Drosophila_melanogaster Locus crol
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster crol
Drosophila_melanogaster
crol
2L
snoRNA:Me18S-A934
11778..11868
16646
TGAAACATTTTTTTTTTTTTATATAGAAAGGACTTCTGGCTATTCTATGTATAAAAACA
TTTTAGAAACATATCTTATTCTAAATAAGAAGATCGATCATAGGATTTCTTTCGAAAATC
GTATAAAATGTATTGTATAATCCACTTATTTTCTTTCCCTCCCACAAAATATGGATTCAA
AAATCTCGAACAAGATTATGTGGAAAAGTATTGATAATCACCTAAACACATTGATTTTCA
ACATTATAAATACTCCACTTGCAAATGCAAAAAAAAAACTCTTTAGAAATAGTCAAGATC
CTACTATTTAAGTTTATACTTTCAGAAAATCTTATAATTCCAATTACACTTTATAACTTA
TTAAATTTACGCTGCTAATTATTTTTATTATTTATAAAATACTTTACGAAAAACTTAATT
TTCAAAGCTATCGACGCAGTGCCATCCCTAATTTGGTATTTTTGTGTATTTGGTATATTT
CAAAATTACATTGAAAATAAAGCAGCCCGGTCACACTGCCAGCTCTGGAGAACTATCGAT
GTCATATCGATACTTCTTCCAGCTCTATACACTGCTTCTCTCGCTCTTCCGCCCGCAACT
AAAACTCTGGATCCGCGTTAAATGTTAAGAAAATAAAGGCACCGCTCTAATTAAATGGCC
AACCGCAAGTGTACAGTGCGCGCAATGCAGTTAGTGACCAGTGGAGAGTGATGTGCAAGA
TCGGGCCACGAAACCAAGATCGCCATTGAGCAATCCGGGAACGGCGTCTGTTGAAAAGGG
ACGCTGCTGCAGGCAGAAAAAGGAGTGGTAGCTCGCTGGTCTATGGATAAAACGTAACTA
TATCGCTGGTGAGTGCAATTCGAATTGGCGACTCTTGCATTCGTATTCAAATTGGCCAAT
TGGACCCGGCCGAATTTGTGTGCTTAACCGTTTTGCCGCCTTTTTGTGCCCAAGCCCCGA
AAAAGCAGCACAACAACGGGAGGGGGTTGGTGGAGGGAGCGGCGGAGACAGCGGCAGCAA
ATCGTTAATAAGAACAACGCAATCGCACGCACACACACACATGCGGGCTCGAGCACGCAT
TGTATCTGTATCTTGCGGTGTCTCTCGTAGTCGCTCTCGCTCTCTCGCTGCCTCCACACC
TCTTGCCAGTGCTGGCCACTTGGATTCTCTCTAGCCAGTTTTTGTAATTGGAGTAAGTGC
AGGTGCTGCTTGGCTAGTTATCTACTCTGAATGCTAAAAGTAGTTTAAGTTTTCATCTAA
TATAAAAATTTGTTGAAAGGGATACTTTAATCAGTAATTTATAAATGCTTTTTTGACTTT
TTCCATTTGAATATAAGGTTATAAAGATTAAATTGAATTATTTTAATAAGTGTTTTAAAT
TTTCATGTATTCCGATCAGATAAACCGCCTTGTTATTAAAGTTATTTTTCTCACTGGCTT
ATGTAAATGTTAACTTTTTTTAGCATTGGATTGGGATTATTGGGCTTTTTACAGCTCTAA
GCTAATCAACTCATTACCTGATATTTGTTATGCCTTTGCCATATTATTAAAAAAAACTTA
TATTTGATATTTGACTGTCAAATTTTCAATAAGATAATCAGATAGCCTTGTTATTATGCC
ACACTTAGGAAGTTCAATAAATAACTTTTAAATATAAGAGTCGAATCAATTGATCCCTCG
TCAAAGCCAAACCGCCTGCACTGGCTCTCCCACTGGACTTTTGTGCTTTCGGCTGCCGCC
CGAACGCGCCGCACGAAGAACTTTTACATCGGTCGCCTTTGCCTGCTCGCCTTCTGCTGC
CTCCGCGTCTCATTCAGTTTTCAGTTTGCTTTGCTCTGTTCGCCGTTCACCACCGCCTCT
CACCCGCGCGGCGTTTCGATTCTGATTGCCACTACTGTTGCACACACACACACACATTCG
CCGGAGAGTGTGCCCGCCACCACCACCGTTGCAATATCAAGTAAATTTTCATATACTGGC
GTCATAAGAACGAACCGAACAACCTTTTTAAAGCTTGTAAAAAATGCAGTGTTTTGTACG
AGGGGAGAAGCTGCTAGAGGGGGTGGGTCGGATATGATGGGATGGGGAGAGGGACAAGTA
CCGGGGCTGATTGGAAACAATTGAGTTTATTTGTGAAATTCGCAGGCCAAAAAGAATGCG
AGAATTATTAATCAAATGACTTTGCGGTCGACTTCGCTGTCAGTGTATTGGTGTGTGAGT
GTTTTTGTGTGCGAGTGCGAGAGTATCTGTGTGTGCTTGTGTATGAGCTGCGCGCACATC
CACAGCTACAGAGTTTCCATTAACGTCATCATCGTGTCATTCTTGCAAGTTTTAGAGCGA
GAGAGGGCAGACGCAGGGTTGCATTTTTCTAAAATTTATTAACTATAGCACTTTAAGCGA
TCGGTGGCGCTTTCCGTATTGGCACTTTTTTCGCCGCCATATGTTAGAACCCAGCTCCCG
ATTCCAATTCCTTTAGCTTTTCCAATTGTGCTCAGATGTGTGCCTGTGTTTTGTTTAACA
ATTATGAAATGCACACTAATTGGCTGTAATGAAAATGTGACGGACGTTTCTCCAACTTGA
TCCTCCTTCTCCTCTCTCTCACTCTTTTTCCCATTCGATTCGCCGCTCTCTCGGTCGAAA
TTTGAGCGACAGCCAAACAAACTTAAAAATAAAAAGCGGCAGCAGCGGCAATAATTATAA
CTATAACTCGAGTTTCGGATCTCGGCATATAGAATGTGAGCCAAAAGGCAAAACTTGTAT
CGACGCGCCGCCTGTACTCGCTTGTCTCTCTCTCTCTCTCTCTCTCTCTGTCTCTCTTTC
ACGCTCGCTCGTTAGCTACTCTCTCAGCTTTCATTTTTTTCTGTCTCGCCTCCTCGCTTT
ATTTTGTACTTACGCTTTGCGATTCAATTCGTTTTTATTGGTTTTCCGCTTTAGGCGGCT
GGGAATTGTACGTAGCGTCGTTCGTGCAAAACGTTGTTGCTGCTGGGCCAGGGGATAGGG
GGTGACGTTGCCGTTGTCGTTCAATGAATAATGAGAGACAATGTAAGGCAAAGAGAGGGA
GAGAGGCAGGAGCGAGAGAGAGGCGAGACGAGAATAACAAAATAAAAAAAGCAAAACCGT
GTACAAAAGTGCACGAAAAGCAGTGGGTAAGAAGGGAACAAAGAGGAGGCGGCATGGCAA
GAAAGACACAACTTTTTTTCCCTGCTGGCAGCCAAAAGCAAACCAGAATGGTGAGAGGGA
GAGAACGAGGAGAGGCCCCCCGTCTAGAATCTAGAAGAAAAGCAGAGAAGACTGACTGGT
CGAGGAGATGCACGCACATACAGCTCTTCTAGATATAGATACAATTAATTTGATTTGTTA
GCACCGAAACCGCACCGCACAGCACTGCTCGTTTCGAATTGGAATAGTTGGAAATGTAAA
ATTTGCAATGCCCCCCCGAAGGCAATTCCAATTCCCATTCCCTTTCCAATTAGAGTTAGA
ATATTTTTGCTCTTCTTTCCACGCAGACGCAGCCTTAGTTTCGTTGTGTTGGTGACTTTT
GCATACATATGGATGTACATATACATATATTGACTGCAAATAAATTTTCGCTTGATTTGC
TTTTGCCCCCCTGTCCGTTCTTCCCACACACGTATGCAAGTATGCATGTGTTTGTGTGTG
TGTGTGGAAGTGGAACCAAAACTGAAAGCAAAGGGAAAAGGGGAAGACTGTACCGCGGGC
CGTTTGAATATTTCGCGTAAACATAAACACCGCAAACAAACTGTTGCTCACTGGTTATTA
TTGTTGCCATGTCTCCCCTCTCGTTTCTGCTTGCAGGTGGCCCTGCCCAAAGGAACATCC
GCATCCGTCTAAATATACTTTCAAGTCCGCTCCTGGCGAGCCTCCCCAGTAAAATCGGCG
GAATCGGGCCAAGAGAATCACATGAGGTAAGTGATTTCAATTGCTGCAGCTTTCACATCA
AATTACAGGGTGACTTTGCCACTCACCACCCAAAGGGGTTATTCAACCCCATTCGATACG
GATCATTCTTGTTTCTGGACCATATGGCATAGTGTTTTCGTCTAAAACAGCGCTTTCGAA
ATTTATAATCCCTTTCGTAACGAGTAACCTAATTCGCTGGATAGCAACTGATTAAATGCA
AATCTCAAAGTTTCAAAATAAACTTTAATGGTTGTTTTCCAACTTCCTACTTTACCAGTT
TTTGGATATTACCTCATCAAGATACATATGACTTTAATAACATTGCTTTATAGCATATTA
CTTTGGCACATTAGATTTTTAAATCTATGTCATCGGTCTATTTGTAGATCATCCCAATGA
TTTCAGTATAATCATAAGATTCTTGATGTATACTTCAATTCTTGTAAAGGTTAGGGGATT
CGTGTTACGATGCAGATTACTTGAGCTTTAAATGTAAATAACTTGAAATATTCTTCATTG
AACCATGACTCAAAGGGATACACCTTGCTGAATCAAGAGTGAATTGCGATAATGGACCAA
CTCTAAAAAGTTATCTTAAAGATATGCTTAGATATATGGAATTGGGGATACCCGGTAGTT
GGCACAAAATTCTTTTGATCCGTTGATGAAGTGCTAAGGTTTTTGACCTGCGCTTGCGGT
TTGCACTCGATTAATTCGTTCTGTGGCGGTGCTTGAGTTACAGTTACTTAATAGTGGGCG
GGGGTCCAGCCCCTTTGTAGATTGGGCCATTTGTCTTGCGTTCTGTGCTTGGCTTCATCA
GTACTTTTCATGCCCGAAACGAAACCCGCCCACTTTTCTTTTTTTTGTTTCTGCCCGGGC
TGGGCACTTGCTCACACACATGTGTGTGCAGAAGACATACATATGTATGTACATATTTGG
AGATTTGCACACACACACATCAATGAAACATTCCTACCTCACCACATTAAAAGTGGCGCC
CTTTTTTAGTGTCCTTTCTCCCGCTCTGCGCTCTCCTCGATGTTTGCTGAATTATTTGCT
CGAGAAAAACAAGAGAGTGTGAGAGCGCAATCACGGGGGAGATTCGCTCCACTCCTCGCC
TCCTCTCTTTCTCTTGCTACCATTTGCTTAGCATGTAAGCTGTAAGCTGTAACTGTAAAG
CGCTTAGCGAAAAGGGGCGAAACCAGGACCTATGCAAACACTCCCCACCTCTCCCGCTCA
TGCGCGCGCTCTCCCTCTCTTCTATTGGAGCTCCCCTTGCGCTCTCCCCTCGTGCACTTG
CTCATCCATCTTTAATTCGCAGCTCGGTTTTTCCTACACACGCACACACTTACACGCGTT
GTCTTTAATCGATTTGTACTTCTTGATATTTACATCAGCCACCCCCCCCCCCCCCCCCAA
CTCGTTTTGCTCTTCCCTCTCTTACACGTTGCGCTCTCTCTCTCTTCTGCTTGCATTCTC
TGATTGGATATCTAAATCCTGGATCCTGCCCCTCCCTCGACTTAACAGCCTCAAATTCCA
GCTCCACTCCCATTTTCGTGTCCCTTGTCATTCGTTTTGCTGCCTTTTGCCATTTACAAT
TTATATAAAGTTATTTCATTGTGCGCCATCTTCTTCTTCCTCTTCCTTCGGTGATGAAGA
CATACATAGCAATATGGGTGTGTGTGTAAATGTGTGTGAGTCCTGCGGTCCGCTAATGGG
CAATTTATATTACTTTCATTGACCAGCAGCAAAATCAATAAAATGAAGAGCTAGCTGGCC
AACATCTTTTTACATAAATTAGTTCTGGGTGATGATTGTTTACTTTGTGTGTAAGTGTGA
GGGTTAAGGCTCAACTGTACTTGTATGCACGTACATACATGCAACTGACATTTGCATTGT
TGCATTGCAAATGTCCTGTAATGTCCTTCGGCACCAGAATGCTGTCAAAATGCCAAAGGA
CCAACACCTTCACCTCGACTGTGTACTAATCTTTGTCTGATCATAGTCCTTATTAGGAGC
AAAGCTTTTAGATTTGGGATATGCAGCATATTTGCAACATCATACATCCCATATCCTCGT
AGATACACCTTTAAGAAAAATACACCTTCTCGTCAGTCAATAGATTTGATTCCAATAAAT
TTCATTCATTTACAGGTGAACAATACAAATTGGTTGTGCGCCAATTAAACACCCAAATGG
ATCAACTGTTACAGTAGCAGCCACAACATCAGCACAACGGGAGCCAGAGCAAGAGGCAGC
AATTTCATGGTAATTGTCCCCAGTCAGCGTCGATAAGAAAGACCTCGAAAAATACCTGAG
CAGCCAGAGACTAAGTGACACCACCTCCACCTTCCACTTGCATTTTTTGTTTGTTGTAGC
CACGCTCAGCGAAAGCAGTCGACAGCAGCAACAACAGCAATATGTAGGCGCTCCTCAGCA
GCAACACATGAAATACAACAGCCAAGAACAGCAGCAACATCAACAACAACTACTCCCAAC
AAACCAATAACTCCCAAAACAAAAAAAAAACAACACAACAACAAGAACATCATTAGGATA
TAGGAATCAGGGAACGAGCAACGCCACAACGATCGCCCGGATCTGGACACAAGAATGCAG
CACGTGAGCGCTGCCAGCTCGGTGCCATCAGTAGTAACTCCTGTTGTGACCACTGGTGGG
ACAACGATCACATTGGGCGGCCCACCACCGCTCCCTAAATCCGAGCACAAAGAGGATGGC
AAGCCGCCGCACGGCATCGAAATGTACAAGGTGAACATTGAGGACATTTCGCAGCTCTTC
ACCTACCACGAGGTCTTTGGCAAAATCCACGGCGATGTGGTCAATCATCAATTAGCAGCG
GCCCACGGCGGCCAGTTGCCACCACCTCCTCCGCTGCCGCCGCAGGTTACCAGTCATGCG
GCGAGTGCAGCGGCAGCCGCAGCAGCGGCGTCCACGAATAATGCCGCCGTTGCAGCGGTA
ATGGCATCAGCGAATGCAGCAGCGGCCGCGGCGGCAGCTGCATCGGCGGGGGGAGGACTA
CCGCCGGCCACCAGCGGCAATGGGGGCCAGCAGGTGACGGTGACGACGACCAGCAGCTCG
ACTAGCAGCGGCGGGAGCACCACCAGTGGGGGCACCACGACCACGGCGGGTGAGTTGCTT
ATGCCTAAAATGGAGGGCGGAATTCATGGCGTGGACGGCAGCGGCAATGGCGGCAATGGT
GGCGGACAAAACGTGGCGCTGGCGCCAGACGGTACGCCCATTGCGACGGGGACGCACGTC
TGCGACATCTGCGGCAAGATGTTCCAGTTCCGGTACCAGCTGATCGTGCACCGGCGCTAC
CACAGCGAACGGAAGCCGTTCATGTGCCAGGTGTGCGGCCAGGGGTTCACCACGTCGCAG
GATTTGACGCGCCACGGCAAGATCCATATTGGCGGGCCCATGTTCACCTGCATCGTGTGC
TTCAATGTGTTCGCGAACAATACGAGCCTGGAGCGGCACATGAAACGGCACTCGACGGAC
AAACCGTTCGCCTGCACCATTTGCCAAAAGACCTTTGCCCGCAAAGAGCATCTGGACAAT
CACTTCCGCTCGCACACGGGCGAAACGCCCTTCCGTTGCCAGTACTGCGCCAAGACGTTC
ACGCGCAAGGAGCACATGGTCAACCATGTGCGCAAACACACGGGTGAGACGCCACATCGT
TGCGATATTTGTAAGAAGTCCTTTACGCGCAAGGAACACTATGTTAACCACTACATGTGG
CACACTGGTGAGTGTGATTGATTGGTGGGGGCGGACAATGCGAGCGGCGAGCGCCAAAAC
AAAAAGACAGATCAGATTCTCTCAGAACTAAATACCGAAAAAAAAAAAATATCCAAGACC
AACTCCAGTCAGACCAAATTCTATCCATAGAGTACAAGAACAACAACAGCCATCACCACA
TCACACCAACCAACCAAACCAACCAAGAACCAAATCAAAAATTCAACCAACCAACCAAAC
CAATCAAAAAGAATTGACAATAAGCACCGCAAAAAAAAATATATATAAACTTCATCGTGC
GTCCTACGTCTTCTTCCACCCACTCTCTCATACACTTCTATCTCGCTCATCGCTTGTGCT
TCTTCTACCCGCCAACTCCCACAGTCCCGCCCACTGTACTCACACAGAGAGAAAAACATA
AACTGAAATTGGTCATTAACTTTGGTACCTTTCCTGGTCAAATAGCTATACTTTCTTATC
ACCAACTTACTTAGAAAGTGCCGGAATTCAAAATTCATTTCGTTTAAAACATCTTACAAA
TGTTTTCCAAATTCCATGATATATAATCACACTAAAACCGCATGAATTTCATTTTAAGCT
TTATTTCTGAAATGACAACATTCTAAGGATAGTATTACAAATCAGTTCAGAAACAAAACA
ACTAATTCTGCCTAAGGGTTTCATAAATTCATTAATTGCATATATATTATAGAACTCAAG
CTAAGGTTCTTAATTCTCTAGAACTTTTAGGTATAGATATAGTTCTGATTTTTTTCTCTG
TGTCAACTAACGCTTCATGCGAGCGAATCTCCAAAGAAGTGGAGAACGCTCCTCGCCTAA
TCCCGCTACAAAATTAAAAGAAAACACGCTCACTCGCTCATACCGCTCCATTTCCCCCCA
ACCATGATCTCTGCATCACACATCCCCAGCTTCACCAAGTCTTAATCATGCTCACATGCA
CCACCAATCCAAACACTTCATCCAGTGCTCGCTCCACTCCATCACTCCAAGTCCACGTCC
AATCCTTTACTCCCGTTTCGATTCGATATCTAATGCCTGTGCAACTTTGTCTACGCTCTC
TCTGCTGTCGAACAGGGTGTCCAAAGCAAAGCAAAGAAAAGTCAAGAAAGTAAAGAAAAG
CTAAGAAAAGTTCGTTGTTGCTGCTTGTCGATTGCCAACGTCTCTGTGTAACTGCGACAT
TTCACACTCGATCACACGAAAGCAATTGGATCACACACAACACAAGAAACACGCACACAC
AAACACACCAATCAGCTCACCTGCATAAATATCTGCTAGGTAGGCTTAGATACCTACCTT
AAACTTTAGCTCTTTGGCGAAACTTTCTTCTGGAACTGCACGTTCCGCACAAAAAAAAAA
AAACGTAACAAGAACAGCATCCTGAGGATCAGCATTGAGTAGAAGCAGAGTTGACAGGCA
CACACAAAACAAGACACACATCCAATGAACATCATCCACACCACATACAATCCACAACAC
ATCTGACACCACCACGCCCACGTCCATATGCCCGAGCCAGCAGCCTCCGTTCGCTTCGTT
CGTTCGAAACCACAACAACGCAAGCCACGGCCAGTTTCACACCAAACAGAAAAAAAAACG
AAGAAAAGATTTTAATACGAAAGAAATAAACCCACCCACCCACGCAGCCACCCCATCACT
AAACAACTAAAAAAAAAAAAAAAGACAACAAAAAAATAAGACTGAGCGGCGGTGCGCGCG
AGGATGGGTCGGGGGATCTGAAATTTTGTTTTTTCTCCGATTCGCCAACATTTCTCCAAT
GGGCTGCCGCAAGGATCCCTCTTGGAGAAATGACCGCTGATTCGAGTTAAGCGAGAAAAA
AGAAAATGCTTGCGCTTACGAATGCGATTTTGTCTTGTCGAACGAGATCAAACGCCATTC
CCTATATACAACAATTCCGTTCTGTTCTGCTACCCTCTCCCACATATCCAGGTCAAACGC
CGCACCAGTGCGATGTCTGCGGCAAGAAATATACGCGCAAGGAGCACCTAGCCAATCATA
TGCGATCCCATACCAACGAGACGCCGTTCCGTTGCGAGATCTGCGGCAAGAGCTTTAGCC
GCAAGGAGCACTTCACCAATCACATACTTTGGCATACAGGTAAAGAGACAAAACGAATCG
TAAGCCCGCTTCCTGCACCTCGATCCCGATCGAATCCTACCCAGCCTCCAGCTACAGTCC
ACGACACATAAAAAAAAACCCTGTATACACAGACACTTGGCGGCGCAGCGATAACGAACT
CTGGCTAGGATTGGGGTAAAAGCTAGTTGCACTCCACTGTTCTTTGTGGATCAATTACTT
TTCCAACTTTACTTTTAACATTCTTGTTAAAAAGAGATTAATCATTTCTAATATAACTAA
CTTTTGATTTAGAATGTAGTCTTAGAATTACTTACAGCAATTGTATGTTTTGATAGTCAT
TTTCAGCGTAACTCTCTATAAAAATATGTTTTGATAGGACTTAACTTAGAAGTCAGCAAG
TCTTTAAATTATTTTCTTTAATCCTTTTTTTTTTAATGTTTAAAAGCTGATTGATTCTAG
CTTTTAAATTCTTCTACTTCTCTTTAATCCCTTGAAACTCAAGGTTTAGACATATGGTTT
GTTCTTGTAGTTAGTTTTCCTAAAATCCAGATCGCGGGGACGGTGAACACACGATTGCAA
CACGCAGCTCTTTTCCCCCGTCGCCTAGAGGAGATAAACAACACAAGACCAATCCGCGCC
AGGTGTCCAGTGACCCGCAACCAGCCAGACCAAACCATGACCGCCCCCCCTGTTCCATGG
CGATGATTACTAATCTCTAAACATTTTCTCGTCCCATTCGCGCGACACCCACACATTTGC
CACGCAAGCAGGCGAGACGCCGCACCGGTGCGACTTTTGCTCCAAGACGTTTACGCGAAA
GGAGCACTTGCTTAACCACGTGCGCCAGCATACGGGAGAGTCGCCACACCGCTGCTCCTA
CTGCATGAAGACGTTCACGCGCAAGGAGCACCTGGTCAACCACATACGCCAGCACACGGG
TGAGACACCGTTCAAGTGCACGTACTGCACGAAAGCGTTCACGCGCAAAGATCACATGGT
TAATCATGTACGGCAACATACAGGCGAGTCGCCGCACAAGTGCACGTACTGCACCAAGAC
GTTCACGCGCAAGGAGCACCTGACGAACCATGTGCGCCAGCACACGGGCGACTCCCCGCA
CCGCTGCTCCTACTGCAAGAAGACCTTCACGCGCAAGGAGCACCTGACGAACCATGTGCG
CCTGCACACGGGCGACTCGCCGCACAAGTGCGAGTACTGCCAGAAGACGTTTACGCGGAA
GGAGCACCTCAACAATCATATGCGCCAGCATTCGAGCGACAATCCGCATTGCTGCAACGT
TTGCAACAAGCCGTTTACGCGCAAGGAACACCTGATCAACCATATGTCGCGGTGCCACAC
CGGTGACCGGCCCTTCACCTGCGAGACGTGCGGCAAATCGTTCCCGCTCAAGGGCAATCT
GCTCTTCCATCAGCGCAGCCATACCAAGGGCCAGGAGATGGAGCGGCCATTCGCCTGCGA
GAAGTGCCCCAAGAACTTCATCTGCAAAGGTGAGTGAGCTCTATGATTGTTGGCTGTGCG
TTGCATGCATCCAGTGGAGGCACGCGTGGCGTGGCGTCAGCATAGTGTCCCAGCTACAGT
CATAATCCAAATACCTTAATCCCGATCCTCTTCTCCAGTTGCTGTTGTGGGGATTGCTTT
CACAGCCTCCAAATGTCGTTTTCGTGGGTCGATTCTAGTCAGAAACCAAATCAAAAATCG
TTTAGTTTTTCAGAAGATTCATGTTTAAAAACTTGTTTTATTATTTTAATATATGTAGCT
ATTTTAATTAAACAGTAAAGAAAGTAAAGAATTGCAAATCATATAGAAAGGAATTAAATA
GATAATGTGTACATAATTCTTGATTTAATACATTTATTCATTTTATGATCAGTGCAAAAC
TTGTTGCATTGAAAAGCAAATTATGTAAATACTTATTAGATAACTTCTAGCATTATTTAA
GATTTCGGTTTCTTGTTAACAAAAATGATGACTAGACATTTACCTCTTGAGCCTAATTTG
CATGCCGACAACGACTGTGAGAGCAAGCCCCCAAAACTTACCTGAGCCGTTTTCGAAATT
CAAGATCCCCGACGATCAGATCTTCATGTCGCTTCCATTGTCCGTTTCGCAGGTCACTTG
GTCTCGCACATGCGCTCCCATTCGGGTGAGAAACCACACGCGTGCACACTGTGCAGCAAG
GCGTTCGTCGAGCGCGGCAATTTGAAGCGCCACATGAAGATGAATCACCCGGATGCTATG
ATGCCGCCACCACCCGTGCATCCGCATCCGCAAATACCGGCTGGTGTGCTGACGCAAGTC
AAGCAGGAAGTGAAACCGATCATAAGTGAGTCGGCAAACACGACTGCGCTAGCGCAAGCG
AGTCTTCCCGTGCCCAAGTCGCCCAACTTAACCGGTCCTCCTACCGTTTCAGTTCCCCAT
CACTCGGCGACCACCACAATGCACACCATTCAGCAGATCACGGCGGGTGCGGCGGGCGGA
GCCGGTGCGGTCCAGTTAACACCGGGTCTGGTGCCCCTGGTTACCTCTACGCTCATCTCA
CATAATGCGGCTGCTCAACAGCAGTCGCAGAAGCAGCAAGCAGCCGCCGCAGCAGCTGCA
CAGCAACAGGCCGCAGCCGCCGCTGCTGCCCAACAGCAAGCAGCTCAGCAACAGGCGGCT
GCTGCACATCAGCAGCATCAACAACAAGTGGCCGCGCAACATCAACAGCAGGCTGCAGTG
GCTGCACACCAGCAGCAGCAACAGCAGTTGCAGCAGCAGCAACAACTGCTTCAGTTGTCC
ATCCAACAGGCGGCTCACCATCATCAGCAGGAGCAGCATCGTCAACAGCAGCAACAGCAA
CACCAGCAGCAACAACAGCAACAGCATCACCAGCAGCAACAGCAGGGTCATCCACAGGCC
CCGCCACCGCAGCAGCAACAGCAGCCGCCGCCCATCGCCTTGATCAGTGACCCAAGTGCT
CTGGCACGTGCCGCCATCCAGCTGCAGCATCTGCCAGCGAACGTGGAACAGCACCCGGTT
GTTTACTAACAGTAGCCCCTCCTGCACGGCTACACTCCCACCACAGCCCACTCCAGCAGC
ACGACCAGCACCTCAATAGCTGCCACAGCGGCCACTGCGTCGTCGCAAGCGGCGTGGTGA
AGGCATGCGTGCCACCAGTGAGCCAGTGCTAGTGAGCCGAGCTGACGCGACTTCTCTAGA
TAGGACACACATCATAACAAGCGCACCCCATATAAGCAGCTAGTTGTATGTACAATAGTT
TTAGCAGCGCGCTGGTTACGCTGATCGGTGGCCCCAAGCGGATATCGTGATACGCTGGGT
TTCTAGGGTGTGTCGATTTTTAAAGCAAGCGTGTGTGGTAAATATTACTTTTAGGACGAA
ATGGCACAGTATTGCCTTTAAAATGTCCAGTCTTCTAAAGCCCCAAAATTTAATTGATGG
TAATTAAATATTTTGTTATCAATTATTAAGATTTTAATTCGTGAAATATTTTAAATCAAG
TAATTTAAAATAATCAAATCACCCTGGAAACTCAACGAGATATGTGTCCCAATCGCAAGC
AAATTAAACACTCCTCAATTAGTCTGCCGCCGCCAGCTTTAACGTGCAATACGAATCATC
TCATAGTTTGTTCTTGGTATCTCTCCCTTTTATGTGTATCTTTAATGCTTAGGCGCTTAG
CGTCTAATTTTATTCACGTGTTTTCTACATTTTTGAAATGTGTGCCAGGCGGCGCGTGAC
TTTGTTTGGGTCGATCGATATGGTTTTTGTGATATCCGATTGTTCCTTAGCTGCGCTCAG
TGAATCAAATGGATCCGAAGACCAATCCGTCTCAGGCAATTTTCTCGCTAGACACTTAAA
GTTAAGGGGTTTTTGTTGCCGTAACCAGCAGAAGCGCACCATCTTGTATTTTTATTGTGT
TTTGACTAAGTTATGATTATATCCATATGGAGCGACATTCATAGAAAGCATCCTCATCAT
ACATAAACATATGCAGATATGCATAGGCATACAATTATAATATATACTTATAGTTTGTAA
ATAACACGCAACAAGACCCTTGGAAATCTATCGAAAATTATTATCACAACTGTATTATTT
TTGCATTTTCCAAGGAGGAACATTAATAACGAGCTAACGCGCGAAAACTTTCACATATAT
TGGCCAAGTGTAGTCCTTAACCCAGTTTACAATATATCGAGCCCTGAAAGTGGGGCTGTG
ATGATTATGAGATATATATACAATTATATGACAGTGGAAACAGAAGCAGCATAACGGCAG
ACCCAACTAACGAGATAATGAAAAGGGATTAAACAAACAAGTTATTATATTTAATGTTAG
TTGAACTACTAAAAGTAATGATTGAAAGCACGGATCGAAGGAATGGAGATAGGAGTTCCC
GCGTGGGAGTGCGAGTAGTTTTTAGTTGGGCGCGTCGCCCAATCATTATGATTACAATTA
CAATTACGATTATGATATATGGAATACTAAACCTATAACAACAAGTTATTACCCCACTAT
TAAAGTTAACAAGCAACAACAACAACAACCCATACATATACATATATACGACTAGGCACA
ACTCTAAAATTAATTATAACCCTTAACTGTGCTTGTGTTGAAAACAACAAACATTAAGAA
CAAGTTTAAGCCGTAACGAAATAAAAGAAAGTGAAACAATTAACGAGAAATCCCCAAGCG
CCACAAGCAACAACATATCTGCTTTAAATTTTACAAAAAAGGAAGAGAAATCTAAAAAAA
AGTATATTAAACACGAGTCAAAGTTTAATAATTTAGTAAGAAAACAATACACAGACAAAC
TGACAGACACACGACCCACACATTATGCTTCCTTTTAAATGCAACATTTTATACATTTAA
TTATCGAGAATTAAATGCTTAAAATACAATTTTAATTTAATTTAACAAACTGTAACTGTA
CACGAATAAACGGAAAATGTAAAACTGTTTGTTTAACCATTTAAAGACAGAACTTGGTTT
TATTTAACCTAATTTTATTGATTCACGATCATCGCAGCAAAGTGCACATTTTGAATACAC
TTAGAATGCAGGGAACAATTGAAAATTGAAAATGAAATTATCATTGATATGCATGTATTT
TGCTTTCACACTGAAAATAATTGTTTTCGAAGTCGCAAACACACACTATCACACGTCTAT
AATTATGTAGTTGAGTATCCGTGTTAGTTTTTGGGTGTTTTTGGATTTTTGGTGATGTGT
ATAGAGCGCAGTATATAGAATGCATATAGAGATATATATTATTGTACGATTATTGACTAA
TATATAACGGATATGTATGTGTAGTACGTGAAAGGCAAGTTTATGGAGACAATTCACTTG
TGTTGCAATATTAATGAACAAACGAAATAATTTACTTGTAAGTTGCGTAGTGCAAGCCGT
GAGAATAGAGGTAACTTTCTCCACAACCCACACTCACTGATCGACAGACACATACCCATT
AACCTTAATGATTAAACGCTGGGACAGCGGCAAAAATGTTTCCTAGGAGAAAAATTAACA
GAAGCTGAAGAAAACGCTTGGAATGCCCCAATTAACGTAAACATTAAAAGCAACAAACAG
TAACAATACTAAATAGAAACAATAATGTACTATAAATCAGATACAATACAACACTATATA
TACCTAAAATATATATGCCTATACGACAGAAATTGGACAACAAATGAAATATATATATAT
ATAGTATATATTGTACAAGTTACGAGTAAAATGTAATTAAAATTTATGAAGTAGTAAGCA
CTAAACAAAACAAATAAATGAGCAGCAAAAACGCGCAGCATAAGCATAAAACCGGATTTT
ACAAGAAACTGAGTAACCCTGAGTAGAATTATATTTTTTGGTTAAGGATATTATTATGAT
TTCGTATCTCTGGGATACCCCGAAAACTATCGCTTCGTTTTCCCATCTCCAAAAGGATAA
GTCGTTTAGGTAGCGCGAATTCCGCCCGATCTGCCTGGAAACCCACCCCTAAATGACCTT
CGCACTAGGTAGCATCGGACTACTGACCGTGGCAACTGCGTGAATTCATTAGTATTCCAA
GTACCACGATCGAGAACAGACCGCAGATGACGTCCGCAAGCGATACAGGTAAGGAATTGG
CTAAAAACGAAAAAAAAAAAAACAATACAACTGAGCCTATTAAGACGATCGTCCTTCAAC
TTTTTAGAACCCACTGCAGTAACGCTGCTCCAGCTGAATGACGATGTCCTGGCTTTGATC
ATCCGCCAGCTGGACACGTACCAGCAGTTCCAGATTAGCAGGTTGAACAGGCGCTTGGCG
GGCGTAGTGCACATGCTCTGGGAGACCCGTGTTCGCAACGTTGTCCTGCAGGACGAGATG
TTCGGACGCTCGGGAGCCAATTCCCGACAGTTTGTGGCTTTCATCTTGGCCCTGGCTCCG
CACATGCAGCACCTGAGTTGCAAGCAGTTGGATGTCCGAAGACTGCGACTGCTCAGTAAC
CACACGCTGGAGAGGATTCACTCTTTCGAGTGGCTGGGCAATGTGTATAGACGGAGACGC
GTTCGCTTCGTGGATGAGGATGTGCGAATGCTGCAGAGGGTATTTCCCAATCTAAAAAGC
CTCAAACTTAGAGGCTGCCAAATTACCGGAAAATACCTATGCGACCTGGATGAGCTTACC
GATCTCCGCCTGCATGATTGCCATTTTCTGGAATCGCAACACTTTAGGGACATCTTCCGG
CAGCTGCGACTACGCAAATTTGACATAATGGAGGACTGTGACGAGGTGAACTGCTGTGAT
CTGGCGGATCTGCAGCTGTGTCCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1959, 3816..3925, 6075..6188, 6299..7686, 9651..9818, 10571..11308, 12232..15646
6534..7686, 9651..9818, 10571..11308, 12232..12845
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved