Drosophila_melanogaster Locus CG11221
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG11221
Drosophila_melanogaster
CG11221
2L
snoRNA:Me28S-G2743
3493..3571
15179
GAGACCGCCCATCCTTGTCTACTTTATTTGCATTGCATTAAAAAACTGACTGGTATTGG
GGAATTGCCAACATAGTTGTTCCTGCAACTGGGACGGTAATTAATTTCGGTGGAACGGGG
TGATGTATTCGGATCGGGTGGGCATAACCTGGTAATTTGAGGTAATGCGCTAGATTAAGT
TTATTTACTTTGAAGGCGGAGCCGGTTAGGAATTACCTCTGATTTGGGTCAGGGAGTTTG
ACAAGAAGAAAGTGATGCGCTCGAGTTGATTTTAAATTGACTTAAAAGCATTGTGTACAT
ACATACATATCTTATTCAAGCTCTAATAATTATGATTTTGTATAAGTGATATGATTAAAA
AAAACACTGAAGACAGAATCTGTTCTAAAAGTCATAAAAAAGAACTGGATTTTAAAATCT
TTAATCAATATCACGCATAGGCATATAAAAAGTTCAGTTTAACTTTAGTTTGTTTTATTC
ACACTTAAATGTTTACCGATTACTTATATCTAGTTAGTTATCACCTTAATCCGCCCCTGA
AAAAGTGAAAGAACTTTCGCCAGGATGCGTTGAACCCAATGCAAAATCAACTACACCTGC
CAGCCACACAGATGAAAGCTTTCCCGAAAAGAGCTTTTCTCCAACATGGAATCGGAGAAA
GAGAACCAAGGCGAAGAGAGGACCAATATTTTAAGAGAGTTTTGCACCAAGTAACTTTTT
TTTTTTTAAATTTAAAAGCTGAATGATAACGTGTTTTTTTACTTTTATAAAAATAGTGTG
TTCTAAAATAATAATAATATATACATTGATTATAAAAAAGGGTCTGGAATCAAATGTTTG
CTTTAGAAAATCATAGTGTATTTTTTGTGCATCAAGTGAAATAAATGGCGAACAGTCTTC
CTTAAGAGCTTAAAAGCTAAAGTTGCCGACGAACGCCTTCGGCTGTCGGCTTTGGTTTTC
CATGCAAATATAAAAACCGAACCGTCTGGGTAATGGGAAATCATTCATAACGGAAAACTC
CTGGCGTGCGGACGTGAAAGTGCCGTGATTTCTACGTTGATTTCTGTCGCGTCTTTCGCT
GCTTGTGTTTTGTGTATTTTCCCCACTTATTCTTTGCGCCTATACTGCCCGCTACTTTAG
TATCCGTTCGGAAAAAACAAAAAGAAAATCGGGGCGAGCAAACAAGTCAACTAAAATATC
CCATTCATCTTGTTCTGCCAACTTATTTCTAATTGTGAAGCAACCTTGAATTTCCACATC
GCGCTGGAAATTGCTAAACAAAAACAGCGCGCAAAATCTATTGTTTACCGCAATACTAGT
CAATTACCAGCGATTTTCGCCTATTGCAATGTGACTTTCCAAGTGCGATCGCAGCTTTTT
TGACGTTTTGTTTGGCCAAGAGGACACTTTCAAATATCGGTAACTAACGGTATTCAATAA
ACGCGCCTAATAAGTGCAAGAGAGGATTAAGGATTTGGGATTACTGATCAGGGAAAACAA
GTCTTCAGAAATGGGCACTATCGGTGAGTAAATCTATCTCTCACTTTTTGCTTTCACCTA
ATTTTAGTCATAAATTCAAAACTTAACTTAAAGTATCCAAGATAAATTGCAAACAAATTG
AAACATATATCAGTGCCAGTGCTTGAATTAATTATACTTCGTTTGCTGATCCAAGACAAT
CATTTAAATAGTTTTCTCTGGCTGAGCTCATACATTTTCCCGGAATGTCTCATTTTCCTA
CCGCCCCCAAAAGGCCAAGTGATTCTCGGAATGGTTCTTCATTTGAGTGCTGTAATTGCT
AGTGGTTATCCAACAGTTGCCAGCCATCCATTCCGATTATCCATTGTTTGTCCAGGACAA
CTCCACACGAGCCGAGCTCAGTGCTGACCCAACACTGTGTTTATGTAAATAATCCTTTTC
AGAGAGCTCACGCAACACGAGCGAGATTCTTTTCAATCAAATAGGATGTGGAAGTCCGTC
CCCTTGCCAACGCCTCGCTCATTTTCATTTTCGTCCTCATGCTTTGCTGCTCTGCTTGCT
TTTCAATTATCCTGGCTAAAAATAAACCGAGACAGCCCACATGGAATACCCCAACCACTT
GGACCGGCTTTCAACACCAGCCCAAAAGGAAAAATTTGATATGTATATACATATATATAT
AGAGCGAAAAGAAAAGCAGAGCAAGCGACAAATGACAACGACGTCATTATCATAAACATG
GTCTGCCCGCGAAAATGTCATGAATTTTGTTTATCCAAAATGTATAAAATAAACTAGGCG
GCTGGGGATAGACCCTAAACTCATAATCGAATGACGCACGAGCCTCTGGTTTTCAACGCC
CATATTAAAATGAGCATGAGCAGCCGGTCATTAGCCAGGTGGCTCTCGTATCCTTGGTAT
CCTTACAATTCACAATACTTTGGGGGCCGCCCACAAATGCGCTCTGATTGCCATCTCGGT
GGGGCAGAGTCGGTCGGGCTCTTCTGCCTCAATGGGTTCATTGTGATGAGCCCCACACGA
CAGTTGCATACTCAAGTGCCACCTGCGGTCCTTTTGAATGCCATCCTCGGGATGTGACTT
GTGCCTGACCGAATCGCATTTAACACGCTTCAGCTCAGCTCGTGAAACATCCTCGAACAA
GTATTCTTGCTGGCGCTGCTGAAAGTTCAGGGGTGAATAAAACCATTGATAACAGAAGTG
ACCCTGCCTTCGTGGCCCTGCAACACATTATGCCCATGACAGTGTGGCAATTGAATAAAG
GTCACTTTCGCAATGTCTCTGGGCCCTCATGTCAATTTAACTTTTCATTTTCAGATTAGC
TCAAATCTATCTCTGTTTCGATCAGGTTCTCTATTTTACATTAGTAGACAGGGTTGCATT
TAGAGTGGATAACGGTATTATAAAAGGACTCTTTGGATGAGTTGCTAAGCGGATAAATAA
CTTCATCTTGCACACGAGCGAGGTGCTGCATCCTCAGGCGGATTTCTCAAGCTGCTGACC
CACTAAAGATCCGATGGGGGACCCGATCTAGCATCACCAGAAGGGCTTCTGTTCATTGGG
AGCAGAGCCCCACAAATGTTAATGGGACACTCATTATTATTGATTAGTTGTTTAGTTGAT
GGACAGCTATCACTAGCCAATAAATCGAATTTCATTGAATAGGGCTTCTATTTATTGCAC
ATTTTGGCTTGACTAGATGCGACTGACATACTTTAAATTTGCTATGTTTTGGTGGGAACA
CTTCAGCTTCAAGATGGGGCAGGTTGGAATCGGGTAGATACACTTGCAGTAGACAAATTG
ATTGTTAAGATACTCCTCAAACTCCTCCATGGCGGATTCGTTTTGGAGCAGATCGCGGTA
TTCCTCGACACTCTCCAGATTCACGGGATCCAGCTGATGCATGAAGCACTTGAGCTTCAG
CACTGTTGCATACAAATAGTTGAATATGTCGACGGCCATGATCTTGTGGTACTTGATGCT
TCTATGATGGCTATCGCCCATGATGAAGGGCGTTTCCTGGGCCTTGTCCAGCCTTTCGTA
GGCGGCATAGAACTCCTTGCACTGCTGATTGATTTCCAACAGGGTGTTTTTCATTTTGTT
GCTAAAAGAGAAGCGCAATGTAAATAATTTCGTAAGCCAAGTTGTATGCAACTCACTTTG
AAGCTCGCAGCACTTCCAATTTTTCCTCATATTCATTGATAATGGCCTCCTCGGTGGACA
AGGTGTACACTTCGGGATAGCGACAGCTCTGCTCTGAACTGATTAGAATCAGATATCGCT
GGGTTAGCAGCCATATCCGTTCAACCAGTATCTTTTGGGCCTTCATTTCGCACTTGTATA
GATTGTAGTATTCCTTATAACGCATCTCTAACTTGACAAGGAGACCCAGAACTTCTGCCT
CAATCCCGTAGTGCTTCTTGAGCTGCTTGGTTAGATGCGGCTCCTCATCCTCCACCTTGT
TTGATCTGTTATCCGATCTGCGCTCCAACTTGCCCGCCACTATGGGTTCCAACATCAATT
CAACTCTGTGTTCCATTTTGTTTATAGACTACGTGTGTTGGGTGTGTGTGTGTGTGTGTG
TGCTAACTGCCTGACTGTCTGAGAAAATCGTATAATGGATCGGCCTTCAAGGCAGACTAG
ATGATTTAGTCTCGGCTAATACTACCCATCCATTTGGGTGCTCATCTCTTTCGTCAGTGG
CCTATTAGATCTCTAAGGTTAAACCAATTTGTTTGGCATCGGTCGAATGGGAATCCTCTG
AGTATTGACGAAAAATCACTTTTAATTAAGATCAGTTGAAAAGATGAAGATTTATATTTC
ACTTAGGCCAATTTAAAAAAGATTTGTCTGCCAAAAACATGTACGTAAAAAAGAAATCAG
CTTCGCAATCGATGAATAGCATGTGATAGTTAAATATAAATATACTAAATATAATATTTA
TACGATTGAAATCAGTCGGGCGGCAAAAAGGAGCTTTTGATTGATTCGATTTTCGAGCAC
TTTCGGCATTCGAATGCATTGGAACGGAAATCAAATTAGCCAAATACTGCAGTGCTGCTG
ATTTTTCCGAGAGCCAACCAACTTATATAGCGTACACACAGGAAAATCCGTTGGCATAGA
TTTCATGTTAAATGCGTAATTTTTCCGTATTCTTATTTCGTTGGGCATCATAAATGAAGT
GCGAAGCCAATTGCCGGCAGTGAAACATTTAATATATCTGTTGCGATATGAAGGAAATTC
GAACTCATGAGCAATGTTTGAGCAATGTTTCCAAACGATTTTTCAATATCACTCAAATAA
ACAATAGGAACATGCGAGTGCAGAGTGCGAAAAGTGTACGCGTATGAAATGCGCTCTAAT
TGGAAAAATGTGTCGGAAATATTGACGGCTGTCAAATGTAAATGGTAAGGCGAAAGGTAA
ATGTTTAAAAATATCTTCAAGTGAAATGTTATAGCCACAATGATCGTTCTAAAAACTTTC
CAATCTGGCTTCTGCAATACTGCAATTTTGTCTCGAAACATTACATTTTTTTGTGAAAGA
AAATATTACAAATAAATGTTCAACAAAATATCCACATTTCGCACATCACGACTGAGCGTT
GTTTACGATTTCGGAATTTTTAATTGCCACAGCGGCACACGCGGCGTATGCGCGATATCT
TGTTCGGTGTAATGTGTTTAGGCTATTTTGGATCAGACAAGTGCTTCTTGTGCGCCCTCA
AGATGTGTTTTCTCAACACCAAATTGTTAATGTGCAATTAATTCTGGGCGAGAGGTTGCA
AAATATTTTTGATTGTGTTCAATTAAGAGGCGAAGGTGCAATGAACCTTTCGCGATAATT
GAAAAAAGGGAAACAAAATAATGCAGTCAACTAAGAGGGCCAAATTTGAAAAATGTATCG
TTTTAGGTGCGTTTTTGTAGTTATTTGCACTAAGTGGGCTAATTAGGCTTATCAAGCTAA
TCAAATTAAGAATAAGGACGATTGGTTAATAGTATTAAAATGACATTAAGCTTTAATACA
CTTAAACCTAATTACACTTCACTTTGATTACTTTACCAATTTGAAAATAATTTCTTATTA
AAATATGCACTTAATAATGCATCTCAGTGCTCTGGTGTGGTTTATATCATTCCTGCCATC
CGCATCTTTCGCTTTCTACGCGTTGAGCCGTGGGACAAGGTCGTGCCGTCGGCTGTCGGC
GCTAGAAATATTATGGCTAACCGAGAGATAAAGTATATATGTATCTGTATCTGTAGCTGT
AGCTGTGCCGCACTGCACAGGTCTTTGCGGCCCACTGAGTCTGTGCCCCGTGCGTTTGTG
ACGCGCTTTTTGCCATTGACACGCAATAAAAATATGTGCTCGAAATTTTTAAAAACTCAT
AATAATCACATTAAAGATTTGATGATATATATATAGGGTATCTGCTGTTGCTGATTATAA
AATAATATAATATAAATATACGATATTGATAACTTTAAGAAATATAATTAAATTTGAACA
CAAAGGAACTTTCGAATTAGGTGTAAATGCGAAAGAAGCTCGTCACGAAGTTCTTGCACA
GCGGACAGTAATGCAATTGATTCAAGGCGGTGGTCAGGCATTCCTTGCAGAAGATATGGC
CGCACGTGGTGGCCACCGGATGATCGGGAAGACTCATGCAGATGGGGCAAAGGTAATGGC
CATTGTTTCTATCGGATAGGAGCCTCAAGACTGGCCGTTCCTCATCATCTGTGGTCAAGT
CAACGGTCTCCAGCGTCTTCATTCCGTCCCCTGCTCGACGCAGTCCCTCCATTTTCAGTG
GTTTCCAGCGCAACAGACTGTGCCAGGATGGAAACATATGTTCACTTTTTGCAAATGTCC
TTATACCTTATATATGGGCACACAATATAAGATTGAATTAGAACTCAAAGGTTCCTTGAA
GTCTAAAACTTTCACTTTGACATCCCGAATTTTAGTTACTTTACTTAGTAATGGAATTGT
GAAAATTTTAGAGACAGTTTAGCCAGATGTAAATGTAGAAATATAAACAATGGCAGAGTC
CAAAAATACTGTGCGATGATTGGTTTTTAAAAAAGAGAAAGCAAAGTGAAATGCGTGGGG
GAAACGGTGAACGCTTTTCTTCTCATCTTCTGTTTTCCTGACGCCGAAGAAAGCATTTTT
ATTTAAATTCATACGAATATACGTACGGGCAAATACGTGTGTAGTATTTAATAAATTATT
AATTTTTGCTACGCTCTTGCCGCTCAAACATCACATGAATCGTCTATTTGGTCGGGCCAA
TAAATGTCTATTATATAAATGGAAAATATTTACGCAGATTGAGCTTTATATGTGTGTGTG
TCATCGAAAATAATATTTCTAATATTTCGATCGAACATTCATATTATTTCTCTAATTAAT
GTCTTTTTCTTGGGAATATTATTCGATCACGCCTTATTTTGGAACTCGTGCTACCTTTGC
AAACATTTTTGACAGAATTTCGAAAGCAATCCACTAGGGTCAGTGGTTCAAAAATCACTT
GAGAAGAAGTCGGTTTCAACCAGTTTTCGAATATAGTCTAGACGCTGTTTTTTTTGTTGT
TTATACTAGATACACGTGATGATGTTTTCGCCATTGAGCTTTCTCTTGAAATGCTTTTGT
TATTGTCCCCGCCAGTCTAGAAAATGTTCTTTCACTTTTATTTTACTGCTCTCGTATTAA
GTAAATGTGACTTTTGAGCGCATAAAATGACAATTTGTTTGTTTACCTACGGAAAAATTG
CAATCATAAGTGTGGCCACTTATTGTGATGATTGCGTATTGATTTATAAAATTCGTAATA
TTAAAGCCACTTAATCAATCTTTCGCAAGCGGTTGCTTTGCAATTTATAGCTCTATCCTA
AGGATAAACAAATCAAATGGCAGGCAATTGATCACTGAAATTCAATGGATTTCCTTTGCT
AATATCCGCTTCCTGAAAGCGAAAAAAACTCGACTAATTATTTCACTCAACGCAACTTAA
AGTTGACGTCAGGTGCCGCAGCCGACAGAATTTTCCTCATTTAGCTTGCAATGCAAATAT
TATTATTAGCATTACTTACAATTATTTACGAGCGTTTTCAGTGTTCCGTGAACACATATT
ACAGACCCAAGACCACATGAGAGATATTAAACAGCAATTGTTTGGCCAGCAGTATTTTAC
CATTCGCACAAGTACAAAGCTCCATTATTCGATCGTTTTTTTTTTTTGATCTGAACCCCG
AATAAATGGCCCACTTAATATGTATATTTAATTCGTATATCATAACCTTCGGCGGGGGCA
AACTATTCAGATATTATTTATGGAGTCTGCTCCATTGCACATTATTCATTTCGGAACATT
CCTGCCAGATTTTGCCATCGATCTACTAGAGCTGTGATAAATGATTTTACGTAGGCACTT
GCCTTGACCTTACCTTGAAAATTGTCAGCTACATGAATTTTTTACACGATCTGCTCAGTT
TTTTTTTTTTTTTTTTTGTTTCCATTCATTTTCGTTTGCGCGTAATTACAGATTTGTTCG
CCACACAGGAGGCTATTTTAAGTATTTTACTCTCGCATTTAATGTGAAATAAAGGCGAGC
AAATTAAATAAATCGTAAAGGCGGAACTATTAAAATAAATTATGAAAACAGTGCCGTGGG
CGGCGACTTGCGGCACTCACTGTTTTGCCCTCGCCCCAAAAGTTCCCTTTCACCTCTTGG
ACGCACATAGGCGGCATATTAACCCTGGCATGTGGACCACTCAAGCGCCACTCAGCGTGA
AGGAGCTGCCTGTCTCTGCCTTGATCCTTGCATCCTGGCCAGCAGCTCGCCACCTGCCGC
TGCTCGTGATGGTCATGTGCGCAAATCTCCAAGAGCAGCTGCCTCGGTTTTCTTGGATTC
GTTCGTGGTCCTCTAGAGTGCTGTCATATATCAATGTTTTTCGTGGTCTGGTTGGGAGGG
GCGTGTACACGCCTACTTTTCTAAAAATATTCTCCGTGGCCAAGAGATAAGGGTGAAAGC
GAATTGAATGGATTTAAACGTGTTTTAATAAATACGAAAAAGAAAATATACAAAATTCGC
ATTAAGACGTAGGATCTAGACATAAAAAAAAGATCTCTTAATATTATTTATTTTATTTCG
GGTTTTTGTTGTTTCGCCGTTATACATTAAACACCTACTATATGTATTTAATTTTATTTC
ATTCTGTTTATTTTGGTTTTTGTTGCCTTTGGTCTGGCTTGTGGGCGCAGCGGAAATTTT
CTTTCAAGTCGTTAATTTTTATTGAATTGTTGTATAATATGTTATATTCTGCTTACGAAA
ACTTGTTCGACAGGGAGTGGAGCAAGTGTATTGGACGAGCCTGAAAATAAATATTAGGAA
TTTTTCCAAAACACGGCAGTACAAAGTATTTGGATTTGTTAGCCAAAATGTTGCCGATTA
ACGGCTTCCCTTTTTGCTAATTTATAAATAATAAATCCATTCCTTCCGTATTAATTATTT
TCATTTTTAAAAGCGGGAAAAAAGAAAACTCCAAGAACAACCCCATTGTTTTTTTCCCCT
TCTAGTACTTACAAAAAATACTATCTTGACCCAATTTCAAGTGCTGTTGTAAACAGCCAT
TAGGTATACAAAAAAGTACGCATATATATATATAAAGAGATTGGATTAAATTTTTCCATT
GGGAAACGGAAGTGTGGCAGCAGATTGTCGTAGGTCCCCCAACCCTATGGACTTTCCGAC
TTTTCCAAGTTGCCGTAGGTCCTGAAAATCAACTCAAGTTTTTCCGCCCACATCAAAGCG
CGGGGCATTAAGCGAACCAGTTGCGTTGATTGGGCAATCAGATTGGATCAATTGTTTGAA
ATACTCTATATGGGGCTGGCCGAGCAGCTGGGGGGGATTGTCCGGTCGATGGTCCCTAGT
CAGTAGTGGTCTCCGGTCCCCAGTCTCTGGTCTCTGGTTTGTGGTCTCCAGACTGCCGAC
GCCTAGCCCGGGCAATTCATCATGGCTGGCTGGATTGGCGCTGGTCTAAAAGTGTTTGCG
TTTATTTTGTAATAATAGGCAACTTACAATCCGATGGAGACCCAGTGGCAGCCTCGCCGG
CCCGAGAGTGGGGCTATATCTGTGCCTGTATGTGGCACGCCGACCGACAACGACTTGCCG
ATTGACGTCAGCAATGCCCCCAAAGTCGCGCACGGTGTCGGGCGGGTTGCCAAGCAGGCG
GGAACCGGGACACCAGTCGCTGGTGGAGACCGTCGACCGTTGTGGATGCGAGGAAGGGGG
TTAGGTGGGTAGGTGGGTAGGTGGGTAGGTGGGTAGGTGGGAATGGGGGGCTCGAGGATT
GGCGGGTATCGGTACGGCATTTTGTCAGTCACTCATACGAGAGTTGGATGCTGTTCGATG
CCGGGCTCATCTGCTCTGCTCTTCGCCCAAGGCGAGCGTATTGATTCTCTGGAAGCCCTC
GAGTTCTTAAGAGCTTCAGACGCTGTCTTTATCATTAAACAAAAAATTATTATAAAAATT
ATACCATATGAACAATTTCTGGGAACACAAAGCTAATTATCATTGGTAGATTATAAAGTA
TATTTCATAGACTTGTGCTTATGAATACATGCAAGCTGCGTTTTGCATATGAATACTTAA
CACAAGGATCACAAGGACATAAAAACTTAGGTAAAATCTTTTTATTTACATATGATTTAA
TATGGATTATATATATGATTTCTAACTTGTTAAGTGCATTGGCAAGTCGCCTATAATGCT
GACAAATATTTTTCCTTTGGCAGGTTGCGTCTCCTGGCGCCTTTGTTGCAATTGCATTTC
ACATTTCAGTGCGGAACGAGCGTTCACATGGATATTTGTTTATTTTGAGCCACTGTTTAT
ACGACTCCCCCTTTGCCGGCAGATGATTTTCACGGAAATTCTGACTTCTACTATATATTT
AGCCCAGCGAAATGCATCTGCGGGAATGCCTGCTGACCCTTCTTTTTTTGGCTCATTTGT
TTGTTCGGCTATTTTTGGGCGTGCAAAGTGTTTCTGCCGCAATGAGAATATCAAGATGAA
ATGGCCATATCATTTGGATTTAGTGCGGCAGGAGGCGGTCTGAAAATCGGTGGGAAAGTG
AAAGTTTGATTTATGGGCACACGCAGGTCGCCGAGACTTTCGTTCGTCTGTTTGATGGTT
TCGTACCATTTATAAATTAGTCTTACCATATCTTCGGGTTGGTCAAAAAGTTTAGTTATC
GCTTTTGAGGGATCTCTCTGCGGTTGGACATAAGCCAATTACCTCTGGAACGGAAATAGA
AACTGACAGAAAAGAAAAAACCGAAAGAATAGCCAAAAACTCAGACTTGTTGCTGCCAAA
AAGCACTTTTCAATCTAATGTCTTTACTTTTTTTTTGGGGGTTAATGGGGTACAGAACAC
AGCATACTTGACCCCTCATAATAGATTCAACATCCTGTTACAATAATTCAGCAAAAAAAA
TAAAAAGATAAAAAGATTTAAGATGCGAAACCATAGTCAATAAAAAGTCAAAAGTCATAA
CATTTTTTTATTTATATTATTATATTTATTTGCCCTTCTGTGTAAATGTTTCAGGATTTG
TCTCTTATAGATTTTGCGAAATTAAGCAGCTCATTTAATAGTGTAAATCAGGCAAATTTA
GCAAAATGTCCCGTAACTATTTATACTTGATCTTCACAGCAGTACTGATGCATATATTTG
GACCCACCTTGAATGGCGTTCATAAATTTCTCGACCAAAAATGCATTTCTCGCATGCCTG
GGCCCAAAATATTTTCTAATAGTAATTTGTCTTATTTTCAAATAGATGTAATTACTAATT
CGGGGATTCTCCGCCATTCCAGTGACACCAAATGAAATACGAGCAAGAGTCACGATTTTA
ATCGCTGAGAGTATAAATGAAAATTTAGTGTCAAAAACAATTCGCGCGAAAATTGTGAAC
AAAAACAAATCAAGAGAATCACATCACGCCCTATAAATGTTTTGATTTTCCAGCTAACGC
ATTCTATATGCAAACGATGTGTGTCTGTCCCCGTGCCATTCGGCTGCAAATCAAATGATT
TTCCGCGTTTTCCCCGACTATAAATGATAGCCAGTGGAGGTGGGAGTGTTGCGGCTGGCA
CTACGCAGATTGCGGATACCAAAAATCGGAGCAATCGTTCGTCTGCAGTGACTAACTGCT
GACGTCTTTGCCGCCCGGCCCGTATATATCTGTATCTGTATCTGTATCTATATATCTATC
TATTTATCTATATAACTCACATCGAAGACAGTCCAGGCCAGCCCAACCCAGCCCAGCCCG
TCGATCTACGCAAATTGTGCACTAACTTTGTCACAGACAATTTGGCGACGACATCGTCTA
TTTCTCAGTCTTGGTCTTGGTCGTGGGCGTGGGCGACTCCTTCTCGTTATGAAGGAGGGC
TGTAAAACGCTTTTCTATGTTCCGCTGACCGATAAATTAATAATTCGCATTGTGGAACAA
CAAATGGACACATAAAAGCAACCGGAGGAGCACATCAAAAGCTGGCAGTAAATCATAGAA
ACCAAATGAACAAAAATAAATCCAATTAAAGATGCTCAGAGTGACACAACATTGTGTTTA
ATTTGTGGTTAGTTAAGTTGAGGTGTGAATACGTATAAGGTGTTGCCATGGGCGGGAGAC
TCAATTATATTTCTATTGAGGCCTGATTATGACGTATCTATTATGGTTTTCTAACCTTGA
GATTCAAACTATTCGTTATTGGTTTGGTAGGTTTATAATGATTAAGAAGTAATTTATTGT
TATGTTCAAGAGATCAAGTTGATTAAATATAAGATTTGAGATACTAAGGATTGGGGTGAA
TATTTAAACAAAATATGTATAATGATCCTAGTTTTGTTAAACTAATTTCTTCGTTTTCTT
CTTGATCTTGCAGAGAAACGCTCATTCTCCTTCCGGCTGCGTCGATCCTTCGGCGACGGT
GGTAGCACCAACAGCCGCAATAGCAACAACAACAGCAGCACCTGCACCAACCACAACAAC
CAGAAGCGATGCAGCACTCCGCTGACGCCGACGAGCACCAGCACGGGTCGACTGGAGGTG
CCTGGAGCGGCCAGCGTGAGCCGCCGGAGCAGCATCTACAAGAAGCCGGACAAGAATGAC
GGCGGACAGATCCATCTCATTCCGGACGTGGAGCTGCCGCTGATGACCTTCGCCGACCAG
TACAACATAGAGAAGACGCTGGCCGAGGGCTGTTTCGCCAAGATACTGCTGTGCCGGCAT
AGACCCACCAATACGCTGGTGGTGCTGAAGGCGGTGCACGCCGAGCTGACCACGATCAAG
GAGTTCCAGAAGGAGTTCCACTACAACTACGAGCTGTCGCATCACCATCACATACTGAGC
GCATATGCGGTGGCTTTCCAGACAATGGACTACTACGTGTTCGCCATGGAGCACGCCCCC
TACGGCGATCTGGCCTCCAACATCGGACCCAACGGCCTGCACGAGAACGCCTGCAAACTG
ATCTCGGAGCAGTTGAGCTCCGCCCTCGGCTTCATGCACTCCAAGAATCTGGTGCATCGC
GACCTGAAGATCGAAAATATCCTGGTCTTCACGCCGGACTTTACGCGCGTGAAGCTGTGC
GACTTTGGGGCCACCACGAAGAAGGGTCTGCTGGTGCACAAGGTGAAGCACACGTGGACC
AGCTGCGTGCCGCCGGAGCAGCTGGAGCTGATCAAGAACGAACGCTTCCAGTGCCTGCCC
GTCAGCGATTCCTGGCAGTTCGGCATCCTGCTGTACAACATCCTCACCGGCAATCCTCCA
TGGCAGTCGGCCGATTGGGTGAAGGACCAGTCCTATGCCAACTTCATGAAGTACGAGCAG
CGCAAGACCACCAAAGTGCCGGACAATTTCCGGCGCTTCTCGCCGCGGCTGATGCGCTGC
TTCCGGAAGTATCTGAGCCACGATCCCGAGGACCGCTGCAAGATCACCGAGGTGGCCAAG
TATATGAAGGACCGCTGGGTGGAGTGTCGCATCTCCACCTCCAAGTCGGCCACCCTCATC
TCGCCCACCAATCACGACCAGGACTCCTGCATCTACCTCAACCAGCGGGAGGGTCGTCTC
TCCGGGGATGAGAACAAGCTGCGCTTCAAGCGGATGATGTCCACCTACGGTCTGGATATA
CCCATCGACCAGGCGATGGTGCGGCGGCGGGTATGGGACTGGCTCTCCACCTGCGACGCC
AACTTTGATCCGGACGTGGAGAGTCTGCACGCACTGGATCTGTTGCAGTAGATTAAGATA
AATCTCTAGCAAAGAAATCCCCCCGAGCAAACGGAAAACATAAATATCCTTAGAAACAAT
TTTGGATTTTTCCAAAGATTTTTGAAAACAAAAAAAAAAAAAAAACAATGAAATCGCTGT
GTAAATAAGACGATATCGCCCAATTAGAAAGCGGAACAGGGATGTATATCATCATCCTGA
ACGGAAACGGTTTGAATTTGTGGATCTATAAGATCGTTTTTGCAGAGCAGAGAAGTCACT
GCTCGACGGTTTTTTCTGTTGTTCTGCGAGTGCAAATTGCCAGAACTGAAATTAAGTATA
ACTTTATATAGATGAATTTTGGTAAAACTAAGTAGTAAGAATTTATAGGATAATACAATA
AATCCCGGAGATCAAAAAAGAAAAAAAAAAAAAAACAAAACACGTCAACGGATAACTTTC
CAGTAGTGTTACCCTTCTAGTCTTCCGCTCGATGATTTTCGTAATACTCTCTATGTGTGT
ATGGATGTAGTTTTTTAAGTGTACTATAAATAATGTGTGATTTACGCGTTACTTATTTTA
TGTGTCCGGGATACAAACTACTGCAATTATCTAGAAATATACGTTAAAGATATGTAAGGA
GTGCCCCTGGCGCATTCACGACCAATTATTAGATCGTTAAGAATTGTTTTATATCTGTCA
TAGACTATATGTGTATTTATGTAGTTATCTCTATAATGATCCCACACTGAAACGATTTTG
TACATACTTTTTTTTAGTTGCATACGACTGTCAAAATGATACTTATATGTCTTTACCAGT
TAATACCCTATGTATACCTATAAAATGCTAAAAATATATAGTGCCGTAAACTGAGTTTAT
TTAAAAAACGATTCTTTCAATATACTCGTTAACAAGTGGAATCCAGTTTCCACATTTTAC
CACATGTTCATTAGAGATTTTGCCAAACAAATATGCTCATAATCTCCATGCGAGATTGGC
AAAACAATGCGGCTTCTGGAGAAGCCACCTACAACTAATGGTAAATATTTGTTATTCGAA
TTTAAAAATATTTATTGCTGTTTATATCGAGCTGGTTGTTTGGCTAATTACTCTTTGTTG
TTCGCGAAGGTCACTCAGATGATTTGCTTCGACATTGAATGTCACGGTTTCCACGAAACA
GAAGCCGGTGGAAAACAATCCGGTCGCGTCCAGCGATTGTTTGTCCAGTTCGCACTGTTT
GCTGTGGACGTGGACAGGATGTGACGCCCCTGCCATTCCGTAATTTGGTCTGTGATAAAC
ATGCGCTAAGGTTAATTCAACAAAGGTGAGGTTACGCCGTGTTCTGGGTGGGCGGACATT
CACATTGTTTGCACTACGCGCTCCACGTAATGCCGTTTAATGGTTCCATTCGGGCAGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1522, 12433..14179
1510..1522, 12433..13787
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved