Drosophila_melanogaster Locus RpL36A
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL36A
Drosophila_melanogaster
RpL36A
2L
snoRNA:Psi28S-2648
1507..1668
2992
GTCCATCGGAGATTTCGCCGTAGGGCTCCGTGAACACCTTCCGGCTGCGATCGCATGGC
GCCGACGGCGATGTGGACGGGTGGGCCTGCTCTGTTTGCAGCACCAGCGTCCAGAATGTC
AAGGTTGCTAGCAACGCGTACATTTTCTGCATTTTAATCGCTCACTTTTTATGCAAATTT
TTGGCTATCTAACTGGTTGCCGTTTTGGCCGTTTAGATTTGCTCTAGCCAGCGCACGCTG
GCTGCTGCCATTGCTCACGACTTGCCGCTGGGCCCGGGCCACCAGCGCATCCGGTTTCGG
CTGCTGGAGATTCGCTATATTTCCAATTATTTTCCACAGAAAATTGTTGAAAATATTTCG
ATTTATTTTTTTTTTGTATCGGGCCCTATCGGTCTTCGATAACGACGTTGCTTGTCGCCG
CCTATCGCTGCAAGTCGCGAGCAAAACAAAACATATGTTTCGCCCTCGATGGCAATGCCA
CTTTCACTTTTTGGTATTTTCTTAAAATCTGATTGATCTGGCAGCGCTCAGCATCAAGTG
ACCGTTAAGATATCGAAATATTATATATGAAATATATTATTTTGTCATTTTATTAGCATA
TTTCTGTGGAGATCGATGAAAAAACCAAGCATTCAGTTCCATGAACATTAAAAATTACTT
GAAAATAATTAATGTGGGGCAAAAATGTATTATACGTAGGTTCGCAGATAAAGTTTCGTG
ACACTAAAAATACATAAAACAAACAAACATGGTATACCTAATTGATAAGGCGTTTACAAA
CTTCATTAACTAATAATAATAGTATTCTTCTGTACTAAGTTTCAATATATGCACATTCAA
AACAAATGTAAAAACAATTGATTTTACTTCAAAAAGTAGAAAATAGTTTAAACAGTGCTT
AAGAACTATACAAACATCGATATGCATATCAAGTCACAACAATGAAACGAAAACCTATCG
ATAGCGCATGGCTTGACGGCACGCTGCCATCGCTATGTGATTTCCTTCTTTTTTCGCCTT
CACGAAATCAAGATGGTAAGCGTTTCCCGAAATCGTTGAACATCCGCAATTGTTATGCCC
GAAATTAAGTGATTCCGCCAAAAGAGCGGGAATACCGAAATGATTGACCCAAGGAGTGGT
CTATCGCGGATCGCGACGGCCAACAAGTGCGTTGCTGTTCGGCTTAAAAATTCGGTGTCG
CTGCCCAAGGAATTTTGTACTAATGGGATTTGTGTGTTTTCCAGGTGAACGTACCGAAAC
AACGCCGCACCTTCTGCAAGAAGTGCAAGGTCCACAAGCTGCACAAGGTGACGCAGTACA
AGAAGTCCAAGGAGCGCAAGGGAGCTCAGGGCAGGCGTCGTTACGACAGGAAACAGCAGG
GTTTCGGAGGTCAGACCAAGCCCATCTTCAGGAAGAAGGTAAGTGCCCCCATTCGTCTAA
TGCTACCGGGATCGCTTGCCGCCGGATTGCCATCGACACTAATGGCGGCTAGATTGGAAT
CCCTGGAATGGCGCTTCGTAGAACTAAATCGCTGCGCTCGTTGAGCATTATGCTTTTTGG
TGGGAAAAAACTGTGCCAGATCAAAACTGTTGTTGCACTGGTGCGGCCGTGAAGGCAACG
TTGTGTGGCATCCATGCCCACAACGCCCCACCGGCAACTTCAGACAATCCAAATGAATTC
ATGACCACCATTTGTATGCCGCTTGCTAACTGGAGTTCTAATTCCATTTTAGGCCAAGAC
CACCAAGAAGATTGTGCTGCGTATGGAGTGCACCGAGTGCAAATACCGCAAGCAGACTCC
CCTGAAGCGTTGCAAGCACTTCGAGCTGGGCGGTGACAAGAAGCGCAAGGGACAGATGAT
CCAGTTCTAGGCACCTTCTTTACACCATTAAAAATCCTTTTTTCGCTAACGAAGTGGTTT
TATGTTGTTTTCGCGTCGCTGCACGGCGGCAAATAAAACAAAATAAACTTGTAGACGTAA
GCTTTAAAAAATGTTTAATTGCAAGGTGTAGCAACATGTGCTATATCACAAGATCAGATC
ACGCTCTGCGCCAGGCAGCTCACTCTCGCTGGCCATCCGCCAGGATCAGATCGGGTGTGC
TGCAATGGAAATGAGCTTGATGAGCTTTCAATTTGGCCAAACCTCTCCACGGAACTTACT
CTAAAATACGCGGCTCCAGACCTTCGGATTGCATTTTCTGCTTAACCGCCGGTGCGGGCA
CACCCACTTGCACCATTTTGAAGAACTTTCTGTAACGTTGATCTTCACAGGCGCGCACAC
CAACCGATTCAGGCGGGAGTTCCGGCTCCGTAGGATTCTCGGTGGTCGGTGGTTCCGTGG
TGTCCACCATGGATGCTTCTTCGTTGCGTTGCTGGTTTGATATCGCTGGCGCTTCGGTAG
CCTCAGTCGCTACATGGTGCTCGGTGGGTATAGACGCCAGCTTGGCCTCCAGGATGATGA
GGGCGGCCTCCGTCTTCTGCAGCTGCCGTTCCATCTCCACGAACTTCGTCTCACAGCCCA
GGGCAAATTCATTTAGAAAGGTGCAGGTGCTGACGAGGAAATGGTTAACGAAGGCCAGGA
TGCGTTTCTGGTTCAGCGGCGGTATCTGGAGGAACAGAGTTGAGAGCTGCAGGTGCAGTT
CACCCTTGAATATAAGTCCCATACCTGGGTCTTGTCCACATTGCCGGTGATTGCTGCAGT
TGCATCCATTATTTTATTTTCACCAGCCGTCTTTTATTTTAGTACTTTTCTGGGTTGCCA
GGCTGACTGACGATACTAAATATTGTTCGCTCAACATCAAGCTGATCCAAAAATTTGGTA
TTTCTCACGTAACTTAACACAGTTAACTTGGCGCCTAGTTTAAAAATGAAATAGAACTGA
AGTTTCTTTCAAAAAACTTGTGTGCATATTTAAATGTTTTGAAATTTCATTTTTAAAGTG
AAAAAAAACGAATAATATACATAAATACATAGTTATAGCTTAGAAACCCATTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 1244..1417, 1732..1992
1032..1034, 1244..1417, 1732..1869
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved