Drosophila_melanogaster Locus Uhg2
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Uhg2
Drosophila_melanogaster
Uhg2
2L
snoRNA:Me18S-A1576, snoRNA:Me18S-G1620, snoRNA:U14:30Ea, snoRNA:U14:30Eb
1097..1209, 1460..1527, 1719..1799, 1978..2058
3199
ATCGCGTACTTATGCGCAGCCACGTACATGATGGGCACGCCGGGAATCTTCCGGATGCG
ATTCTTAAGGTCCTTGTCGTTGGTGGCCACAATGTAGCATTTGTGCTGGCGCACCCGCTC
CACGAGGCAATCGTCCGCATAGGTGCCCTTGTGCAGGCACGGCAGTCGCTCGAATCTGGG
ATCGGAGATGATGCGCAGGGCCAGCTTGTACTTGTTGCCCAGCTTCTCCAGCTCGGCACG
CACGCAGTCGGAGATATAGGGTATGCACTTGGCATACAGACAGTCCATCATACCTTGCAC
AATATCCAGTTTGTTCTTAATGCTAAAGTTAATGAAGTTCGTGTCCAGAACGATGTGGTA
CGGCGGTCCCAGCTGGGTGTTGTACTGGAAGAACAGAGCGGAGCTCTGCTGGGTGGCCTC
GTGCACCTTGATCTGGTGCGGATCCTCGGCCTTCTTTCTTTTCACTCGAATCTGATCCTT
AAGCCGCGCGTCTGTGGGTTTTATGATGCGTTTAAGCTGTGCATTACGTTGTTTCTTAAC
CTTCTGCGTTTTCTTGTGTTTTCCCTGCAAAAGAACTGAAGATGTTAGGTCGGGTTTAAT
TAAATATTAAAGATTTATATATACCATTGTAAGCTGTAATTCCCAAAAACTGTAAACAAT
ATAACTTAAAAAGTGGCACACGTGTGGTAAGTATTTTGGTAAAATCAGCTGTTTGGGCTA
GATCACCGAAGACAGCGATAGGCAATCGATACATCGAATTAACATATAAATATGAAAGTT
TTTCATATATTAAGTATTTTATGAATGATTTAATGAAAATTAAATGGAATATCATTTATT
CGGTTAAGTTAATTATTGCACATTCTTATACAATATATATCAGGCAAAAACCAAACAATT
TTTCCGATACGATACTACCATGGTTGCATTCAGAGACATCGATAGTTGGCCGCCATCTTT
TCACAGAATTTTTCCTTCCACGTGCGATGACGAAACTCGTTCATTTTATTTCAAGACTCG
AAATGGTAAGTTGTGTGCTCTTCGTAAATAGTTTTATATCAAGTGAATTAAAGTGCTTAA
ATGGAAGAGTGTTATGCCTCAAATGATGAAACAGATGACGAGACTGAAGGAACAAATTCT
CGACTTGGCGCTGTATTTTTCAGTGCCTCGTTATATATTTGTTCATTTAAGATGATTCGG
CGATCTGATGGCATATAACTTCAAGAACTTTCTTTGGGTTTGGCAAGAATATGTTCTAAA
AGTTCTGTATTTCTTGCAGTGAACAATATTGAAACCCTAAGCATTTGGATAAATCGAAAT
CCGGGCACTCCACGTGCATGGTGCATGTGAGACACCTCGGGACAACATGTGAGCCCGTTG
AGACACCTTGGGCACTGAGCCCACTGGAGACGCCATTGTCACATTGGAGGTAAGATATTA
ATACTTTTGGTTGGTCTATGCTTCTCTGATGATCTTTTACACAGACCTGTACTGAGCTCA
TAACCGTGCAGAAAATTGTAAACTGAAACCTAATCAAATATATAAAATATTTGGAAGTAC
TCCTTGTACACACTGTATTGATGCCATTTTCTTTTATTTCCAGAATTTACATTCTGGTTT
GAGGTTATGTATGGGTCCAGCTGCAGCAGCGAGCACATGGATTTACCGATAAAGGTAATT
TATTTACACTAACATTTTTATGTTTGAATGCAATATACGTTTTACTGATGATTAACTTCA
ACACCTTTTGCGGTTTCCACCAGAAAGCTTCGGCTTAATGATGGTCTAAGGCGTCTGACT
AAAAAGTTTCAATAAAAACTTTATTATACTTAAACTAGCATTTTACTTACCTATTTTATC
TCTTGTTTCCAGATCAACTCAGAAATGTGGTTTATCGCAGGCAAATATAACTAAATGAGC
TCGTTTATTCGACTGTATAAGGTAATATTTTCGAGAATTTTTTTTTTTAAATTAATAAAT
AAACTGATGATTACCTTAAACACCTTTTGCGGTTTCCACCAGAAAGCTTCGGCTTAAGGA
TGGTCTAAGGCGTCTGACTAATACAAATATATATATTTCGGCTGTCTTGAGATGATGTAT
TTAATATATTTTATATTTTACTTTAATTGCAGAGTGACGTTGCCTTGTGTAAAAGATCTT
GATATAAAAAGAATTGGACATCTTCAAATACTAAAATAAATAAACTAATAAAATCAAATA
ATCACGAATTGTATATATTTTTTATTGTTATTGGGATGGTGGAAAAGAGCCGCAATTTGT
TTAATCAGTTGTACAAATAAAGTATTGACCTTAGAACAAAGTTATAGATAGATAATGCTT
TATAATTTGAATTTACCGTGCTTAACTAAACTGGTATTTATCGAACAATTTAGCACAATT
GTAAGCGCACTTTACGAAAGTAATTTAATGAGATTTCCTAGTATTAAATAGAGCGCTTCC
CAGAGCACTGAGAGAGTACAAAGATATTTGAATGATTAATAGTAGGTAAACAAATCTTCA
AAATTGCGCGCCCAATTGTCATCCCTATTTTCCACCCCTCACTTTCGATATCGATAACAT
GGAAAATGAGACGCGCCGGTTTAATCAAACCGCTGTTGCGTATAAATAACGAAAAACAAC
GTGTTTGGAGAAAAAACTACGCTACCCAAGTGGTTTCCGGCTTGGAGGAGTGCTCACTAG
ACCCCAAGGAGTATGTGGACTTCAAGCGGCAGCTGCGGCAGCTCAACTTGCCCCACAAAG
ACGGACACACGTGCTTGCAGCTGGAGTGTCGCCTCTGCGATCGCAATAGGCAGCCGGTGA
CAAACGCCCAAAAGGGCACCGATCATGGGCTGCTGGCTTACGTAAACAAGCGGACGGGTG
AGAGCACCAATTACATTTCGCAAAAAAAACCGTAGTATATTCAATTTTCCTTTAGGAGCC
TTTATCTGCCCCAATTGCGACGTAAAAACCTCACTGACCAGCGCTTTATTATCCTATCAG
TTGCCCAAGCCGGTTGGCTATAAGCAACCGCTGCAGAGGCAGCCGGTCTATGAATCCCGA
TTTCCCCACCTGGCCGTGGTTACTCCCGAGGCCTGTGCAGCTTTGGGAATCAAGGGCTTG
AAGGAGGACCAACTAAATGCCATAGGAGCACAGTGGGAGCCGCAGCAACAGCTGCTCCAC
TTTAAGTTACGCAATGCCGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1279..1428, 1603..1673, 1872..1940, 2132..2199
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved