Drosophila_melanogaster Locus CG31647
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG31647
Drosophila_melanogaster
CG31647
2L
snoRNA:Me28S-A2486
2529..2644
5699
GTGTGTTGTCGTTGCTGTGGACTTTTTGATGTATCGTGCTGGGCTTGGGATTTTTTTTT
TATGTTTGTGCCGTGTTTTACGCACCACTGACTGCCATTAATTTTAATTTGTGCGTCAAA
CTCAAACGCAAAACGCCTTCGTCTCTCGTTGACTTTACCGCTGGACAGTGGGCGAAAGTG
AGATGGAAATAAAACACAAAAGAGATGGGTATAGAAACTGACTGGGGGTGGGGGAGGGAA
AAAACAATTGCACACAATCATTTTCAATTTAATGTCATTATGTGCAATTTGTCAACAATG
TCCACAAAGCAGTCAGTCAGCCGTGTGCCTGTGATTTGCCTAAAAGCCAAGGGCGTAGTA
AAGGGGTGGAAAAGTATAAAGTATTTGCATTTTTCTTATTTTCTTTTCTTTTAATATAGT
TATAACACATTTTCGATTTTCAATAAGAGTATCGACTGGCTGTTAAATAAACTTATTTCT
TACAATCTTTGTTATATATTGTTTGAATAGTTAGAATACCCTCTTCAATTAGTTTCCTAC
CTTCCCCACTGGAAATATGCAAATGACAACCGGTAGCTCTTCCTGACTGAAGTCAAATGG
AACACCTCCCCATTTCGATTGGCTAAGCCCATCCCCCCTCCATTTGGGCATTGTTTATTT
ATACGGCTACTTTTTGTGCATCCGACGAATTCGTGACGAAAAGTGATTGAAAGTAAACAA
TAAAAGCGACACTCGCCTGTCACTTTCCACTTGGAAATCCACCTCCACTCTCGACTTCCA
GGCGAACAATCTAACCATCGGCGAATTTCTTTCGCTTTTTTTTGGGGGGGCCACTTGACT
CGCGGCCTTTCATTTGGCTAACAATTTCTACTTTGCGTTTTTTCCATCCGCCTGCTAAAT
TGGCCAATTGCGATTGGTAACAGCCGCGGCCGACATGCCAAACAATTTAATTCAATTAAA
TATTTTTTCGTTGACTGCCTGTCGTTTGTTATTTAGCGACAGTTGTTGCCTTCGCGGCAA
TTGTTTTATGTGAAATTTGTCACACTGTCATGTGCGTTATATAAGAAAAGTTTGGGGGGA
AAAACGGGCCACCAGGTGGACAATGGACAATTTGCGCCACTTGAATTATTCAAAATTTCA
GTGGAAAATGGCGAGAAAATTAGCTCTGGTTCGGGAAATGGTTTAAAAATTCATTACCAA
TTCCGGGTAAATTGGCGACAGTTGAAAGGGCTGAGATTTAAATTGGCCAAGCAGCTGGTT
TTTCTCTGCTCAGTTCTCAGTTCAGGGAAAGAAATTAATTTCGGCTCAAATGGTTTTCAA
AAGTAATCGAACCTTGAACTAAATGGTGCTTTCGGGAATGTCAGATATTAAATTAAAAAT
AATATTAATTTCAGCTAATGCTATACTTATTGAATCTCATTAGGTTTCTTCCGTTCTCCT
TTCCCGACCCTTCGAGCCCGCATCTCAAATCATTCATGGTTGTTCATCCCAAAATTAAAT
TTCCGATTTGCCATCAGACTATTCGGCTCAAAAAAAAAAAAGGTTCCTAAGTCTAAGGCA
AATCAACCTCTTGACTTCCAAGTAAAAACACCTGTGGTGTCAATATTTCAACACTGCCAG
CGGTGTTGAAGCTCTCTGTCTCCGATTTTTTGTGTATTTTCGTGACTCTCAACTGGGAAT
TTCTCTTTTTTGTGTGTCGAACAGATTTCTGATTTATTGATTGAATTGAATTAATCAACA
AACTTATGAGTCAATACACTGTTTAAACACAGCCAGACAACAGGCAGAATAAAGCGAATG
CAAATTAATCATATGCCCAGATCCCGATCGTCGTCGATTCGATCGGTGAAGTCTGCTGCT
GTTTCCCATTTCCTCTGACGCCACCTTTCCCCCTTCGAATAATAATGACGATGATGGTAA
TGATGACGAACTAACTGACAGTTGTTTGACATGCCCCAGTCAGTTTCATTCGAATCGACG
GGGAGAGAAACAATTAAGTGACGCCAGCCAGCAAACAAGTTGTTATTTTTTATGGAAATG
CAAAACGGCAAAGTAAGGAGAAAGATCAAAACACCTCGAGGCAAGTGGGTGCAGCATATG
GCCCGTAATTAAAAGGTTAACTTGATGTAACTATTACGTTGGCAAATGCACTGCAAGGAA
ATTTCATGTACGTGCTATTTGGAGTTGCCACAGAAACTGCCGCAATTCAATGCCCCTTTC
GACTTGCATGCTGTTGGCTGTCATCTTTGACATTTGTACATTGTAAATGTTGACACTTTA
CCACACACAGGCATCGGGGAATGATCTTGTTACACTTACATGAATGATCACCACAAATTG
GCATGAGGAAGCCGGAGAATTGTCGCCCAGCCAGCAGCAGCTTTCCCGGCACCGCTCGTT
TTCCTCGGGGAGTTTTCATTGACACCTCCGACCGCCGCAAGTTTTCCTCCGGCCAAACTC
GATTCACGCAAGACCGATGAGGCCCGCTTTTATTTTTAGGTGCGATCGTGAATGACTTAC
CGTCTGAATGAGTGAATGATGAGCAAATTTATCGCGGCATTGTGTCAAACTGTTTTTGGT
TTTCGGCTCTCGGTTGGCCATGTGTGTGGGCCCGACACCATCAGGCGATCAGACGATCTG
ACGATCGTACCCCACCATTCCTTCAGATACGGCATATATGTATGTGGATCTGTGTGTATA
TATGTACATACATAGCTCCTCCAGCTTGTTCTGCTTTGTCTGACAAGCGTTTAATTATTT
TGGCTTGATTGCCTACTCCGACTCCTTATATAGCCGCCGATTCATTCATGTCGTGCGATG
TTGTAAGTTGGGTGGCAGTGTCGCATCATTGACACGATACCAGCTGCTGTAAGTGGATGT
TGCAACATCTGTATCTGTAAAGGTGAACACATATGAGCTCTGCCAAAATATCATATCCCT
CGAACTTTGTTTTATGTTTCTCTGAAAACTTTGGGAGGTTGGAAAATGGAAATTTTACAA
GAAATACAGGGAGCTTTCTATAAATATTTTAATGAGATCGAATATGAGGAGGTTACCATA
TTTGCAATTATTATTAAAAATTTCAGTGCCCAAATTGTTTTGCACATACATATTTGGAGG
CAATTATTTTTCTCACGTTCTCAGATCGATTGGTTCATCGCCGCCGTCTTTTTCCAGGGG
CAGCTCCTTCAAAGTTTAGCCGCCAACGCCCACAAATATGTGGACCCTCCCATGATTGAT
GGGCATCTTGCGTACAAATTAACACCGGAATTACTCCTCGTGCACTGCAGGCCAAGTTCG
GCGAACTTCCAACGATTTTCGACTCCACCCCAAACCCAAAAAAAAAAAGACATAACAAAA
AAAGTAACGAAAAAGGAAGATGCGTTTTGGCCCATTTCAAATGAAGCCGACTTTCAATTA
GGCAAAAACTTGGCAGCAAACCAAAAACAAAAGCAAGCTAATGAGACGACGACTGAGTTT
GGCCGGAGGTGCGATCGTGACTTCGAATGCGAGTGAGTCATGCGGCAAGTTAATTATGAG
TATGCAACTAAATCATTACATTTTAAGCCAGTGTCAAAGGCGCAGCTGGATATTCTGATT
AATCGCCATGAGCCAGATCCTAGCTGCCTTTTATTAATTACGATCCAGCTCCAGATCGAG
TGCGTATATGGATGTGGACATGGATGTGGATGTGGATATGGACATGGATGTGAATGTCTC
GGGGAGACGCGTGCTCAAGGCGTGAATACCATCGTCAACAAGCTAGCACCTCTCGCTCTG
AATTATTGCTGAAATATTTGCTGATTTATTGGCACCAACTCGCTTGTTGCACTTGGCACG
CCATGTGCGTGTTTTTTTTTAGCGAGACCCAAAGAGATCACTGGGAAAAAAGACAGCTCA
GTTCCCAGTCCTTTGAATTAGATAAATATATTGAAAAGAAAAAAACTTCAGCGGAAATTG
TATTAAGTATGATGTGATCAGTTAAATATGAAGTATACGTATTCATAATAGTTAAGTTTT
ACATTTTGTTTTAAAACATGCTTCATAACATCATTATTATTTTTTAACAATATCTCCCCC
TTGCTAACAATTATTTCACTTACTACACCATAATAGCTTTTTCAGTGCCCATGCAACCTT
GTTGCAATTAGTTTTTGCATCACCACCCAGCGAGTAACGAGTAACCGTGGCGTATCATCT
TACCTTTTGGGCCAACCTTGAACTGGCCAAGACAGAGGCCCTAAATCTGGCTCTTTTCAG
CTCTTCAGCCTTTCAGCTCTCCAGTGAGCCACATGACGCGACTTGGCAGCAACTGCAGCT
CATCTCGGTTCAGTTCGGGCAGACTTCCGTGTAATTAAGTGGCGTTCACAATGCGCTCCA
CCACCCATTGTGTGCTGGATTTCAGACAGAACCAGGATCCTCCCTTCACCAGCCCCATCT
CCTTGGCCATGATCTCGTGCCCCACAGATGGCCCCACAAGCAAATTCTTTGTGAAGGCCC
AGACAAGCGAATGCACATGACTTCAACGAGGAGACGTCGTCGCAAACTGGATTTGGGCGC
CAGTTAGGCACAATGGGTAGGATGTCTCTAACGCAGAGTCTTCGAAGTTTATAATACACT
GAAATTTGGAATATTTATGGTATATACATAGTCTAAATACAAATAAGCTTAAAATGTGAT
GTAGCTCCTAATATTTGAAATTCGAAACAATCTATTTCTAAAAATCCGTACTCAATATTC
TATTTAGCCCTTTGGCAGTTTAAGGAAATACTTTAACCATTTAGATAGTTGGCCAGCTAA
GTCAACCTCATGACATAGTCATTCGACCATAGTTGAAAGCCAGGGAAAATATGATAAATT
GGGCGCTAACTCCACAACTGAAGGCAGCTCCTTCTCTGACAAAATCTACTGGCCATTCTA
TGACCAAAGTCCTGCTCCGGCTCCATGGCCACATCTTGAATGCCAGTGCCACCGTAATTT
GAGGCCATTGCGGAGCATGACCATGGCAACGAAATAAAGTTGTCAGCTGCTCCTTTGCCG
CAAAATGCAAATGATGGCCATAGCCCGTTTTGGCCACAGTCTGCTGTTAATTTTTGGTAC
GTGTCTTGCAAATTGGACTATCGTGGCCTGGTGAAAAGTTTCTAGAATTTCAATGCCGTT
TAATCGATGTGGTGGCATCCACGAATCTCCGTCAACCGGTTGCCACACACTCGGTGGCTC
TGCGGAAGCAGTTAATGTTAATGAAACGGGTTTGGATCCGGACAAGAGGAGGTGTCCTGT
TTGGTTAAACTATTCAAAAACTCTCGGGGTGATCGAAGTGGGTCACTTGGAAATCGATAT
TAATGTGATTTGTTCTGGACATGCAGTGAACAACTTTATTCTGCAGTAACTGGGTCAGGC
TCCAAGTGGGTACTCTTAGTAGTTATACGTATAGAGTTAATTAAAAAATAGCAGCTTAAA
TATGTATATCCTTTTAAAATTTTTATAGTCGAAAATGTAACTGCATTTTGAAAAAGTCCA
CAGAAACAAGATCTCAACATGTCATATGGGCAGCTCATTAACGCCAAAGCCAGCGTAATT
TAGTTTTAACCCTTTGACAACCAAGTGCATGTGTACTTGGCACTTTTATTGATATAGCTT
CTATCGATTGCCCGCCATAAAATCGATCATTAGCGCTGTTAATTTGCAGCAACAAAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 3177..3511, 3567..4699
3231..3511, 3567..3594
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved