGAAAACTTAAAATATATGGCTTTGTTAGGCTTAACAAACAAATCATTTATCCCATAAAG
TACTTAATTGACCGCAGTATGGGGTACTTTTGGCCAGTGCAAAGTCCACGGAAGTCATCG
TAACTTAAATCGAAAAGGGCAATTCCGCCGAGTCCTTTGCCCTTGGCATATACTGCCTTT
ATTCCAGCAAAATCCGGATCATCGAAGCTCAGCCATACGCCAAAATCTCCATTATCATCT
GCTGGCCGGAGAGCGTAATTTCCGTATTTCTGGGTGAGATCCGTGACCTTGCGGAGCGGC
GCCAATTCTCCTCTATATTGAGCGGATGCGTTCTGCGACAACTTCGAGCAAATCTCTGGC
CAACTTAGTAAGCCCTCAGCACTCTGGATTTGTATTCCGCCGGGTGCAACTCCACATGTC
TCATGAACAATGGGAGCACCACTGAGTCCAGATCCCTTCGATAATTTCCATGCTCTGCCA
TAACTGGCTATTCCCAGGTTCAATTTTTGGCCAGGACAATGATTCTGCAGCCAATAGTTA
ATCTGGAACTCCACATTCAAATGGGGCAAGCGATTCTGTTCGTCCTGGAAGAAAATCGGA
GCTGTGAAGTCCGCCTCCTCGGGATTTCGTAGTGGGGTGAGAAAGTCGAAGGCCGCCAGG
TTTATATAGTCGAACTGGGGATGCAGTTTGGGGACATCGAAGTACCCTAACGAAATGATT
GATTAGGTGGTTAATAAAATAGTTCCTACTATATGTAAAAATAGGATATATACTTACAAG
TGGAGTTCACATTGGGCAGGACTGTCAGAGACAGCATCAGATTAGCAGATCGAAAGGCAT
TCTTTATATTTCCAACGAGATCGGTGAATTGTGACTTGTGCTCCTCCGCCTGCGGGTCCA
CAACGAAGTCACCAGTGAAAAGCTTCTTGAACGACTTCCAGTAAGATCCAAGGGATCCAT
GGACTTTTCTGGGCTTATTACGGGGTAACTGGAACGCGAGATCAAGGCCATCGAATCCAT
TTCGCTTAAGCAAAATCATGCTGCTGTCTATAAAATTCTGCTGAGCCGTGCGATTCGCCT
CCAGAAGCTCTACATATTTATTGGGGTGGGCCTCATCCACATCGCGATCTCCACCCACGC
TGAGGAGAATCTTCAGTTGAGGAAACTTCTGTCGCAGGGCGGTGATGTCCTTGTAGTAGA
ACATGTCCAGGTCCACATTCAGACTGAATAGCTCGAGGGTACCGGACTTCAGGCCCGCAT
ATCCGTAAACCAAATGGGTGCAGAACTGCAGGGCCAAATCCAATTCGTTGGTATGCATTT
TGGCCAAACCTTGGCGCAAATACGAGTTGGAGTCATAATAACAAATCAGATTGCTGGCAG
CATGGGTCAAACTTGTCACACTGAGCAAGCCCAGTATATAAAACAACTGGAATCTCATCT
TTTGGTAGAGACCACGTCCTGACTTTATGGCTGATAATTAGCAACTGAAATCTCGTTCAA
AAGCTTTATAGCTTAGCTGCTGTATTTTTGCTTATCTCACTGTTCTGCCGATGATGCCAT
TATCTGGTTTTCAGGCATTACGTAGTTCCTGTCAATGTTTTCCGACTTTATTGCGTTTGT
TTGTGATGCCCTGTCAGCTAATACAGTTTCACGAATTGCCGTGACTCAACTTTTAGGGGT
CTTTTTTATGGCGACGACGTATTTCACGTTTTTAGTGAGTGTTTTGGATTTTTGTTTTAC
TTGCAAAATTAAATTTATTTCAAAGGGTACTGAAAAAACCGGAGTTATATGTTATTAATA
ACAATTATTGAACAGAAATTAATGATGAAAGTTTTACAGATAACTGTATATTCATATAAA
AGGATACTAATGAACTTACAGAGTATGTAGATAATAATGTATATATTTTATTATTTTTAA
AACGCAGTTTTAGTCGATCTATAAATGAAACATAAAAACCAGCTTTTTATCTTCCATACA
TTGCCATAAGATTTTTCATGATCTACCTCATTTACGCATCGTCATCGCTGTCGTCATTTG
GCTCCTGATGAAGGTGAAAGACTTTCAATTAGCTAACTCCGAACCGCTCCAAAAGAGCCG
ACTCTCGAGTGGAGGACAACCTGCTGGGCAGCCGAATCTTCGGCAGCTGTTTTGGGCCCA
CGGGGAGGCACTTAAATCAGAAATCAATTGAAGCATTAAATACCCCAAACAAAGCAGCGA
AGAGATGGTCCTTGGGCAAAAGTCGAAATGGGACAGCTAATGACGACAGTCACAACAATG
CGATGGGGATGGATCTCTGATCCGATGTACTCAGGAATCTACTCTCGTATGTGACACAAC
CAATTAGACAAAGGACATGGCGGGTCCTTGCCAAAGAATGCGAAATAATCCTCACACGCT
GCTTAGCGTTGACAATAAAAACCCGGAAAAATCGGGGGACGAGGTCCGAGAGGCGTGTTC
GTGATGAGAGGCGGCATTATCCTCGAATGTCCTCGATTGTGTGTGCGTTTTATCCGCAGC
CATATCTGTATCTGTGTCTCTCATTGTTGTTTGATTTATATCGGAGGCCTGGCTCATCAT
CATCTCATTGTTTGCCTCACACCCCACCCATATGTACATATATGTATGGTACACATATCT
ATCCCATATCATTGTGGCCCAGATATAACAAGCCAAAGCATTTCTAACCTTAGCCCATGT
CCACAGTCTATTAGCCACAAATCCCCATTTCCATCTACCAACTATTTGCTTTGGTCTTTT
TGGGTCATTTTGGGTGTTTAATGCGGCTAGTTTCGATATCATCAATCAGTCAATCATTGC
TGGGCAAATAGAAATCAATGCCAAATAGCTTAATGTGTGAATTAATGTGCTATATAGTCA
GATTGTATTACACTTATGGGCTTTGATGTTGACATAAGCTTTAGTGTTCAATAAAACTTT
AATAGTTTTCGGACTAAATAAGGGAATACGCCAGAACACTGGGATCGGAATTAAAACTGT
TTTAAAACAGTATATGCCAGGCCTTATTTAATAACTTTTTCTGTTGCTATTCAAGAGTAA
CCTTCTAACAAAACTCTAATATAAAATACAATACAATACCATTTAGGTCATTTAAAGTCT
CTTGTAAATGATCAAAACCATTTGTATAGCACCGCAATAATTGAAACTTTTCCAAGAGCC
TTAAGCCTTTCTCACATTTTTATTTACCTTTTTGCCGCGAAAACTTGAAATTGTTTTCCA
TTATTGCGCATTCTTGGCTTCCCTGCTTGGCAATAATTAAGTCCAATAATAATTTAAACA
AATACCTTCGCCAACCCCAGGCTCACCTTCAGCTTCATTATCTGTGGCAGCAGGTGCAGA
ACACCGCAAAACATTTGCCTTATTTCATATTTCTAATTAGACAGCCGACGCTTTTCCGAA
GTTTTCATAACCGGGCAGACAATGCAATGCCCGCAAGAACAGAGGAAAATTCAATTTTCA
CAAAACAATTGCCATTAGGCGACGGTTTTCCTTTGCCGCTAGAAGAGACGAGTGCTCTGC
CCAATTGATGTGCCTAATCAGTTTATCTAAAGCATTTTTTTTCTTGGCCGCCCTTCTGAG
GGTTGCTGGCCAACAGGAAATTCATCATTGTCAAATGTGCGGCTTGACATTTTCCAAAAA
GGAGGGGGAACCCGGAAAAAATGTAAACTTTTTTGAGGCAACTTTTGGCTTTTTTTTGAG
GGTTGCCTTTGCAATATAATTAGAAATTCATAATGAATTTTATTTGCTTTGGCCGCAGAG
AAAAAAACCGAAATGAAAACAACACGCGGCAACGTCGCCTTGTCTAAATGTATTTTTTTC
GGTAATATTGACGCGCATTTTTGTGCAAATAAAATTAAAGCGCCCCCACGCCATTTTCGC
CCTTATGAACCCACCGCATTAACAGACCGGGGCATATCAAATTATCAGTCATGGGCTGGG
CAGTAGTCAGTCATTCAATCACTCAGTCATTCGTTCAGTCAGTCCATCAGCAGGAAATTC
TGGGTCGAGCCTTGGATTTCAAATTTTTTGGTTTTTGGTCTGGGGGATCTGGGGGTGTTA
ATGCGGCGTGCAGGTATCAAAGCGACGTTTGAAAAATGAAATTAAAAATTGTTGTTGATT
CTAGCGCAAAAGAAATGGATAAAGCGAAAAAAAAAACAGCGGATGAATAAAGTTAATGAT
AACAGCGACTGTGGCACACCCTTCTGGGTGATATGAAACAAAGTTAAATAATGTTAATAC
AAGTCTAAAGTCTTTGCATTATTTTTCTAACATTATTTGTTTGATAAATCTCTCAAAAAT
ATACAATGCACTTTTAAATGTAATCTACTAACAGCATGTTAAGTACCCACCTACATACAG
TCAACCAACCAAAAGAAAAAAGATACAGCATGCCTAGAATTTTTAATTTTTAATGAGTCA
AAGAGCACTTCTTTGGGCTATCTATGTCCATGGCGGAGGTTGGAGGTTTATTCCAAGTAG
TCAGTCTGTCCAGAAATGCCCCTCACTGCCATTCATTAGGTAAGGACATTTTGTTGCTGT
CTTCATTAGAGACTTCGGATCTCAAAGTAAACTTGGAATGTATCCATCTATCTGTCAGCT
AGAGTTTCCTGCTTGTTGTCGGGTCCGGATATTGCTTTGGTTTTTGCGGATGACTACATG
GCGCCACATGTCACCAATACAGAATCCAGAATGCCAAATACAAAAAAAAAAAAACGAAAC
GGGACCTTGAAGGACTTCGTTTTGAGTAGCATGACCTTCGGTGTGTTGCTCATATTCATT
ATAAGCCCAAATAACTGTTGTCGTTGAGTGGCAAGTGTCAAAATACCATGGGCCCAAAAG
GATTGTTACCATCGCACGTCGATTCCCCGATTTCCTCTCCTCGATGGCGCCTTCTGGTTT
TCTGCTCAATTGGTTCTGGCGTCGATTTGGCCAACTTCTTCCCCCTTACCAGCCTGACGT
TTCCCTTTTTGTGGGCTCGAGTTACCAGTTGCAGCTAACTGACTTGCTTATTGGCCTGGC
TTTCGGTCGGCCACTTGGCCACTTGGCCCGGCTCATGTGATTTACCGGGCCTCTGCTGCT
CAAGTGTCAGCAGAAGCTGAAGGGAAACCTTAGTGGCGGTGCCAGTGGCGACTGGCGACA
GTTGGCCCTGGCTCAGCATTAAGCCTCATTTCTGGCCAATTCTGTCCTACACTTTCTGAT
AACTGTTGCCGTAAATCAATATCTCGCTTTGTGGTCAATCAAAATGCGTTTTTTTTGTTT
GCACTGGTGCAGAGGTTACAGTTCGGGGAAATAAAAGCCCATGAAGTGAAGTACTTACGA
TATCTTGAAGTACATAAGTTTAAAGACTGATTAACTACGTATCTCCATATTTTTAACAAG
CTTGGGCGAAGTCTAATTAATTTTTATTTCATACGGAACCGAACAAAAGAAAGTCGTCGC
GGCAATAATTCATTGAAAAATATCATCAAAATCAAATGACAAAAACAATGTCATAAATAA
TAATTAATGCCACTTAATGCACCACTACCGACAATATTCAAACATAGCTGCGAAAAAATA
TTAATATATATAAAAATATAAAGCAGAACATAAATCTCGACGGAGAGGGTGAAAGCAAAG
ACAGACAAGTTGGTCATAAAAATGGTTTATAAGTCCATAAAAACCAATTGTTTGCATTGC
CCGTAATTGCATTAAAAAAAACACTGAGCCACGTGGACACTCCAATAAATATTGATGGGA
AATTGGGGGAAAAAAAAATGAAAATCCGGAATCGAAGCGTATGCATTTTTAATTTCGGAC
TTAACGCGGCATATAGAATGTAATTAAAACAGAATCTGATTAAATAAAAACAAATTAAGT
GGTTTGTAAATAAATTGAATAGCGAGTGCGTAAAAAAATGTAAATAAATTTGCGGCCATG
TTATTGTTACATAAACTGCGCTTGCCAATTTTTTGTTGCCTGTTGATCACAAATAATACA
TTAATAATATAAACCAATAACTAATCATATAAAACAGCCATGTCTGCATCGTCTGTACAG
TTCAGTCGACTTTTAGAATGCTTTTCGAGAAACTCGAATAATACCACCAACTTTTACTTA
AGGCCAAAGTTAAAATAATATTGTGACAAGACCCATCCCTCGAACAAGACTGGGGTTCTT
TTAGCTTCTAGCTGGAGGCCAAATTCGTAGACCATCCACATTTGTCTATTTTCCTATGCA
AATCGTTCGATTTCACTGTGGAAATGGATGTTTTGGGCCAGTCTGAGGAAAACCTCTGGT
TGCAATCACAACCCCTTTGCGCATTATGCGTAATTCTAAAAATGTTTTCTTTTGCTTTGC
TTATTTTTTAATTGCTAAGTTCTTATTTCCACCTCAGCTCAACTCAGCCCTTTTTTGGCC
TTTCTACTTTAGCCTTTCTCGTCTGCCAAAAAGTTCAACGAAGTGTGTAAAGTTTTCTTC
TCACAGCTGAGGAATGGGGTAGCTGTTAGCTGCTTTGGCATTAAATTTGTGTAAATGGAT
TTTGCTAATGGATCCAATAATTCATTTACAATTTTACTTCTTAGCCTGGCAAATGGTATT
TGCGCCAAGGTAAATAGGAGTCAGGACGACTTGGCCGCACTTTTCTGCGGTCGCCGATGG
GAAGGAAGTCAAAAGTGGTTTGCATTCGGTTTTTGGGTGGCTTTCGGTGGATGATTTCAC
ACTTAAGTTGTGCTGGAAAACGCTAAGCTAAATTCCTCGGCTAAGAGAAAAGCTTTGGGC
CTAAGGACTTAAGAGGACGTATTTTCCAGTCCAGGTTTCAGCATCAATTAGACGCCTCTA
CGTTCTATTGAAAATATTTATTTGTCTTACATTGTTACAACTTTTAGCATTGCCTGACAG
TAAGTTGTTGTTAATACATTTTCCACCTAAATTCGCTGAAAGCCATATCAATGTATTCTT
TTCCGCAGTTTCCCTTAATCTCCTCTAGCGCGGAAAACAATTCCAAACACACAATTAAAT
ACCATTTTTTACGCCCAATAAATTTGTTAAAAAATGTATGAGGCTGCGTGAGGTCCCTTT
TGTGTGTGAGTTGTCTGCTTAACAATATGAAAAATAAAGCTGACCATTTTTTCACACGCC
AGACACGCAAGGATGAATCGGGGGATATATGTAATTGTATATACATATATACATATTTAT
ATATGTGCGGGCCAAAGAGTTGAGGGCAACGCGTGCTAAGGACCAAAAAAAAGGACCCAC
AACAATGAACCTGAGCGTCACTTTGTCTTTTTGTTGGCACACACACACACACACTCGCAC
GCAGCTGGACACCCGGTTGTGTATGTGTGTGAAAAATCACTGCCGCAGTGACGAAGGTCC
TTCCTCGTTGTTGCTGTTGTTGCGCCATTATTTTGCTTAATTATTTACATGAGTAAACAG
TTGAGAGTTCAGTTCAGTTCACTTGCGCTGGTGATGAGTTGCGGTGGTAATTTTTTCATA
TATTTATGGTGTCCGCAGATATGTGCAGTCTAAAATATTTCTAAAGAACTAATTTATGTT
ATTTTTTACATAAATAAACCATAATTTCTCATAAAAAATTGGTAAATGTTGGGGTTTTTT
TTAAATTTTGATATCCATCCTTTTCTCAAAACGAACTTTAAATTTGTAATATTTTTTTAA
GTGGACTCATGTGTAAATAACCTCAAGCGCGTTGCTTAAAAATTGGTCAAAAGCTCGCCT
AATGGATCGCTTACTTTTTTGCGGAAAATGAGTTTACCCGAGGAAAATGCGGTGAAAGGG
CACCCCAAAAAAGGTGTGAGTGTGGCTGGCGGAGCTCTCACCTCTTAGAAAATGTATACA
TGCGCTGATATTTCCAATTCCATAAAAGCGAGAAACGCCTTCGAGATTCCTGTTTTCCCC
TGCTGGTAATGTCTTTTTTTCTGCAGCGAATCAAATCGAAAAGAGCTGAAAGCCATCGCG
AACTTGGCAGAGACTTCCAATCAGACACAATTTGTTCCCGACCAGAACCGCAATGAGATG
AGGAGAAGGCCACGAAGACGAGAGCATGGCTCACACGGAGCTCCTTGTCTCACCTCGTCC
TCTGCTTCCGCCGCCTTGGCAATAATAATTTCAAAATTACAAATTCACAAAACGTACGCG
AAATTATGCACAATGTCTGCACCTCGGTTTGTCTGCCCCGCTTCCCTTAAGCTCCCTTTC
CCACAACGCCCCTGCTCGAGGACTGCGTCATCATCCTCCGATGCCCTCATGTATCTTTGT
ATCTTTGCATCTTTCAGCTGCCATCTGCCGCTGCTTCTGCTGCTGAAAAAGCTGTGCCGC
GCCTAAAGCACTTTTTATATTATATATATTCACATTTATATATAGCTATTGATGTGCCAT
ATATATATATATATATACATATATATATTGGGTATATATGCCGCCATGCCGCATCAAGGA
TTACATGTTGCGCAAGCCGGGCCACATCCTCACCTCAGTTTTTGCACAGTGGGACAGTTT
TTTTACCAAAATAGATTACTTTAAGTGGAAGCAAAAGACTAAGATGCACAGAATTAAATA
AGAAAAATCTTTGACACATCAATAATTTAAATATGCTGAAAATTTGATTGTGTTACATTT
TAAAGTGCATTGAAAATTGAATTAAATCACATATATTGTAAAATAAGGGAGACTTTGTAA
AAGAATTATTATTGTCTATCGCATTAATCTTTAAACGTCTATTATGCACAACTTTTATTG
AGACTGAATTGTTTTCGAATTGATTTTGTCCCACTGTGTCGCGTCTCCATTTTCGTCTTG
TATAAAATGCATAAAATTCACATTTAGATATTGCTCTGCGGCCTGCAACTGCGACTGCCG
GCTTCCATGCTGCCATGTTTCCAAGAGTTTCCCCCGATCCGATATGAGGGCTGGGTCCCG
TCTATAACTGGCATTCATCATTCATTCATTGCCTCCACACCAACGTCAGACTGCGATTTT
TCATAGCAAATATGGCGAAGTCGCGAATCGCGGAGTTGCCTGTGCGGCTTTCTGCGGCGA
GTCTGGAAGTCTTTGAGTCTTCGAGTCAATCAAATGCCCCAAGTTCATTACGAACTGCAA
GAGTGGTTGGGTGAGTAATAAGTGTCGGCTCTTCTCTCTATAATAGTTTGCCTGCCTATC
TGTTTGAAATACACAGAAAAAATAATAAAATTCTGCTTGAATAAGTATTTCAGTTTTTTA
GCAACAATTAACAAATAATTCTTGACTATAAAAAGAGATAAAGCTTATATTGAATATCGT
TACTACTAGACTTTTATTTGGTTAAGAATTTAATTATTTTTTTTTTAATTTCGAAATTTA
ATAGTCCTTATTGAACTTGAAAGCTTTAAGTTTGTTTAAACGAATATTTGAGTATTAAAA
ATATTTATTTATATACCATATTTTAAACACACACATTATAAGCGAGTCATAGGTATAGAA
ATGCGCTAATTATAATAGAATTTTGAAAATATTTGACTTAATGCTTAGGATTGGTTTATG
GTAAAGAGAAAATCCAAAAGTGCTCCTATTTGGATATTCTTTTTTATCCGTGCAGAATAG
TTGGCCAAGAGTTGGGCATAGATCAGGTTAGTTCGTTGCCACCTTCGTCCATTTTCGGCT
GCTACTTTGTTGGCCGTTTGGCTGTTGGCCTGGTCCGGAGTTAAAGTCGGAGTCGGTTGT
TGTTGCCTTTGCTGATGGGGATGTTGATGGGCTTGATGCATGTTGTGTTAGCTTCTGTTG
TTGATTTGGAATGCAGTTTGGCGGTATGGCCCGGGGCCATATTTCCTGCTCCTGCATCCG
CCACTCCGCATTTTGCATTTTGATTACTTTTTTCAGTTGCTCAGCCGACAGTTGGAAGTT
TCGATTTAGTTTTTGTGGCTTATAGAGAGAGATGCGCAGATATCTACTACATATATTTCT
ATAGTTGAGCATTTTTCCTGCGCTTTGAAAAGAACCGAAAATTCAGCACTTTGCCAACAA
TTGGCCAAAAAGGAAAACTTTTCAACTAACTTTTTAATGGCCACGTGGAGGGAGAGCTTT
TAACTGTAATTAGGAAACAGGCGAGGTTACCACATTGAGAAAAACCCTAACATTATTTGT
ACTTCTCATTGAAAATGATTTTAAGATATCACAAACACATATATCTACTAGAATTGTTGT
TCCACATGCTTACCTTTGGATTTGAATTTTATTGAATTGAAATTTATTGAATGTTTGCTA
TTTACAAATTTCGCCATGTGCAGCACTGGCTAATATATATGCCTTTCAAAATGTTGTATA
TATAAAGCGAAAATAATAAGGAAAAATTCAGCTCAATTTTCGTGAGTTCCGCTTGGCATG
CAATTTCAAAATTTTAGCAATTTCGCTTCTGGTTTGTTGCTGTTTTCCTCCTTTTCTGTT
TCGAGCAATGACATAAATTTATTTGGGTTTCTCGTGTTCGGTCGGCGCACAAAAGTTGAT
GCCACAAAATGGCGTCTGGCCGGGGAAATTGTTGCATGCATTTGCATATTTTCTGCATCG
GCTTGGCCCGCAAAAGAGCGAGTGCGCGACATTTTATTTGGAAAAGTGCAGGCCCACTTA
GCTCCCTCCTGCTTCCCAAAAATTTTCCCTTTTTCTCGGCCATAAAACATTGCCAGCGCT
GTGCCAACATGGCCAAAATGGCGTTGGGGAAAATGTCAACCATGTGCAAAAAGGCAAATA
TCAGTGGGCGAGGGGCCACCAGTAGCAAGTACCAACCGGTTGAAGTACGACTATGTCCCA
GGGCACAGTGGTAGGAAAACTAAAACCAAGTAAAAACTAAAAGTATTGAATTAATAATAT
TTTGGATTTACCAAAAATATAGCCTGCGCCTACTTCTTTATTACATTATTTGGTATAACA
ACTGTTTTTGCAGACCTAAAATCGATTGTCTGCCCACTATAAAGAGTTTTTGTGTTAGTT
AAATATTATTATGAAATGATAACTTAACTTAGAGTCTTGAAAATTATTATTTTAATATTG
ACTTAATTCATCATGATCATTATTTATTTTTCTACCCCTAATGAATAAATGAATTAGAAT
GATCACCATCATCGAGGGCACCACTGTACATTTGGGCGGGCAATCAGCCAACCAAAGCGA
CGGCCATGCGATGTCCAATGCCCAAGCCACCAAGACCGCTCCTCCTCTTCCGCCTCCCAG
TGCCTCCTCCTCCATCACCTCGCTCCCCCCAGCCTTAACCCTTGGCCAACCCCGCAGTCG
GAGTAGAACCCGCAATTATGCTGTAGACCAAAGCAAAATAATTACTTTGATCGTCAAATG
ATATTATTTTGTCGGCCATGCGGTGTCTGTGGTGCAGGGTAGGGTGTTTGGGAAGGTGCG
GGGTGGATAGTTTTCCGTGGAAAGGGGGAGGGAAGGCCGTCCGAGTGGGCAGAGAGGGAG
GCGTGGCTGGTTCTGCATGCAATTGAGCTGGGTGTGCGAGTGTGCCGAGCATAAGTGTGT
CTGTGTTGGCAATGGCCGTCGCGAAACAGTGGTTTTAAATTATGGCAGATTAGTTAACAC
TACTGGAATTTTTAACAGTTTTTTTCAGAACATAACATCTTTGGAATACAGAAATGTTTT
ATATTTTAAAAGAAAACGGAAATAATAAAATAGATTCTCACTCTTTCACAAATTTTATGA
AAATACTTATACTGTAATCCTGATTATTAGCAAGTTGTTGTATTGTAGTCAAGACTTAAC
TTAACTTAACTTAACTTTAAAGATAAAATGTTACTCTACTACTTATATTATACATGTTTT
TTCCACTGTTTTCTATTGGCCAGTCATAATGACGTCGACAATGGCCGCCATCAACTGAAA
GTGCAATGTGCATTTGGCCAAATTTGCATTTGTCGGTATCCCCGCACCAACACCACCCAA
AAGCCATTTTAGCTGGCCCAGGCCCACAAGTTAATTACTTTTTCGTACATTTTCGATGGC
GCGTTTCGCACTGGAAACTTCCTTTTTTCCATCTTTATTTATTTCACTGCAAATGAAGCC
TCCGCATGGCCAGGTTGCCTCCCCAAGCCGCCCCACAAAAGCCCCTGAATACCCCACGAA
ACTGAAACTGAAGCTACAGCTCCATTTGCAGTCCCAGTTCTCAGTCCACAGCAATATCCG
CGTCCTGCATTTCGCTCCTCCTTTCGGTCGTTGTTAGTTTGAATGCGTTTTCGCATTTAT
ATGCAAATTTTTTGGTTTGCATGCAGAAAATATTGCTTTCGACAAATGGCCGGAGAGTTG
GGAACGGGAATGGGATTGGGGCGATGATATAGTGGGGGTTTTTCTGCCAGTTTTCGGTGT
GGCTGCCAGGAAAAAAGGGGACGATCCCGGGGCCACGGAATTGGTCGGCGAAATTGCAAC
GAACTGACCAATGGGCGGCATCACCATCATCATCATGAACTCAAATGGGCACAACCGCGA
AATTGGATTGGAATTCGACCGGGATATGTGTTTTTTTTTAGTAACCCTCCGAATTATAAG
TTATTATTTATCGAAGGATGAGTTATCAGAAATCGGAATTTCCCAAAATATAATTGAAAT
ACAAAAAAATAAAAGGCATCATGTATACATTAAATAACTTCCAAAACAATGAAATCAATT
TAATTATCGTTTGACAAACCTCATTAACAGTTTTCACTTATTTAGCAAGTTTTGCAACCC
CGTGCACTATGAATATATATATCTCATTTTCCAAGAATTCCTAATAGAATTCTCTGCTGA
TTAGAGGTAAAAGAAAACTTCCCACACATTTACTTTAACCTTTTGTAGACGGCCCAACCC
CCTTTGGCAAATTAATAAAAAGAAAAATGTTTCAACTGAGCTGCAGATTTATGGCGGTTA
GAAAATGTGCAATTAATGCGTGTATAAATTACAGCGGACAATTAAATGGGGCTCAGACGT
GCTGAAAGTAGCCTCTAACCATCCGCAAATTATCCAGACCCATAGCGACCCACAGCATTA
CACATACGCCGCGTGGGCGTCGACATTGCGTGCTTAGGGAGTGTGATTTATTTTTGGGAG
AATCGTCTGGATGAGCATTCGTATGAATGGATGCGTTTATAATGAAGTTCCGATAATACA
TACGACTAATTATGCGCCAGGAAGCGTACAAGGAGATGCGATTCGAAGTAGACAAAGGGA
ACTTGAGAAAACACTAGCACTAAATGTCCTGTGGCAATAGAACTAGGTAATTCTCTTTTA
AAGGATAATCAAAGCCTAAAAATTAATATATTTCGATACGTTTTGTATAGGGTAATAGAA
AAATGTATATAATAATGGTCAGTTGGGATTTATTATAAAATTTCCAACTAAATAGTGATA
GTTTATACTTTTAATGCTAACAATGTATTTGTAAGAATTTTTATTAATTTCAAGTTATTC
GAAACATTCTGTTTTATAAGGAACACATTGTGCCAACAGGCGTTGAACATCATCTAGTTT
GAATACACATTCCTTACTTTACATACCCCAAAAATGGGGTTAGCTGCGTAATCTACAGAG
CCCAAATTGAGTTGTCTGTGTGCAATGGACAAACAGAACCCCACCCAGCTTTTGTTTACC
CCTCCCCTCTCGTACTACGCCCATGCTCCTGCAGCAATGCAATTCATAAATTTCAACAAT
GATAATCGAGCAACTGAGTTTGAAGAGGGCGTTGCAAGATTGCTGACTGCACTTGGGCGA
GATTACAGCAGGGGAATTGCCAAAGAATGGGGATGTGGCAGCATCCAGTCGGCAAGTGTA
ACATATTGCACATGCACACTCCCATGCCCGTGTGTGCATTGGTCCTTTTCGCCCAGGACA
ACGTCGCTCGATTGCGAAGCCGATGCCATCGTCGCCACCCAAACAAACACTCGACGCTTT
TGTTCCTGCTGATGGAATTATTTGTTCGCACATTGTCAACTTGCCACTCCCCCAGGCCCC
GGGCACCTCGGCCCCCCGCCCCATATCTTTAGGGTGTGCATACACCGTAAAAAATCACAC
AATGCTTACCGTATCAGTATCGTGGTGTAACGAATTTCACGGGTATATATACAAGGAACT
ACCCATGTAACGATGTTTGACTTTAATTATAAGTAATATTAACAAAAGATTAAATCTTAA
ATATAGTTTAATTCAACTTATTGAATTCAGAAACGTTATCTTTTTTTAAAAATTTATTTT
ATAAGGCTCTTGTTTTGCTCGCTGTGTAACTGCGACATCCGTGGCTGGTGTTTCCCATTG
CAAAATGCAATTTGCCGCCACCCGAAAGGTTTTTCCACCCACCTTTTCCCCCATTTCGGT
CTTATCTTTGCTTTCATTTCATAAACCAGCTGCCCCCTCGTCCAGTCACAGTTTGCAACA
CTTTTCGACCGCAAAACGAACTCAAAACTGAAACAATGAAGACTCGTTGCTGCAACTGCA
ATCCATTCTGTGGGCAGACTGCAGTTGCCGGCACAATGTATCATCAGTTGAACTTTTGTG
CGGCTGTCATAGGCAGAAATTGGTTGCATGCCTGCCTCTCTGCCGAAAAAACACACACAT
TTCCCCGAAAACGTGCCCTTGCAACTTGATTTGCAACTTCATTTGCAATGCTTCGGGATG
GGAAAATTTTGTGGGGGGGGCGACGATGGGGATTTGCATGGAGGTCCAAGTCGAAGGCTT
ATAAATCATCTGGAATTGGTTTGGAAAAGACAATGTGATTGGATTTGATATTTTCGTTCA
GGGTTTCGGATAAGATCTCAAGGCTTGGCTTTCGATTGGGTGAAAAACTTGAGGATAAAG
CAATTTACGGGGTCGAGACTTAAAACAGTTTTTTCCCTGGGAAAGAATTATATTGCTGAA
GCGATTCTCAATCAAAATGTAATATATATAGTAAACTGTATATATAAGGCATTGCATGTC
TCATTTCTCATTTAGATGTGACAGGATCCACCGACTTTTTTAGGCATCACCCTTCAGGGT
AACGTCTCTATATCTTTTTCCATAGTTTATCTTTATGTTCGGCTGCAATTTTGTAGAACA
GCATGGCCCGAGGAGTTGCTCACTCTTCATTCTGCCTAGTTTCCAAAGACTAATTGAAGA
CTCTCAACACCTCGGTCGAACGGAACCAGCTGAAAACTGTGAGAGCCGCCTTATATTCCC
AACTGGCCTTAATTAATTTCTCACCCATCCAGCGGCAGAAACTACGCAGCTTATTTGAAT
GTTTATTAAAATGTACGAGAACTTCCCTCCCCGGGTTGCCTTCTTTTCTTCTCGGACATA
GTTGCGCCTAATTTGATATAAAATATATGTATAATATATATACTTATGTGCTATAGTGTT
ATGGCAAGGCAGGCGGATCACTAACAACGCGCCAACATGCAAATTGGCAATTTAGTTTTA
ATTTTTTAATCGCTGCAAAGGAAAATTCAACACGTTACGTTGATTGTTAAACATATATAT
GTACATATAAATTGTATTTCGTTTGGATAACTCAAAAGTGGCTACTGTTTTACATACATA
CATACATAGGAAAATAGTTTTTTCGTGTGCACCTTTTCGTCCATAATTTTTAATTGCGAA
ATGCAGAATATTTAAAAAAGTTTCAGTCAAAAGGGGCTAGTAATTGTTTTCGAGTGCATA
CAATATCATGTCAAGCAGACATTTCAATTCAATTAAATTCTTTCGCCTTTTATCGAAAAA
CTTTTGCGGCAACAACTTTTTCGTATTCCCAACCATTTTTCCACTTTACAAAAGCTGCAT
AAATTAATTAACTAAAAATGCTTTTAAACTTGTACGTCCCTAAAATAACCAAATTCTTCA
ACGGAAATCTGCGACTGAAGGAAAACAAAGGCATAAATCGATTAAATTTGCTGTCATTCT
AAATTTGACACATGAAACAAAATGCGTTGAAATATTCCCACCCACGGTCTTCAAAAAATA
TTTTTTTAAATGGAGAGGGGGAGTTTGTTCCTGTCACATGTAGCTGGGTGTGAAAACAGC
AACAACAGCAAGGGTAACATACGTTCGAAAAGCTTTTCAGATTTTCCCCCACCCCACCCC
AATGGGGGTTTCCTTTTGGGAAAAGGGTGAAAATCTGGGTGCGCGACGTTTATGCAAATT
GTCAGCCGTTTGACTGTGAAAACATTGTGTAGCCATTTGAACTTTCGGGCAACAAAGAGT
TGAAAGGAATTTTTTTGGGAGGAGCAGATGGATTTTAAAATTAATATAAAACGCTCGAAA
AAAGATAGAAGAAATAGTACAAAAATTAAAATTCATGCATGCGCTAAAATTATGAGTCCT
GAGCCGATTAATCTGATGCGATGGTACTTTTAAGATTATATGTACTATATGTTCTAGAAT
CTAGTTAAGTAAATTGATTTTCTAAAAATATACATACATACCATTAAAACTTAACAAGCT
GTTTTTGTTTTCCACCTGTTGTAAGTGTCTTGTTTCTTCCTGCAATTTGAATTTTCATTT
CCATCCAAAGTCCATCTCGGAAAATCGTTTCTTCGTAGATTCTCTTCTCATTAGCTCTTT
GAAAAATTGTGGTTACAAGTGGAACGCGTTTCCGACTTGTGTAAGGCGGCACCGAGCGAT
AAATAAGCGTCTTTCAACCTACAACTCTGACTTTAACACTTGCGACAACTTAATTCGCCG
TAATCATGCGAGCAGTCTGAAATGAAGTCTCTTCACCGCTTCCACCGAGAGACCCAATTT
AAATTAATCAACTTGGTGGGCCGAACAACACCCATTCAAGTCTCTGCGATTCTACCACCC
ACTCGAGGGCTCCTCACGAACTCCCGATAACCTCAGCTGTTGCGTGCTCCCGACTAATTT
TCATGTGCGTTCCTAATGAACTTTTAATTGTTTTCCGAGAAAAAAAGAAAAGATTCGATC
GGAAGACAATCGCAATTGAAAGTTCTTGCTTTTCTTGTATTTGTTTACGGTGGGAGAATA
GTACAAATGGTTTGGAAAACTCTTGAAAATATAAGCATATGTATGTAAATATTAACATAT
AAAATATAAACATACTATTACTATATATTTCCGGAATTTTAGAAATTAGCTATATCAAAA
TTAATTTTTTAATTTTTCAGCCCTAACTTATGCTTAACCAGGGAATCATTCATAATTCAC
TCTGAGGTCCTTTAGTTCGATTCTATTTTTCCGAGTGGCAAACCACACAAAGCCCACATA
AATAAATTGCCGGCAATTACGGCGTTAACAAGTTTTATTGACTGACTAAATGCGCAAAGC
CCCCCGCCCCCGGAAATCCATGAAGTGAATTCCCCCCTCCGTCACTGACGAAGTAAAGTC
CAGAGATTTTTTTTTCAGCTGCCCGACGTTTCAACTGAGTTCTCCCCCTTTTTCGGATTT
TTCGGGCAAGGACATTTCATGGGCTTGTACAAACGTTTAACCGAGTGTCTGCTCCCCTCA
GCTTTCCTGCCCCCTCCCGCACTTTTTTCGGCGGGGAGTAAATTTATTTGCGCTTCGTGG
TCGTCTGGTCAAGTTTTTGTTTTTGACCGAAAGAGGGGAGTTTTGTGCCGAGGGAGAACA
ATGAATAATGTCCGCCAGTCAGCCAGGCGCAATCGCTTGTTTCCACTTGCCGACCACCCA
CTGACATCCACCCATTTTCCCGCCCCACTTGGTCGCCCATTCATTCCGCTAGATCAATCT
TCGTTGCACTTCTGTTGGGTATCCCCCACCCGTTTGGCTCGCCCTGTCCATGTCTGTCTA
TCGATTCGACACTTTGTTGCATTTGAAATTTATTAGCCAGTTCTATTCCACATATACGTA
AAAAAAAAATGGTCTGTTTTGTAAAAAATGTACATTTCGGTGGAGTTTAATAAAGATAAG
ATTTATTTTTAAAGGTAGAAAAACTATTCCTCAGTTTAAATTCACACTTTTATCAGAATT
TAAATACTGATTACCTTTTACTTCTTGCTAAATTGATTAATGCATAGAATATTAAAATGT
TATTATGTGGCCTTAGAAAAAAATTGCCTGCCATGCAGTTTTCTAATACATAAATCCAAC
AAATATACCTTCGCTGCTAAATACCTATTAAAAACAATAAAGAATTTTTGCTATTGCAGA
ATCGACAGAAATCTTTATCGAGCACGTGCATATATGTACATACGAGTACATCCCCAGCAT
ATTTCTCACATTATAACTGTCAGTCGAAAATTTACCTTTCAAGCTAAGCATAAAAAATGG
CAAAAAAGAATCATAAGGCGACATTGATTCCGTGCTATTTTTTTTTTTTATTTTCGGCAA
TGGCAGCCAATAAAAAGATAAAGCCAGGCAAGCGAATCGTCTGGGGGAGGGAGGTTATAG
CCATGTGTCTTGGTCTCGGGTGGTTCGTTCCCCTCGGGAGGTGGTGATATGGGTGATATT
GGCGAAATGGGGCGGAGGCGTTAAGGGGCAGGGGGCGTGTGCTAGGCGCTATCAGCATAT
GCGGTTTAAGTTGCGGTTGACATTTATTTCACGCACCATTGCACAAATAAATGCGTTGCG
GCTTGCCGATTCGATTGGAGGGGGTGAAGAATATATATTTATATGGTCTGGAATCGTTTG
GGGTAATGTACTGAAGTACTGAAACTTTGGAGAGTCACTAAGGGTACTTTATAAAAAAAA
ATCTATGAAATATATGTTTCTTAAAAGCCAAACAAGCGCTGTACCGTACCACAAATTCCA
TATAGCATCTATAATTGAAATGTTACAAATGGAATATAAGTTTGGCAATTCGATATGCCC
ACTTAAGTTGGTTCAGCCTAACCGATACTTTTTCTTATTTAACAGAAAGGTTTACAATTA
ATCGATTTACCTTACGTATATCATATATTAATTAATTTATCCATCAAATCTTCAATTAGC
AGACACTCGAAGAATGTCGAACTGGCGCAATCGATTGGAGAACTCGGTTTGTAACAACTT
TGACGGCCAAAGATCATCTCCATCACATTTTTGCGGGCCAGGAGACCCTTTAACCCTTTT
CGTCGTCCGTGCAACTTCTGGGCCACGCCCCCAAAAAGGCAGTAAGAAGGCGACCTCTTT
CGAGGGTCTCGGGGTCATTTGTTCCCACTTCCTCCACACTTGTGTTTCAATATCTTAGCT
TAGGATTTCTTTTTCGTTGCGTTTGCCTTTTTGGGTTTTTAATTTTACGCTTCGAAATTT
TATAATTTCCACACTTTGTGCTAGACTGCCCCTCTTTCTTCATTATTTTATCTCTCCCAT
TCGGTTCTTGGGGCCTCTCGTCTTTAGCCTCAAACATCAAAAGTAAAGTTTTATTTTCCA
GCATATTCTTTTCCCTGCTCCTCGTATTTTTGCTTAGCCCGACTGAAAATTCCTGTCACG
TACACAAAATTTTAATTGATGCCATTAAATGGTTTGGGTCTCAAGAAGCGAAGAAATAAT
ACAAGTTGAACGAGAGAAATAAAAATATGGTGGGCGAAAAAGGAATTTGGAAAAATAAAT
TTAAATTTTTATTATTATTTAAATAGCTCCATCGCATTTAAATTGTTATTCTCTCTAACA
AGTATAACATTTGATAGGAGGCTTGATTTTTAAAACACATTTATATTTTGTTGCAACTGA
ATATGACATAAGGATGATTATAGTCGCTAACTGAATCTTCTTCAATTAGTGGAATGATTT
AGCGAATTTTTGTGAAGTGGCTCATGAAAGTCAGAGATAGTAAATAATCCCCAGTAGTCG
TTATCCTTGCTGACATTAATTAATGGAACTTACAGCTCTATTCGCAGGATAGCAGAATCT
CGAAACTTTTTAGCTGTGCAAGTGAGAATTTTAATTGTACCCCATCTCCGCACACACGTC
CTTGCCCATCCTGTGTTGACTTTAATTGTGCGAAAAAGCAAAAACATTCTAATTTACAGA
GCTGCGCGAAAAAGGATGCAGGATATGTGAGCTGGTTTAGCCGTGAAGTTGTTCCCCCAA
CTCAGTTTGTGTGTTTGGAATGTGATAGTGTAATTATGATGCGGTTTTGGGTTCGGTATT
CCGCCCTGTCCAGATCCTGGCTAACAATTGCAGCCGAAGATTAGCCAGCTCAGCCCTTAG
CACACGCCCTCGTTTTCCAACCATTTCCATGACCATGTGTCGCACGTTGAGAGTCCCTTT
TTGTGCGAGTCCTTTTTGCATACTCCATTCGGACAATGGCAAATGTACTTTATGCAACTC
GCCATTGTTTGCCGTTGTAATTATGTTGACAATCCATCATCATACATCATCATCATTGGC
CAATGTAGGGGGTATTTCTATATGTTTCTCTAAATTTTTGTTGAGGTTTCTCCGATTGCG
ATTGTATATTTCTGGGCACGGCGCTTGACGACTGCCTTTTGTGTCCTGTTTGGCTAATTT
GTTTAATGAATGCATATGGAGATTCGCATTGGACGCGGTTGGCACGTGATGAGTGATTGT
GGGGTTGAAAAATGGAAGAAGGGGTTGTTATTTATTTATTGATACAGCTGGGTAGCTGAT
ATAATATTTGGTTATTTAAAGTGGCATACGTAAAATTATGTCTGGCACACAGTTAGATAA
TACCTTCGGGAATTGAAAAACCATCTAAAACATTTGACCAAAAGAAAAGGTAAGATTTCG
TAAACAAAATGGATATTATTTTAAATTTATTTTTATTAATATATAGTAATACAAGGAGGG
ATTTACATTGAGCTTTTACTTCTATTTGTTTACATCTTTCTTACTTATTTAATTAGCTCA
AAATCAATTTAGGTTCCAACTAAGCAGCTTCCATCAGCTAATCACTCAAACTTAAGTACC
AACCCACCAATCCTAAGCTAACCCACTACCACTAGCTGTCTGTCAATCGCAGGATCATAT
CTGCATATATATAGATATAGTTGGAAAAAACTCTTCCCCTTCGCTGAGGGCAAATAAGAC
AAAAGTGGAAAAAATAATGCCAAGAAAAAAATATTCTACGCCAGTGTGTGAGAGAAAGTG
TAACTGTGTTTAAACTCAATTAGCATAAAATGCAATCCATCATGGAAAATGTCAAAAACT
GCTGAGCAAAGTTGCTACAAGTCGAAGCACAAAAAAAAATAAAGAAAGAAGCCAAATCAG
GGGTTGCAAACTGAACCGCAAAAAAACAAAGTGGAAAAAATTTCTAATATATTAAACAAA
TATGATAATAAAGTTAGTGTGGTGGGCGAAAGGGGAGTGGCCAGGACATTGGGAAATGCA
GGAAACTATAAAAAAGCAGAAGACGCTGATAGAGAAAAGAAAGTTGTGAACTTTGCATAA
CTTTTTCGACCAAGGATTTCACATCCACTCAGGTATTTACGACCTAACCAAATGCGATAA
AATGTCCCACCCAAAAAATATAAAGTAGATTTCAAAAACCTGTAAGTTAGCCTAGTTGTG
CACTGGGAAAAACAATGAGAGCATTTAGACAAAATGCTTCTTTTCATTTCTACAGATACA
TGTGAAATCATTGGAAATAAAAATATGAATAAGTGTTACAAGTCGCTATAAATAAAATGC
TTTAATAAAAATTACAATCTTTTGAAAAGAAATCCAAATAATTTCTCAACGTGTTCCAGT
AGTTAAGGGTCAAGTAGTACGACTGGGATGGGAATGGGTTAAGGAGGACGAGTCGGCCAT
AAATTTCCAGGTGCTCCTGGCTTTTGTCCTGGCCTGCCTGAATTATTGTCACGGGCAACA
ATGATGTGGCAGCATCAGGAGCTGTGAGATCCTTGGAGGGGATGGGCAGGAAGTCCATAA
ACCATAGGCTGGGGCAACTTTAGCAGAAAACCCTCTCATACGTAGACGCCCTACCCACGA
CAAAGTATTATCGAAGTGGGTAATAAAAAATAGGAAAATATGTTCGAGATTTCGGGCTCT
TTTGGCTCCATATCTAAATTACGCTCATCCGCAGACATATCCTGCATGGAAAACGCCAGC
ATTAAATGTTGAAACTTTGTACAATTTTCGTAGCATACTTTGGGGAAAAGCGAAGAAAAT
CAAACAAAGACTAAGGGGTAAATATCCTTCCATTTCTCGGAGGACTCCCAAGTTCCACGA
ATTAGGGGTGTGGCCGCCGCAAAGATCCTGGCCGCAACATAAATCCTGCAGGACGTCTTA
GCACAGGAAAATGCAATGCCACGGCAAGAGGAATTAAAAAGATGGAAAAAAGAGAATATA
AAGGTGGAGAAAAACGGGAATGATAGAGGAAAAACCAGCAACTACAAAAGAAACGAAGAA
GGCAGAAATTTTGCAGTTGCCAGCCAAAAGGGAAAATCGCATTACGCAGATGTTGCCAAT
TTTGCAGTGGGTAGGGGGGGAGTAAAAAGTAAGGGCGTGGGGAAAATCCAGTGGAAATTC
TTCCCTTTTGTACCGCCCACGAAGTGCTAAAGAAAAAGTCATAAAATGCAAGCAAGAAAA
GAAAATTGCAAATGAAATGTCGAGAGTTTTGTGAGCTTTTCCCGGGGGTTCGAGGGGCGT
TCAAGGGAAAAGGGGCGGAGAAAAAGCAATAAAATGGCGGATATAAAGAAAAGCGAAGGC
CAGGAGCAGCGATTTTGCCATGTACACGGACTGTACATAAACTCCCCTCAATAAAGAGAT
ATAAAGGAAGAAAGTATACAATGAAAGCGGTTCGCAGGAGATACGATATTATTTTTGCAT
TTCACTAGCAATTAATCTTTCAATTTTAAACTCCAAAAGATAATTGGGGAAAATTACTTG
TCGGCGAAAAGTGGAAAGAGTTTGATATATTTGGTTATTAGTGGGAAAATTAATTGAATT
GATAAGGGTTCAAAAAATGATTACCTGAATAAAATCAAATAAATAATTATTCTATTTAAT
TTTACAATTTATCACAAAGGATGAAATATTTTTCATTTTATAAAATATGGTTCTATATTT
ACATATTTATATTAATTCAATTAGAAAATAAAACACGAGAGTAATAATTCGACCTATACA
TATATCTAGGAATATTTCGATATTTAATTGAAATTTTATTGAAATTGTATACGCAACGTT
TTACAGCGCCCCCTCTTCTCTATATAATTTATTTATAATATAAGAAAAACTAAAATTTAC
ATGGTCATAATAAAAGTGCCAAAACAATTGTCTTTTCCTGAATTCTCGGAGCCTCTTTGA
AATGAATTGTTTATAAAGAAATTTACATACCGCAGAAGTTACACAGGACTTTTCTATAAA
TAACTCGAGTCGGGGCCAGCTTAACCCCAGAAAGCCCCACCTCACTGCGCGTACATCATC
ATGGTTGTAAAACTACAACCGACAAACTGAAATTGCCCAACGAAATTTGAAAAACATAAA
TTTAAAATTAGTCCTGGTCAAAGGACCCAGCGAACCCTTGGCCCCACAAGGCCCGAAAAT
TAAGCAGGAACTAAAGCCAAAATATTGTTTTTACCTTGTAAGTAAAATATTTATTCAATA
TAACAATATTTTCTGATTGAGGGATGGAAGAGGGAATAGGACAGGGATAGGATACCGAGG
GAGCGAAAGAGAAAGCGACCCAGAGGGTGCTAGGGAGAGAGAGGGAGAGCGAGAGTGCGC
AGTGCTGAAATTTGCACAAAGGAAATGCCTTTAAATTGTAAAACGAGACGCATAAACAAA
TGCACCAACGCAAACTCAACCAAACACACAAGACAGTCGTTGAGTAAATAATAAAGCAAA
AAAACCAAAAGAAAAAGCAGAGCAAAGGCAACGAGAAAAGCAAAAACACAAGTGCAAACA
CAAACGTAAAGAAAGGAAGCCAGTACATAGCGGAACGTTCGGCAAATGGAACACGCTCTT
GGGGGCGGAGTCTCAACGATGGAAATGAAATCGCAATCTGAATTGAAATGGGAATTGAAA
TGGAAAAGAGCGAGTCAGCTAGCGAGGGAGCGAGAGAGAGAGAGTGAGAAAGAGAGAGGG
AAACGCACACACACTCGCATTCTCGCAATGAGAGAGCGAAATGACAAACAAATACAAATG
CACAGTTATTGCTGCGCCGCCGACGTCGACGTCGCTGCTTCCATTTGCTCCCCTTTTCGC
GCCTGTTTCTCCACCATGCTCCTCGCTTCCTCGCTCTTTTCTTCCCATTGAAGCAATCCC
CAAAACGTGTTCAAAACAAATAAAACAAATTATAATCAAGCAAAGAGAGAAAGAGCAAGA
TGTGGAAAAACCAGAGGAGACATTTTCCAAATTTTTGAATTTTCTTACAATTTGATCAGA
AACCTTCTGAAAGGAGCGGCTGAAATGCATGTGAGCTAATACCTTATTTGGATTAAGTTC
AGTTTTTAAGCCAATGCCTTGCGATCTGACACTTTGGGAGAAATATTAATTGTACCTACA
TACATTTAATAATTGATTTTCCATAATGATTTCCATAAATATAAACTGAAACTAGCTTCC
ATTTAATAAACATTCGTATAGGCTTCAATAGCAGCAATAATCTTACTGTTTTTACTTTAA
ATAAGAGTTTGAAACTTTTAGTACAAAAACTGAGTTATTAAAAAGTTATATCAGGTTGCA
TTTTCTTAAACATATTTAAAACATATATACTAGATCAACAGTCCAAAAATGGCGGAAATC
CATAAATTCGTGTTGCTTACATTGTTTTCTTAGTCGCTATTGTTGGTGTCGGAGCAATTA
ACCCACTGCTGCCCCTTTCGGCCGTCTGCGAGGTTAACCCCTCGTCATACTTGCCGCTTG
GTTCTTGCATAAAATTATCAGCCGCAGAAATTATAGCAAAATGCTACAAGTTTTTGTTGG
TAAATTTGCATCTGGTTTTGTATCAGACGTTTTAATTACAAAATGCTACAACAGCTTCGT
TTCGATGTTTCAGTCGAGTTGTTTAATTGCCTTTGATTACCGGTGGAATTATGGGAAATG
TGAGAACTAATTGATGAACTCCAATCATAATTTCCTTAAGAGATTCCGAAGTTCGCTGGC
TAGGGAGCTATAGGTGTTTTAATTATACAAATTAGGCAGAAGGCAGATTTCAAAGGTAAA
TTTATAATTTACATACATATATATGCAATATTTTCTTAATAAATCTATTTTTTATTATAG
TATTACTTTTGTAATAATATTAAAAGATATAAGAAAATAATTATGTTATATTCTTATTAT
TTTTGCACCTATAACAGGTGCTTAGAATATTTATTTCACTACCCATTTATGGAGTTCCTA
ACAGCTCAACATATTTTTATTCGTTCTTTTGCTGTTAAAACGTGTTTTCATAAAAACCGC
ACCAGCTACATAAATTTTAGTGGCAATTACGTTAGTCAGCTCACCTTGCCTGACTGGATG
CCCAGGACTCTTTTGGATTGCCGGCGGCGTAAGGACCTTTAGGCAGGTCGAATTTCCAAT
TCCAGGAGCGACCATGCTAGCTGCCATTTTTCCCATTACGTAAGGCCCAACCGAAATTGA
GTTGAAAATGCTTTCTTACAACTAAATCAAATGTTTTGATAAATTGCCCGGCACACGCAA
ACATTTCGTTTGGACAAAATGGCCGAGAGAGCTGTCGACTCGATATATATGGTAGTTGAT
GCTTATCTGGCCATTAAAACAAGGCCAAGACTTTGTACAAAAAAGAAAGAAAACAATTGC
GTGCCATTTAATGCGATTTTCGCATTTCGCTGAAATTCCCCAGTGCACTTTGTTATGCTC
TTCTGATGATCTTTCGTTTTTCATGTAATCTATATAAATATTTACATTTTGTGTGGCTGC
AGTTGTCAACACAATTGAGCAATTAAATGGGGGATCTACGCCAAGATCTTCCCATGACTT
ATCTGGAAAAAGGTTCTTCTCATGACTCCGCCGCTGCTGCCACAGCAATTTTCATTTCAA
TTTCTGCGCACGCGCAACATTTCAGCCTCCTACTCACGTTCCCCAAGTTTTTTTCTTTTT
CCATCTTTTCTCGTTGCAAGCTTTTACCTCTTTGGTTACGAGACTTGCACAATTTATCTG
TGATTCCATGTGATTCCATCTTTAGTCTGGGCAGTTTTTCCTGTCAAGAGCTAGTCGCTG
GGATGTTTTAGGGTTGTCATCGTCTCGCTGTATTTATGATTATTGTTATTACCATTTCAT
CCTTCTCTACTCCATTGCCTGTTTCGTGAGCTTTGAACTTGCCAGTGCAACTTCAATTCA
TAAGAAATTATTGAATTCGAGGTTGAGGTTAGCCGCTGCAGGTAAGCTGCTGGTCAAGCG
GTAATTTAAGATTCGTTTTGCCCCTTCAACATTTGCCTTTAAAATGTTTTAACTTTGTAA
TATAACCTATCGAATCGATAGGAAACTTCTGAATCTGTTCGATAACTTCTAAGTACACTC
ACCTGCCAATTTTCATATCCATCTTCAGTCGTTTTCGTAATGGGTTAAGGGCCTCGGATA
GGCCTCTGATTCTGTTTTTCACCCGCGGGCCTTTCTATTTTTATATGGCGCGTGTGTGGA
ATCAATGAAATGGAAGATAATTGCACACACCCAGCATTTCCATTATTATTAACATTAACA
TGAGCAACAAGGATTGTTGGGCGGGGAAAAGTGGGAGGCAGGTGTGTGGCAGTAGCAAGC
AACACGTGTGAAAATCAAATTCCATGGCATCACCTACGCAAATTACAAAATGAACACACG
CAGCGTTGGCCAAAGAGGGGCGACAGGGGACTCACAAGCCGGACAAGGGGGGGTTAAAGG
TGCCGAGCGCATGCCTGAGCACCAATGGGTTAAGCGCGTTAATCATTTTAAGCATTGACC
GGCCATTCAGCATCCTTTCAGTGTTGTCAACAGTTGGTTACAAGCAGTAGCCGAATCGAC
AATAAAACGCATTACAAAAGATTGTTTTTTTAAATGTGTTTAAAATATTTATTTAAAATA
CCTATAAACTGCCGATTAATATGTTGACTATCAAATGCTTTGTATTCTAAAGACAACAAG
TAATAAATATGAAAATCAGAAAGCAACATAAAAAATGTATGTTTACGTACCCGAAGTTTA
TAGCTAGAAAATAGCCAGATTGGTAACACTTCCCCGTTCACTCTCCCCTCTCATAATAAT
TTTCCCTGGGCTTTTCCCGTTCCTCATGCCACCCATTCATCGATGATTATTGCGTTAATT
ATTATCCTGCATCCTGGTTTTCAGGAGTTCCATGGGGCTATTTCGAAGGCATACTTGTGC
GTAAACTTCAAAAGGAATCTCTGCTATTTTCGTACGAGGTGCCTGCTGCCCGCTTAACCC
CTTGCTGCCCCCGTTTCCGAGGTCTTTGTCCTGCTCACTGCCTTGGGCTGCGTTCGTCCA
GCTGCTGCCCACTTGCCACTCCCACTTTTCCTTGGCCTGTCAGCAGCAACTGACCTAATA
ATCATTTTCAAAGCGAAAAATTGTTGCTGCCGAGTTGGCCTAACTTATTTCATTCACACT
TTGTGTGGGATGGCTAGGGGCGGTAAGGGGAGTTCGGATGAACGGACTGGTGTTAAGCGC
TTGGGGAAAACCATTTCCTTTTTTAGCCTTTCCTTGCTGTGCGCATGGGGCCTATTGCGT
AGACTTTTCCGGAATGGATTTTTGGATCCAGCCTAATTTGGACACTTTGATGAATGTTTT
GGGAATGGGTGGATTAAGCAAGTTTTAATGGGAATTCAACATCTGTAAATGTATGCACAC
AGTCAGAGAATATACATATAATTAATTTGAAATATTTGTATTTGTATATGGCTAAGAAAT
TCACGTTCGCTTTTAAACTAAATTAAATAAATCCCATTCTCACAATCATTTAAATCGAAA
TCAAATTAAAAGCTTATCACTAATAGACCATCCCCGGGCCATTTCTCATGGGTCAATCAG
TTTGTTCCAAAAAAAAAAAAATTAACCAGAAGCGGATGCAATTCAAGGTTCATTAACAGA
CTTCTCTCACCTTTCGAACGCCCAGCGAACAAAATACGTTCATCAATCAAATATACGAAT
CCTAAAGTGTGATTGCTATTCGAGCACGAATAATGATCAAGATATTCAGCTGCAAGTTGG
CAAAGACAAAAAACCGAAGAAATGATCGAAGATCGATATTTTCAGGGGAGAATTGAAAAA
TTAAGGCGATGTGTTCGCAATACTCTGGCCCATCCAAGTGCCAATTAGGCATTTTGTACA
TTCTTCGTGGTCGAAGGCGACAATTACCAAAGACAATGTAGTGACCACAGAACATTTGGC
TTTCCATTCGCATTCGACACTGCATTTGTCGCTTTATTTGTCTGCCTTTCGGGCGACTAA
TCGAAATTAAATGACGTGTGAATGTTGGCAGCTGTTTTCTGTTGGCTCACCTCCTGACTT
TGTGCTGTTATTATTATTGCATAGCTTTCGATTGCTGCCAGTCAGCAGCTCCCAGGTTGG
CCTTTCATTTCCCCTGTCGCCCAATTGCCATCGGCTTCATTTCAATTGGTATCGTAACTA
CCCAGTAGCTGTGGGGATATGCGGCTTTCAGTGGCTTACAAGAAAGATACTTTGTATAAA
ACACTCATGAGAGAAATATGTGAAAGCATTCAATATAATCTTACCAAGAATCATCTTTAT
ACATTCTCATTGTTTTCAAAATAATATAAAATAAAATTAAATATTATAATCTTACCAAGA
ATCATTATTTTACTTTCTAATTGTTTTCGAAAATTTCGGAATTCAATAGCATTTAGTGAT
GTATACTACATATCTTTGGAATGTAAAGATAATTACTGCATTTGCAGGGACACATATAAG
TCGACCCTTAACCAAAAGCTAAACAATCTGCTCCCGTTCTGTTCAGTTGATTGTCGTCTG
TCGCTTTTTTGTGGTTTTTATCAATTTAGTTGATATGTTATTGGGCTATTTGAGGAGACC
AAAGCCAGACCAGAAGGACCCATAAATTATGACGAATGTCAGTGGATGATTGCAATTGCG
TTTGCGATTACGATGAGGTTGTCGATTACCAACTGGCGTTAAAATGTTGTGGCCGCTTTC
ATAAATTTTATATATGTAGACTTTCACGCCTGATATTTGTGCTACTTCACTCCCATGTTC
GGACATTTAATTAATGTTTAAATAAACCCAAAGAGTTGGCTTCTTCGCATTTCGCCCCGA
GTGATTTTTGGATCATAAAAGTGAGCTGTGAGAAAATTGGAAAACATCGGATGATCTGCG
GAGTGGTTGTGCCACTTCTGTTTGATTAAAGTTTGTTTAATTTATGATGTCTGACCAGAG
ATGAACTTGTTCGTAAATTGTACAATTTTATGCCTGATTTGTCATGGCCGAGTGGGATTT
GTTTTGGTCTAAATGGGGCTGATTTATTTTCTACCATCAATTTGGGATCGATTCGGATTC
GACTGGCTTGAGGATGAGCTGCTCAATCTGACTGGCAACTGTCATCAAATTGCACTCAGC
TTGTCATTACTTACAGCTTTGTGGCTAATAGTTGCCTTCATTCGGCAGATGATTTTTTCA
CCATCTCCGCAGAGTTGGCTAATTTACATATAAATTAAAACTAGAAAAAGTAAGAGCAGT
ACTCACACACATCACACGGAGGTCGGTCTTTAGCTGGCAGTTTGTTAACCTCAGCTCGTC
TCGTTCTTGTGCTTTTTGGTAATAGTTGTCTGGGCTTCTCAGGCTTTTCAAGTCGCCCGC
CCCGAAATTCCGCACAAAATTTCATAAATGCCTGGCAATAAGCGACCCAAAGCGGCAGGA
TGAATCCCAGCTAGTAGGATATGATGTAAAAAAGTCGAGCCACATATGCGACACTTTGCT
GCACATGTCCTGCGACAGGACAAAAGGCATCCCGGGTACACAAAAAACCGCAAAATGCTT
AAATGTCTTTGATGGCTGGCTCTCGAACATCCACCAACAAAACTCCTCCACCCACAACTT
GGTTACCAATTTTAGTTTTGGGTTTGGCATTTTGTGCGCTCCAAGGAATTTCAACGGTTC
GAATCCGAAGTATTTTCCCTGTTCAAATTTTAATCTGTACATTTTACAACTGGCATACCA
TGCCTCAACCTCTTTGATCTGCCAGCCGATTGATATATCAGATCATTAATAATAGTTGGC
TTCGAACTTTTTCCAATCTCCTCTTCGGTTTTTTTATTCGGCGCCTACTTTCTTGGCATA
TTATTTGTTCAATTTCACGGTGTACATACTTAGTTATAGTTGTTATGTTCTCTCGTTTCG
ATTCGCTTTGGCCACTCAGCTGAAAACATTTGAATTATCATTTTGTGGCACTGCCTAATG
ATGATTGTTTCGCATTTAATTGGTTTTTCATTCGGTTGGTGGTGCATGACTGGCAAGAAA
AAAGTTTCAGAACTTGTAAGGGAATTGTAATGGATTTGAGTGATCGAAAAAAAAACATTG
GACTGCTAGTAGGCAAACTTTTAACTTTTTTAAACACATTTTTAAAGGGGTTTGAATACT
GGAATCGAGTATTATTTTCTCTATAAAACCAAAGCTTACCCCCTTTTCGTATGGCAATCC
CATTCACTACTCCATCTTATACACTTTTCCATTGCCATTGCCACATATCATTATTTCATC
TTTGAGCAAATCGAGTCCTAAGCCACTCTAATGGATTTCATGCCCCGCCGAAGAACATGG
ATTGCATATTTCGAGCGACCCAATGACCAAACCCACAACCCTCGAATACCATCTAATTGC
CATAATCCATTTATAAGGTAGCACAATGTCGCACAATGCACAGCGACCCATGGAAGACGG
TGAGGAAAAGCGAAGGAAAAAAGGAAAAACAAACAAAATAAGCCAGACAACAGCCAAAGT
AAAAAAGTCAGTTGTTGCAATATGACAGGACTAGTAAATAAATAAGGCGGACGGCCCCCA
GAAGTCGGAACCCCAACCGCTTGATAGAGCCCCCCGTTGCCTGCAGTAAAATGATACAAA
GAAATGCGAGACGACGACTTTTCAGTACAATTTCCCCGGCGTTCGAGGAAAATCCTTTTT
ATTAGTGCGATAAAGGCCAGTGAAATATGTAAAAATTCTGGGAAAACGAACCAGGGAAAT
TACACAAGCTGCAAACAACATTTGCATTGCCTACTTGGCGGCGTCTTTTATTTATGTATC
TTCTTGTCCGTTTTTCCGTACGGGGAAAATCTGCGCTTATTATAATTTCCTTTTGAGCAT
TAGGCTGCCAACCCCAACCGTCGCCGTCTGCTACCCACTGTGCACAGTGGGCCTAATGGA
TGTTTGCTGTCGCTGCTCGATGCTCGTTTTTTACGATTTGTAAGTGCAATCAGTTGTACA
AATACAAATCTCCCATTGGGTTTTTATTTTTTTGTGTGCATGTTTTTCTCCCAGAGCTCA
AAGTCAACTAAGTCGTTTAATTTTGTTTAACAAGATTTCGCGGTATTTCCCCGCACGTGT
TGCTTTAATAATCCGGCATCAACCACCGAGGCAAATTACCCCAAAAATCTCGAGTATTTT
CTACGCATATTTTTCCGCATTTTTACTCCCATTTGATTTGGTTTTTCTTGTCCTGCAGAG
TCTCGGTTTCATTTTGGGCTTATGACTTTGATTTGTGTGTTTATCTTTTGAATTTTTATT
AGCAAATAAGTTTCCTTTTCCCGTCCGAGTGGGGCGAAAAAATTCAAATGAGCGGAAATG
ATGGAGAATAAATATCCGCTTACAATTAGAAAAAGAAATGCGCTAAAGCCCGAACATCTG
TTGTGGAAATTGCAATTTAATCGCAGGAATTTTCGATTTTCAGTGGATAGCCAGCGTACA
GCTGTCTGTTTGAAGCGTTTGGTAAATACAGACAAAAGTTATAGACTGATAAAGTAATGT
TTGCAGTGTTGTAGCTAGATTTGTCAACTCGTCGTTTTGTTTGCCTTTGGCTAAATATCG
AAACATGTGTGCAATCCACAGCTTATCACGTGGCTCCGCTATCTGCCACCCACTTTCCCA
CCCACGCCCACCAACAGTCGGCAATAAAATAGTGCGATATATGTATGTCTGCGTCTGGGT
GAGAAATCTCTTGGGGATTGGTATCCAATAGTTCTCTGGCTGCAGTGACTTTGCTTCCGC
AACAATGTCGTTGGGGAACCTTTGAAGTTCGCCGCTCTGAGCGGGACTTTCAATTAGCTT
TACACCTTTCCCGACTTCCAAGTTAAGTCGCAAAGAGACCGCACACAAAGTCACTTGAGG
GATGAGTTCCACATAAACAGAAATACGAGATAATCGCCAGGGATGAGAACTCGAGACACA
TAATTCGATCGTGACAGGTGATTTCGCTTTAAACACTTCCATTAATCACTAACCATTAGG
TCATATAAACTTCAAAAGATATTACCTTATAACCAAAATAGGTATGTATTTGAAACACTT
AGATAAAACAAATTAAGGAAAAATTAATATCCAATTGTTAGCGAATATCAATTTCAAACA
ACTTATCTTTATGAAGAGTGTACATTATATGTTATTAAAGCCCTTTTTTAATTATTCTTA
AGTTAATCGCGTTTACTGTCATCGACTCACGGTGCCACCTTCACGATATTTTGTTTCTAC
TGTGTTCATTTATTGATCGTTAAAAATGATTTAGACCTGACAATGAGACATTGTTAAGGG
CGACGAGGAGCTCGTAAAATTCTGCGGTTTTTTCGGTTTTTGTTCGGCACATCCATGGCC
AACACACTTTGCTGTTGAAAAATGAAATAAACCGGCCCCGAAAAGTACTCAAATTAAATA
ATTTTTCTTATTGTTTGCCATAGAGCTACTGTTTTCTCTCTTTTTGCGGTTTCCTGAGGT
CGGCCGGCAACTTGTTGCTGGCAACATTTGCGGCTAGGCCTTGCCTTTTCAAGTTCCCAA
CATGGAAGAGACAACAAATTAATGTTGTCGAAACACGAGAAAGACTTGTAAACTGTCGGC
CGCTGAGGCAGAGACCCTTTTTGATTTTTTGCAGGGTCCACAGACCGTAGAAGAATCGCT
GGGAAAGAAGCTTCAGCAGAAGGAAGCTCAGCACGCACGGGAACAACAAAAGCAAAAACA
ACATAAGCGACAACAACAACGACTACTTCTTGGCGGCTTTTGACTTTGGCCTTTTGCATG
TGGACCCGGTTCGGTTGTTGTTGTTGTTGTTGTTGCTGCATTTGTTGCACGCTTAAATGT
CTTCTAAGTGGCGTAAATCTTAAATTGTTGCCCCAGGCTTTTTGGCTCTTTCGCTTTTTA
TGGTTTCAGGACTCTGATTTGCCTTGGCAATCGTCGCAGATTTGGGGGATTAGTTTTAGC
CGGTGATTTGGCCGAGTTTTTTGCCATTTCTTACTGATATTTTTTCGACGGTTCCGATTT
TATTAGGTATGCAAATTTTTGTGAGTCTTTCGGTTCTACTTTAAACGAAAACACATTTAA
TTATGTTTTTGCACAGACGCTTGCATTTGGATTTGTCTGGCAATAAATGTTTTTGTACCT
ATTGAAATATACTAAAAAAAAACTCACACATGTTATTTTAAATTATATATAGATATTTCT
CATTTATATAAAAATTATTCATACCAGACGCCCCTCGGCGTCTTGAGAAGGGGTATGAAA
ACTGAAAACTCTGAAAAGTTTCGTATAGTTCGATAAACATTCCTTAATACGTCTATAATT
TATGTGGCACACTAAAAATTCATATTAAAAGTACGCGATAATAAAAAAGTTTCCGTTTAA
ATAAAAATATCACCAGTATTCTACTTCTATGGTATTGAACAAACTTTTATCTACCTTAGC
TTACCGCTTTACAATACTGTAGAAAGGTTTTGCGAACTTTCCCCCAGTTTATATACGAGA
AAATGATTGATTGTTGTCAATAGGAAGCTTCCAAAGAAATTAACTGTTCGAGTGTTGCAT
AACTCTCCCACCCTCGAATCGATCCACCACGCAGCTGTCAAATTCGTAGCATCATATAAA
TGACATCGAAACAGTCGAAAACAAAAAATAAGTAGGCATTTTTGTCACGCAGCCAAATCG
ATGACGTCGCAACAGAAGGCTATGTAATCAGTTCCGCTTAGCCAAGTCACAAGTCACAAA
AGTCGCTGGATAAGTCGCAACTACACGGCCTATCTAGAGCGCTGATGACTGTTTTGATGA
TGATGACAGCCGAGTGTGATTGACAGGGATTTATGATTGTTGCCTAAGCAGTTGAAATTT
TTGTAAAGTCCTACTCGCAGGAATTCTTCAGCGAAAGCAGTGAAAAAGGGTGTTGGTGGA
GTAGCAAAACCAAGTGAATGACCCGTTTGCATTTTGTGTCTACTTGTGAATGGCTAAGCA
AACACAAGCAAACATTCGCTCATTCATTCAAATGCTGTGAAAATTGCATATTATGTGGGC
AAACAGTAGACACTCAATATCTGATATTGATACTTCTATGGAAGCAAATAAATTCATTAA
TTTATCAAAAAAATATTGTTATTAGTGTTACCAGTGCCTGGATAAATGATTTAAAGTGTG
ACCAAACGTATAATTGTGTGATCGTGTATGGAAAATATTTCGTTTCATTGAAAAATTGAC
AAAAATGAATGCTAGGAGTTTATGTCATGGTTAGCCAAACTTAAAAAGTGTTTTGCATTA
CCACTGTGCTTGCAGTCTGCTCTGCTTTTTGGTTCACTCACCTCGGCTTGTGCAAACACT
TTTTGCGGGCAAATTTTTCAATGCGCATTGCATTTCATCTCTAAACGAGATATGGGCACC
AGGACGAGGACGCGAGTCCTTTTCAAGATGCTAGGGAGGAGCGAGCGAGACGGGGCGAAG
TGTCTGCTGTGAGTATGAATATTCATGCCTTGTTTATGCATATTTGCGTGTCAAGTGATG
CCACGTCCTTTCCTTCCAATTCCTCTTCCTTCGTCCTGTGCGATTCGCATTTCTCTGCTC
ATTGCTCTTATTCAGCGGCTCCTGCTGCTTCCTCTTCGTCATTTTGCACGTGCAACACGA
CGTATGCGCAATATTTCCGCTTCTGCTTTTCGGTTTGCTTTTCAAGTTTGTTTACCATTG
CACACGAGTTGGGTTCAAAAAGTACAAAAAAAAAACAGGACTAGGGGAAAGCGATGCCAT
GGCTGTGTGAAAAATTTTCTGTTTATGCTCACATTTCATTTGAACGTGAGTTTGTTTGTT
TGCCAATTTGAAGTGCTAAAAAGTCGGTGGCTGAAGAGGAGCAAGGGGTTGACTGGACGG
GGAGGACTTTGATTGCAATTTGTGCCGAGTGTGCAAAAAGGAAATGACTGCAAAGGAGGT
TGAGCTTCTGTACTTTCGGCCTGCTAAAGGGCAATAGCAGGCGGATTAGATAAAAAGGAA
AAGAACCAATACAGATACCTTATTTTAATGGGAAATAATAAATAATGCCATTTGAAAGGG
GACATGTAAGCATTATCAAATAGTTGGTTTAATCTTCCTGAAAACGCTGCAGCCAAAACG
AATGCACTTTTTCCAATTTTTTACTATCTCTTTCACTTGATTTCTGCTAACCCATTTAGT
AGCCCGAAGAAATATTCCCCAACTACCCACTCAAAAAAAATATATTCACATCAGTCTGAT
TTCCACGCCGTGTCCATGACAATTGCCCAGTCAAAATGGGGCGTAACTAGCCATATTGTA
CCGCGGCTTCAACTGGGAATTGGCCGTGGCCCAGACGGGTATGTTGCTGATGAAAATGAT
GATGACGATGATGGATACTCGATACTCCTTGATACTCAGCCCGAACACGAGCAGAACAAA
AGCCATATAGCGATGCCCTTGAGTGATCTATGCAAAGCAAAAGGCGGTGCTCTGGACCCA
AGATCGGTGGATTGATGGTGATCGTGGTTATGCAGTTGGTTACAGCCAAATGAAAGGTAG
CCGTTGCCAGTAGCTCGCTGGTAGCCGACTAGTCATCAAAACTGGGAAATTAGCATAGAC
AGTTTCCAAGCCAGCCATGGCCAAAGTGCGTAGAAAATCATAAAAATGGCTACTGGAGTG
GCCAACAAGCGAGAGCCAAAACCACGATGCAGCTGGATATCCACACAGGAAAAATTATCG
ACTTCATATAAAGCATTACTACACAACATTTTGTTGTGATGCTTTAAATGATTCACTGTT
TCAAAAATATATATATTCAATAAGCTAATAATTAATTTTCTTAACTTTCAATGGAAAGTT
AACTTAATTATGTCAAACGTATAATTAATTTAATAAGATCTAACAAATACGCAGTAAAAA
GACTACGTCATAAAAATATTCATAACTATTAGTATATACATATATACCTTTCAAATTAAG
TGGTGTCAATTTTGTTGAAACCTACATTTTTCTCTGTGCAGATGACTCGGCCTCAAAGCC
AGCGGCATTAATTTCATACAATTAATGGAAATTATATGAAATTATGAGTGGAACATTGAA
ATTCCTTGTGAACATCACCCGGGACAACAACAATCCAGATGAAATTCACTGTCCGCCTTC
AAACGGAAAACTTCTAGCACTAACTTGGGTGGCAATTTCCATTTAGACACAGGCCGAGCC
AAATGAAAGAAAATTAAATTTTTCACTGTCTTCTTAATTGAAACATTAGCCAAACATTTT
AGCTACTCCCACTCCCCAAAAAAACGGCTCCACTCCTCTGTTCATTTACATTCAAATTAA
CTCGTAATGAAAACGAGTCGAGAAACTTTGACTTTGTCTGGTTGTTCTTCCGTGGGGGTT
GTGGCATTTAATTAGTTGTTCTGATTGTTGCTGCTTCGTCGTCCTGTCGTCCTGTTTCCC
CTGTTTATTACTATTTGCTGGCCATTTCTTCTCGGCTTAGTCAGTTAAATTATCCACGCC
CAAGGATCTCTGTTTGTTTTGACACTCGTTTGATGTTCATTTGCTGCAGTTTAATGACAG
TTGGCAGTTGCCTATTCGATTGAATGGACAATCAAAATTACGGGGTGGAAAGCGCTGACC
TTTCGGAAAGCTGTGAAATGGAAAACAGTGTCGTCATTGCTGTCACTTTTAATAGTTTTT
ATTTTCAAGGGTGATATCACGTGATAGCCTGATATCTTAAAGTAAGTCCCACAAAATACA
GGCTCTTTTAAGCACTTATATCCTTTTCATTTCGCATTGCAAATAAACCGGTAAAATAAG
CTTATTATATAATTCTATTGAAAGATTCGACAAATAACACAAGTAAATTAATTTTTCATT
TACCTCGGTAAACAATATTAAATTTTGACGAAACTTCAGGGTTGTCATTGATACAGTTCT
GCGTTGCACTTGCCACAACCCGTTCCCACCCACTCCAAAAAAAAAGGGACCACACCTTAC
AGGTCCATGCCTTCCGATTTTCCATCGTCAATTTCTCCGGGCGTTATGTTGCCGTGGCAA
AAAGAAAACAAGAAAACAGCAACACGTGCCCCTTTTAATTAAAATAAATAAATAGGCGCA
AACGCATAAATAAACAGAACATTGAGCCATAGGATAACTACAATGCCAAATAGAGATGAT
GGTTCTCGGTTACTCTGTCAAAAGTATTATTTTGGGCCTGGTACGAGTATTCAATTTCAT
GCATTTACTTCGAAGAGCGGGTTGTGCCCCGGGACAAAAGAGTTTGGGAAGGGGCGAGTT
CTACCTCCCCATTTATATAAGAACTCACGATATGGGGGCGCCTTGAGCTATGTTATGGCT
TTTTTCTGCTCTGTATTCTTTGTGAAACGTGCGCATTTGAATTTGAGGCGAATTATTATT
TAGTCGCGGCGAGACGCAAAACGTTTCTCGGAATAAAACATTTCCAACAACTTAATTTTT
GTATACCGCAATTTGCATGTGGAATAAATCAAATGTAAAACGCATAAAAGAGTCAGGAAC
ACCCCCAAAAATAGCACAGACATGAGTTATGAGCTGTGGGTTAAGGTGGAGGAGTTGGAG
CAGGAACAGTAGCCTTTGTCTGGCCAGGATTATGACCATTTATTTGCCTGTCTGTCCTGC
AAAATGGTAAATACTCTTGTGGTGGGTCGAAAGTTTTGGCCTAAGGCGATTTTCCTCGGT
ACAAGAAATCAAAATCAATGAAGACTTCGCCGCACAATGGAGCGGTATTAACAAAAAGAG
TGTCCTGCACCCGTTTGGTTTCCACTTTCTGAGACTTTATGGGTCCGAGTCCTTGGCTTC
CTGAACTCGGCTGGTGCCGTGGCCTTTCATGGATTATGCATCGCTTAGCTGGCGTAAAAC
TTTTCAACCAGCCCAAATTATTTATTACTAATTGAAGGAGCGGCACTCGCAAGTCGAAGA
ATGACTTTTCCTTCGATTTTAATTCGATTACTTTTCGGAAAACATTTTGCACAGAGTTCA
ATTTGTCAGAGTTAATTAAACCGAGTTAAGAACTTTATTGAGCATTTCCTGCTCGCAACA
AATGAAAACCAATCAAATTTAATGCGAACTTACCAAGATGGCAAGGTGAGGTAAATGGAG
AACAGAAAATATATCTGGTCCGGCCATTGGGCAAGACATAATAATAACTTATGTTTATGG
CAGCGCCAGAAGATCTGCAAACGATATGTGTATGATCCATGCTCACCGACATTCATTCAA
TACTCTATTTAAGGAAGAGATCATAGGTATTCAAAATAGTAGAAATAAAATAGTACACAT
ATTTGGTGCTAATATATAATATAACTGGGAAACTACAATATATAGATTATCCAGTTAAAA
ACATTTGAATTCCCTAAATGGTCTCGGACTTGCTTTCATTTAGTTTCAAACACATATTTC
TTACACCCAGTTAGGGGTTATCAACCTTGCCTTTTTTATTTCACTATATATCCTGCCTTT
GCTTACATATCATTTTAATTTATTCATACACTTCAGGGTATTCATTCTTCATTTTGCTGG
CCGTCCTTACTGCTTAATACTTTTCATATAAATGCACAAGTTTTTGATTGATTCAATCAA
AACGAAGCAAAACGCAAACGGCGATCAAGAAGTGGTCTTGAGCTAAAGCCAACGCAAAGT
TGGAGGCATCAGGTTTTCTGCATGCCTGTCACGTAATTTATTGATTTAGCTCTTGGGAAT
ACGAGAGACGGTTCGTGGATCGTGAAAAATGAAATGTTTGCCACTGCCAGCAGCAGAAGC
AGCAGCTTCAAAATAACACTGATATTAAATGCATGACTGCAATCTAGTGTAAAGTGCATA
TTTTACTCAGTATGAAAGGATCTGCAGAAACGATATTAAGTAAAAATATTTTTTAAAGAT
ATTTTTATACAAATTCGTTTCTTCAATAGTGGATTTATATGTAATAAACAATCACCTTTT
GATATTCAATAAACAAAATATTTAAAATAATATAGAGTCACAAATTGAGTTAAAGTTCAC
TATAATTTTGTGATACATTTTTTATATTATTAATGTAAATGATTAATGAGAGCGTAATTT
TTCTGGGTGCACATGGGCAGACTGCGCAAACTGGCATGATGGCTGACCGAACTGGACTGG
GGCTGATTGGTTGTCGATCGATTTGGCTGCCGGCCAGACAAATTCAAATGCATTGGCCCC
GATCTGTGAATGCAACTGCTGCAGGAGGAGGTCCGAACTCAAGGTTGGGGGGGTCAGGTG
CGGGGATCAAAGGCACTTACGCATGTACGCCTCAAACGATACACAAAACTTGATCATCGG
CGGCCACAGCGATCATCGATCAACAGACAGACAGACATCCCATGCCATCCCATTTCAACT
CATACCATACCATACCATACCATACCGTCCTGGGTCTCTGAGATAATGGCCGGCTTGCCA
TTTTGCATTTTTGCATTTGTAATGAAACTGAAAACCAGAATGAATCGTAATTTGTTCGAA
ATCGAGCAGAAGCAGCCAGTCGAAGTCCCAGTTTCGCGCACAAGAAATAAGATCAACAGC
GGCTCCGCACTGAAATTGCACTGCAGGATGTTCAAAGTGGTTTGGGATAAGATTGTGGCT
GAGGATGAGGATGACGATGAGGTGGGAAGAGCTCGATATGAATAATCTGGCATGAAAGGT
ACAGTGTGTTGACGATTGCATAAAGCAAACATACAAACTTAGAAAATGGCCTTTGCATTT
CTATGTATCTTTTAATAAAGAATGCCAAATGAAATTTTGATAGATTTGAATTTATATTTG
TATAAATAATTAATTTTGGTTGCTATTCCCATTTATTACATCAAATGATACCTTTAACAT
TTTTCTACTATTCCAAGCCCACTGTGCAGTATTAAACGTTTCTCAGATCGCTCCCATTCG
CTTCTTCATCTGTGGCCTGCAATTCGTATGTAAAATCGCGCATATTCAACTGTTATCAGA
CCCACTCTTTTGGATTCACACCGCTGCCTTTACGTACAGATCATCTCGCACTCCCCAAAA
ACCCCGTAGTCTTCGCCAACTTAAAAAAAAAAAAACTCCACCGAAGGCAACGCAAATGGC
AATTTAAGTCATTTTGTTTGCCGTTTTTTGCGTTCGATTTTTTTGATTTTTGTTGCAAAG
GCGAATTCAAAATGGTTTAATATTATGCACAAATCGGGCGAGTTGCGTAGTAAATTATGG
GCCATTAAGCGAACAGGTAGAGCGAGAAGCGGCAAAGATACGGCAGGGGGTTTACCTGAC
CGGCCCCGGGTAATCAAATTTGTGTAAAATGGCAGCCGGCCTTTGGGTGTAAAATGGGGG
GCGGCGTCTTCGGCTAGAAGGAAAAACGCAGCAGCGGCAGCAGCACTTCCAGGGAAATGC
GTGCTACCTGCAGGAAATCCAGACTCAAAGAGAAAGATGCACCTAGTAGTAAAGTATCTA
TAGATGTTGCCTCCGGAGCAGATGTTGGATCGTAAAAACTAATTTTAAAATCCTCTGCTC
CTGCCTTACAGCGATCAGTCTGCTCGGAGTCCTAGCCTCAGGATGTGGTGGCTACTTCTT
TTGCTGTCCCTAATTGCGCCGTCGTGGCAGGAGAATGCCACAGTGATCAATCCAAGTTAT
GTGACCAAAGCTGGTTGTGAGGCATTGGTCAAGGAACCAAATCTCTGCGAGTGCCAGGAG
CAGGAGATCAAGTGCGAGAACCTTCAATTGCACAGTGATAATTTGCAGTTATACGGCATT
AGCTGTAGTATATTCGATGCCAGGGGATTCGGCTATATACCACCGCTTAAGGTGGGCAAT
ATCGGTTCCCTGATCGTTCAAAACTGTGCCATACCAAATGCAGAAAGCATCAAATACTTG
CTCAGTAAGCTGGGTGTTAGCAACTACACCGAACTGGAGATCTTCAACTATTTCGATCCC
AAGAAAACGGATCGAGGCGAGGTCCTGCAGCAACACTACACGGATCACGAGAGTCTGAAG
AAAGTATCCATCATTGGATTCAAGTCAACACTGCCTGAAAATTTTCTTGAAAACCTGCCG
GCACTACAACAACTCTCCTTAAAGGGAAGCAGTGATTTGCCCGGTAACATTTTGCATCCT
TTGAAAAATCTAACCCATTTGGAAATTGTGGTCAAGAATTTGGGCAAGGTGTCGGGTGCA
ATATTTGCAAAGCAATCGAAGCTAAAACATCTGATGATCGACTGCGATGCCAAGAACAGT
AGTGTCGAAATGTCCGCTTTTGGACCCCAAGAACTCTGGCACATGACCGAACTTCAGTCG
ATCGAGCTCTTCAATTGCGGTGATAATGTGCCAACCGAGTTGTTCTGGATGTCGGAGCAA
TTGGCATACATTGGAATAAGGAGCAACATCAGCTATTTGAGCAAGGACTTCCTTAAGGTG
CAAAAGAAACTGCTCACCTTAAGATTGGAAAGAAACAATATTGCCAGGCTGCCCGATCAG
CTTTTCAGGAACACTCCCTTGATTTTAGAGATTCACTTGGCGTTCAATAATTTGGATCGC
ATTCAGAGGTGAGTTGCTATTACAAATACAGACATCAAACATATATACCCCAGTATGACT
TTTCGGTAACCATTAAATAAAATTACGTTCTGACTCCCTTTCCAGCGGCCTTTTTGACAA
GTTAAAGAACCTACAGGTGCTGAACTTGGAGCACAATCCGATAACCACCATTGCCCTGAA
TGCCTTTACTCCCATCCCAACTGCCCATATCTACGTGGGCAAACTCTTTAAGGCGGCGAA
AAATGCCGACTGGGCTCGATCCACGAATGCAACAATCTGCGAGGAGGAGTATATCTACGG
GGTGTGCATCTACTGCAAGCGAGATGAGTATCTGGACCACTTTGCCGACTCGGAGAACTG
CAATAAGCCAAATCCGAAGGCCAAGGATGTGCTAGCCAAGAAGGCGTACGAAAATCAGCT
GAAGGCGATGCCAACGCACTCCTGGAAAAAGGCCAAGGAATGTGAGTAAAGCGTAGATAT
AACTTTCATCCCATTCCAGTGATTTTTCGCCAATAATTTATATTAAATTTGACATGCGAC
TTCCCTTCTTCCGAGTCAGACATGGCCAAATTGAAAACGAAATAAAAAGCAGATAGCGCA
TGAAATACAAACAATATTAATATTTGTTGTCCGCTTTCAACGCCGCCAATGATAAGGAAC
GAAAGTTGAAGGTTGGTGCGAAGTCGACAGAACGTTTTTATATATAAATCATGAAGAAAA
ACAATTTATCTTTTGATTTGTAGCCAAGGGGTGGGTTGCTACGAAAATGAAAGAAAACTT
TTCCAGGGAGCAACATGTCAAATGTAATAAGGCCTAATGTTGTCTTCCCTTTACTTTTCG
AGGGCTGGAATGGATTGTAAGTGAAAGTCAGATGAGGAATATCAAGTGAATTATGCGGGT
TGCGAGGGGGAAGCGAAAAACATTTCAGATTGCTATCATTTATGTTAAAAAAAAGAAATC
CAGTAACTGACAGAAGCAACAGGGATATAAGAAACTCACGAGGAATGTTTCAGTGTTATG
CAAATAATATCTGTCATTTCTCGTTGTTGATCTAACATGTTATTTTGTATAGGGGAACGG
GGGTCCCACAGAGCCAACAACTCATAAATGTCAAGGATATCACATGTTGAACTCTGTGGG
TCGCCAGCGATGAGAGTTGATTGAACAGCAATCAAATGTAAATTTTTGTGTAAGTGGAGA
AAGGAGTTCTTGGGGTGGCGTAAAGACCTCTAAGCGTTCTAAATGGGCGCGTAAAATAAT
TCAATTCTTTGTACGCCCTTCCATATAAATGAAAGCACTTAAGTACATGCAGATTAGATA
AATGTTGTACGAAATAATAATGTACCATTTTGTAAGGAACATGTATTCAACTTTTTTACT
TATTTTTTCTTTTGTAAATGTTTTAGTTCGTCGTTTAAGTACTATACACAGCCCTCTATC
ACTTGTCACCCAGTTTAAAAACCTAATGGGTGGCATTTTAGAATCCGCTTCTCCTACTAC
GTTTTTTTTTTTTTAATTTTCCGATGCGCTTTAATGCAGCCCATAACTCATGGCCTCACT
TACTCAGTCAGTCGTCGACTGGCTTCTAATCTCAATTTGCTGTTTGAGTTGCCACTAATA
AAACGCACGACGAACTGACACCACTGGAATCGAACCACTGACCACTTTGGACGCCACCGA
ACGAACGCCACCATCAACATCGGCGATCCACATGCATTTGTGCTGCCGTCGATACACGGA
TTGGCTTTGGGTCTGTTTATGGTTGTCTCCTTGCAGGCTTTCTGTGTTTCCGATAGACAT
AATTTGTCGGGCATGAGGTGACACTGACATACAAAGGGTCCGAAGTCGAGGACGATTGCC
AGTTTTAGAGGTGGAACTTTTCGAGATATTACCTTTTTGAACAGAGAACATAACAGCGGC
CGCATTTATTTATAGATTAACAGATTTATATATTAATTATTGTTATTACATTAAAGTGTG
TTTTGAAGTGCACATTTTTATCCAGAAAAGGTGTAGTAGTTCCCCCAAAAAGGTTCTAAA
ATCCACCACGCAATCGTACTACTTCAATCTTTTGAGTACTCCACTCTAGAGGAGACACAC
GACCCAAAAACATAGCTCACACGCAGTGGCGCCACAAAGGGGATACTTTTCGACTATTAC
TAACATTGAAGATATGAAAAGGAATAGAAGTGTGGATGTGTAGCCCCTGTTTTTAGGATC
CCTAACCCCTAGAATTAACCAAAAGCTCCACCTCTGCCCACAACTGACCAGCGACAACAA
CTGGCCATCCACTTGGGCCCAGATTGCGACTGGCTCTCCACAAATGCAGCTTTTGTACTA
CTCGTATCTGGCGGATACATTTCAAAGCAATGCCAACTGGACTGCGTTTATCGCCTGGTA
GCCCGGCAAAAGCCCAGACTCTGACTCCAAGAGACCAAGGGGCCAGAAAACAAACAGGGA
AAAAAGAGTGAGGGCCCCATGCGAAATTTATGGGCATCAACGTTCAGTTTGAAGCGGGAT
CCCGAAAAACCTGGACTCCAATGCCGCGCAGCCGACTAGCTCCAGTGGCTGGCTTGGCAT
TTGTAATGCCTAAATGCTTTGGCGAATTGATTTTTGGTGTAAACGATGTGCAATTTTAAT
GGATTGTGCTGCCAGATAAGCCAAAAGGAGGAGCAGTGCCTCGGAAGCGGCGAGTGGGGA
ATACTCCACATATAAATACACAGAGTGAGAGACCCCAACTCTGAGACCATCCGATGCCAG
TCGTCGTGGCTTGTCGTGTGTCGTTTAATTGAATTTGTTTTGATTAGTTGCTCGATGTGT
GTGCGGGCATTTTGCAAATGCAGCTTAAAGTGTTCGCCGCTGGAGTTTTAAACTCACCGA
ACAAGGGCATGCCAAAAGGAGAGGGTCCAGGACAAAAAAACCTTTGGGCCTTCAAGGCAT
CCAGCTAAATTGACATTGTTCATAGTCATAACATGACGGAAAAATGTCAATTTAAATATT
TGCAAATATTTTAACAAGGCATGTGCGCCCCAGCAGCGCTAATTTCGCATGTGCGAAATA
AAAATTGTGCACATTTTTTTGCTCAAAAAAATAAGAGAACCCAAAAAAAGGTGCAACAAC
TTTTTAATTAATTAAGGGAATGATAACGAAAGCGCCAGGGGTGCAAAGAAAATATTATGC
AAAAATTGTGAGCCAAGAGAATGCGAAAAATTTCTGGTTTCAAAAAGGTTAAAACGACAA
TAGGGTTAAAAATGTTTTGCAGGTTGCGAGCGATGTTAAACAAGTTTTTAGTCATATTTA
AGTCTTGCTTAAAAACATGACTTTTTAATATGTACCAACAATTAAATATCAGAATATCGA
TGTGGTAAGAAGAGCTTAGCTTAAAATTATTTAAAATTCCCTAAATATTTACCAGAACAA
TAATTAGCTTTGGGAAAAATCACATTCTTCTCCCAGTATTTAAAATTGTGTTTCCTTTGC
CTTGAGTTTTCGTTTTTCATTTTAAAGGGCCCCCCCAAACTAAATAAAATTCCAAGCTCC
ACTCACAAGTCAATTAGACAGTGAGAAACCAAACACAGAATGCCATATAGCCCCCAAGGG
GATAAATTCGCAATCTCCATTTGAATGACAGGCGGCAGTGCAGTTAACTTGTTGATTTTG
CCACAAAAAGGGGGTAAATTTCGTAGAGGAAAGGTTAAGTCTCAACCGGAAATCTGGTCA
GAATTTCAATTGTTTATGCGTAAAAGTCAATTTGTGATGCGAAATTCGAGTCGTAGGCAA
TTGTGTTTCTGGGATCCCTCTGCATGCGCTTCAATTAGAATAAGATTGACAGCTAAGCTC
GGGGAGTGAAACTGGGACCCAAACTGGCGATTGGGGTATCCTTGTATCCTTGTATCCTGC
ACTTGCACTTGCACTTGCACTGACCGATAAGGTTATGCACTTGGCTTGTGGTTTTACCGA
GCCTAATTGAATTTAATTGATTCGGTTTAGGAGTTTTTGGGGGAGTCTGTGTGCACCCGC
TCACATTTGGGGTGGCTTTCAATTGGGAATTATTGTGACGGTATGGGGAATGCATTTTAA
AGTTGGACTCCACTTTGGACGAGTGAATGTTGTAAATGTTGCATGACTTCCAGAGGCCCG
CAGTTGGTAGCAGTGAAAAATTGCAGCTGTCAGCGTTGGCCAGAAAAATGATTTGTTGGT
TTTGTTTGTGGGTTTGAGGAGCTCGTGGGGTTGCATAAATCATAAAACGCTTTACATATT
CCATACATTGCCCATACTTGCCGCACGTATGCAATTAAACTTAATATAAATGTCTGGTAA
TTATTGTGTCTGCGTTGCATGAACTGCAGCGACTTTGGCTTATAATTGACTCAACAAGCT
TACCAAAAACGTATCTAAATTAATAATCTTGCACTTGCAGATCCCGTTGAGGAAGAGCAG
CCCTAAGCTCCAAACGGTTCGTTGGGATTTTACGCATCAGTACTAACTAGTATATGGATA
TCTGAGTAGCTTATTTCTGAGACTATAATGAGATTAAAATAGGCTGAAGCTATTTGTTTC
CCGAATAACTTAAAATTAATACTCCCATATATGTTCACCTGCTAAGTATCTTTTGAAATA
TAACACGATTTGTATCTTTAGTGTAAAAGTTTTGAAATAGTTGCTATCATTAAAGACTAT
AATTTTATGTTTGCTGATTGTAAGACTATAAAATCGAAAAGTTGGAAATATTACTGTATC
AATAAACTTATGAAATAAAGATATTGAAGAATACGAACTTATTTATTTCAGTGCAACTAT
AACCCTAAAACATTTGGGTATGTCTCTTTTTGAAATTATGGCTATTAACCCCGAAGAAAA
GCAAGCGACACACAATAGCATTCCATTTGCCATCGGACGATGACAGGAGTATGGAACTAA
TATTTGCCAAAAATGCCAAAACAAAACGACTGGCATAAAAATCACAATAAAACAAAACAG
TTTAGGAACAACAGGATCCTGCAACCCGAAGGCGACTATTGTACACATGTAGCTTTCCCC
TTGCCCATGGTGGGTTGTAAACGAGCGGGCGGGGGGAAATGGTTAGTCGAGAGTCCTGAA
AGCTTTCTCCAGTATCGCGCCTTTTGTGTGCGATGTGTGTTTACATGGTGATTTTTTGTT
CGCACGCGATATCCTTTTTGCCGTCGCCCAGGATGTTTACCACCCTCCCCCCCCTGGAAT
GCCACCACCAAGTCCACCGGATTCTATTTCCCTCAGTGTTTGCTCCTTTCGGGCTGTCTG
TCATATATGCGAACTATGAAATGGCTGGCAAACATTCAACTATTGTTTGCATTAGTTGGT
CTTTTCAGCTTTTCGGTTTGCCCAAATGCTCCGCATAATTGTTGCCGCTGCTTTGTCCAT
CAAACAATGGGAAAACACCGTGCAACACGGGCAACAATAGCAACATTTGTCGTGAGTTAT
TTATTTGGGTGTATGGCCAAGTTGCCAAAACACTGCTGTTAATTATGTGGATAGTAAAAT
TACAACACGCAGAACATCAACTAAATAAAAATTATCCTTAATATTTAGATTGAATATTAA
ATAATAGTATTCGATAAATATTAAAACAATATTTTCGACTTGTAATAAAAATAAAACAGT
ATATAAAATAAATTCATATTTATGTAACTTAGCATCTTTAAGTACAAAATTTCCTCATAT
AAATGAGATTCCTTCTCATTTCCGCAATTGAAATTAATTTTTTTATGTAATTCTTATTCT
CTGAATTCTGAGTGCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 43511..44527, 44625..44980, 48940..49297
43542..44527, 44625..44980, 48940..48962
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved