Drosophila_melanogaster Locus Msp-300
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Msp-300
Drosophila_melanogaster
Msp-300
2L
snoRNA:Psi28S-2263, snoRNA:Psi18S-525k
79633..79777, 94238..94377
98545
TTGTAAAATTGTATTCCATTTAGGTGGAGCCCCAAATATTTCTCCAAGAAATACCTCAC
CCCCTAAAAATAGCCGGCTACTGCGCCACTGACCCCAAACAACAACAAAAGCAGTCGTTC
AAAAACGGAGAGTACGTGGTAAACAACATCCATCAAAAAGTGGTACGAAATATTGCGTAT
ACTCCCGTTTTGAGTCTCTGATTCTCTCTCGGATTTTCGACCACATCACTCCAAGACTCT
CTCTCTCTCTCTCTTGTCTTTCAAGTGAAATACCAACACACATTGGGTAGCACAGACTCT
GAGCTTTACTACGATTACTATACAGCTCTTCTCTCGCGACTTTTTGGACTGGACAAGGCG
TAGCACATTGAACGGCAGTGGGTTTGGGTTTAGTATCGAACCGGCTTTCTACGACAGCGG
ATTGGAAGCGCGGAGCGACAAAGTCGCCGGGTAATAATGTGATATAGCCGGCTATGTTCA
GCAGGCAAAACTGAAATAAAAGTAATAAACACCGAAAGCCCCCGAATTCTCGCATCTTTT
TTTGTGGGACTGCGAGAAGAATTGCGAGCGAAATACTAATTTCCTTACCTAACTGCGTGA
GATAATCTCCGGTTGGCATTGTGTGTCGCGCAATAAAATCCCCAAAAGCCCAAAGCTTCA
AGTGTTTAATATAATAAAATAGCCAAGAAGCGTGTGTATTTGCATTTGGGAAAAATTTAA
GGTTGAATTACGTGGGCCGAAAAATTAAAGACTGAAGGCCATTCAAGGGTTGTTCAAAGA
GAAAATTCGGTGAAAAGTCACCGTGTGTGTGTGTGTGAGTGTGTGTGCGTTGCGTGAGAA
AAATCAATTCTGCATTTGGTGGAAAGCCGAAAACGGAGAGAAAATTGGTGGAGCGAGGAG
AAAAGGACACGAATTAAAGGCTGGTTTTTTGGGGCTGCGAAAAACTCGTGACCGATGACA
ATTTGGCTTGACGAGGGTCTATTAGCGAAATCAATGCTATTATGGCTGATAGTGGAGGAC
CAGGATCCAAGCACATGGATCCAACAACCATAGATGCCGGCGGGGGCGGAGCAGGAGCAG
CCGGAGGTGATGACGTGCCTCCAGTCCCAGCTGTTCGCCGGCGTCGTGCGCATGAGCAGA
AATCCTCGAGAGAGCAGGTGCTGGAGGAGGAGAAGAGCCAACAGCTGGAGACATCGACGG
TGACGAGGACCTACATGAAGACCATCACCACCTCCCTCACCACCTCGAGTAGCTCCAACG
TGGAAGAGTTTATCCTGGGGGAGCACGCAGCAGGAGCAGCAGCTGCTCCATCGCCCAACC
AGCAGCGATTGCGTCAAAAGGTGGCCCAGTACGAGAAGGTCTGGTCGGATGGCTCCAGTC
CCGTTAAGCGTCCAGCCGAGCAGAGCTCTGATGAGCTGCGTCTGACCGACGACCAGGATG
AGTACGATGCCGAGAATCCATTCGAGATCGATGTCCATGAGATTGAGCGCCGCCTTCGCC
AGGAGAGGCAACGTGGCTTGGCCGAGGCGGAGGCAGCCAAGCTGGCCTTTCAGCAGGTCC
AGCTGCGGCACACAACTCCGCCGCGTCGTGTGGAGGTAACCAGTGACCAGGTGGCGAGTC
CCTTCAATGTGACCCTGCGCACCACCAGTCGCATGAGTCCCGGTGCCGAGCACGGAAATG
TCGAGGAACATCTGGCGCCATTCAATGTGACCCTAAGAACCACTCGAAGGACCAAGAAGA
AGGAGTTCAAGGAACTGGAAAACTTTCTGGAGGGCGAACGAACCGTAAGGGAGGTGCCGT
CTGCAGACGGTGTTAGGACCATTATCACCTCCTCGATGACCAGCGATGGCGGCTATGCCG
AGGAGAAGATCTATCGCCACGGCGAGGGCTATGTATCCCCAAGGGATTCGCCGTCCTGGT
CGCGTTCCAGTTACTCCAGCGAGCGATCCAGTGTTACGCCACCGAGGAGCGTGGATCTAA
CCGCCGGCGGACGAAGGATTCTGATCAAACTGGAGCAGGAAAGCGAACTAACCGAGGAGA
ATCAGACGAGGGACGAGACCGACCTGTCGTTCGGTCGGCAGGAAGTGGCCATGGCAACCG
GCAACATTGACATTACCGTCGGCGGTAGCAACCCCCGCCGGCGTTTGTACCAGCAAACAA
CTGTCCAGGTGGGTGGCGGCAACCGCACCAGCCCTCAGGACTCAACACCCCAAAGACCAA
GGGACTTAGACCTGGCCGGCACCACGAAGACAATGCTAACATCCACGCCAATTGGCACGA
AGGAGCAACCGCAAACGGGTCCGAAAACTCTAGTTAGTCCAGCTGCAACGTGCCAATTGC
GCGGTTCTTCGACGGAAGAGCCCCGGAAAATTGTAAGCCACAAAACGATAACCAGCACAA
CGACCAAGTCCACCTCATCCTCGACCTCCGCCACCTCCTCATCGTCCACGTCGCGCAAAT
TAATCGAAACGTCGCCGGTGGTCGTCGGAAAAATCGCGCAAATACGCACCGGGAAATCTA
ACGCCAGTGACAACGATATCGACATCGATAACGATTCGGACACGGAGGGCAGACCCGCCA
GCAGTATAGTGATTGTGTCCACGCCCACGCGTCCCACCACACCGGCAACCGCATCCGTAT
CCGCATCCGCAGTAACCCCATCCGCATCCATATCCGCAACAGCTGCCCACGCCCTCAGTG
GCATCGGCACTTTCAGCAAGAGTCTGCGCCAGGATTATCAGACTCTGGCAACGCAAAGTG
GCCGCAGCAACGAATCACCCAGCGACCAGGAATACCAGGAATTCCAGTCCACCATGGCGT
CCATCAATTACGCCCGCAGCAATTCCCAGTACGATAGTCATATCAAGGAGAAACGAGGTA
AAAATCGGGAGTAACATGGATGGGATATAGCCATAATGGGTGGGAAAAATCGTGTCCAGT
GTTAGACTACTACCACTATGTAAAAATTCTTAGCCATACTTTGAGTATATATTCTCTACT
TTCGCTTATGAAAGTAAAAATCAGTTTTCGAAAGATCTAATTTCAACCACACATTCCATG
TACTCCTATCTTCCACCATACATCCCAGTTAATCCCCAATTTGGGTTATTTTAAGCCAGA
TCTTATCTCAAAGATATCCACCACCTGTGGTCTCCAGATAACGGAAATTGCAATACCCGT
AAAACCGGAAAACAATATATCTTTACAATGCGGCAGAAGCTACAGTTTATAGAAGATCCT
ATAGAATGTCAAGGTCAGGCGGCGTTACTTTGTGGTTACACCTGCTTCGAGAGACATTTG
TATGCTTAATTAATTATTACACAAAAAAAAAATGAAAATCGATAAAAAAAACTGCCGAAA
TGACATCATCCATCGCTTTGAGACGCAGCAATTCGAACTTTAACTTGTTTAGCGGGCCTG
TGTGTTCATTGGGGCTGTCGTTATAAGTCAGTCGGTCGGTTGGTCGCGCCCAGAACTTCT
ATACTATCTGGCGATTTATATTATTTATATACTGGCGCACAGTGCGTTTGTTATGTATTC
GCCCCATGCCATCGACTGTTGGCAAGCAGTTTGTTACCTCTTTCCTTGGATCGGGGGAAA
AAAAAGGGAAAATTATTGGCAGCGAAAAGCACTCGAGGCAGAACTACCCCCAAGATCATT
TCGATGGGGTTGGATGTTCGATAGTTGGATTGTTGGATTGTTGTATATTATGTGACCTCC
TCGGCTGTTATTATGTTAAGCACAACAACCAATTAAGTGTCTGGCAGGCTGTCTGTCTGT
CTTGCGCTCCTTGAAAATGCTGATTGGTTGCTGAGTGGTTCGAACAGTTCTGTCCCCCTC
CGAATGACTGGCGCAATTTTTGGGCTGCACTTGTGGTATATGCAAATATTTTCAGACACA
CATTTGTATTGTATAGATATGTATGCCCTGACTGCCGGTTGTGTGTTTTGTTAATATACG
AGCAGTTTTTTCGTGTGCATTATCTTTAATATATGATGATTATCGGAGGGGAAAGTCCTA
TTTGCAGCAACTGTATTTTATGGAAATTGATTTTCCCTGTTTGCCATTTCAACATTTATT
AGCTGATTAAAACACTGGGCTACGGTTGAAAGTTAGCAAAGTATAATAAAATATCCATAA
CCCATTTAAGCAGATAGCTCTTATTTCTAGGGTTTTCGCTAGACCTTAGTTATTCGCTGA
TAGATGTCTTCATATGACAATTAGTGAGCATAAATCAAGTTTGCGTGAGCTAAAGTATTA
TATTTTCTCCTCTCGGATCATCGTCAGTGTCAGCATAACGGCTTGCTGTCCAATATTTTG
ACGTTGCGTGTTTTACCAAACTCTTCGAATGCTTCGGATAAGTTTGCTTGACAAGCCAGC
TAAATTTGGCCCAAATGTGAGCGGTAAAACCATATTGACAGGCCTAGTTACACACAATAT
CTAGCATATCATATACGCTATGAGCGACATGGAGATAGAGCTCTATAAAAAATTTATAAG
GCAGCAAATGTACGTCAAGCGTTCACTAATTGATGACATTCACATGGATATAGTATAGTA
GACTATTGATTGGTGGCTCTTGACTTGGTTTCAATACATGTCCTCACTTTCCCAGCAATT
ATCATTAATGCCATTTTAATGGCTGTGCAAAAAGCCCATTGAAAACAAAACAAAAAATAA
AAAACTCTATCCATATTCAAGGCATGGCAGGCGGTACATCAGCTATTGAGCTTCATCAGG
CCGCGATTCAAAGCCGAATTTGACTATAGAGATGATTTATGACAGATATTGATAGCTAAA
CTCAATGAAAATGTTTTCAAAACAAAGTGACAGCCTAGCGTTATCTCAGTGGATGCGACA
TTGTAAGTAATCCACACAAACGGAACGAAACAATCCGTACAGCAGCCGTACAACTGAGAT
CATCGCCAAGTTATTTATTGAATCTATCTATCTATCTATCTATCTGTCAGTTCTCGAATA
TTTATAGTGCATGTAGTTTAGCGGCTTTTAATTGATGCCTAAATTGCGGTCCAGAGAAGT
TGGCGCCTCGCGCTGAAATTTGACCTGAGCTCTGTAAGTTAAGAAGCGAATCAAGTTTAC
ACACAAAGCCGAACTTGAAGCATCCACAAGTTTGCTCTTAACCCACAAAGTATAAATGGC
TTGGATGCGGGGGTGCCCATTCTTTACCCCTCCACATGTTGCTCATGTGGTCAAAGAAAT
TAAAAATTCCCAATTTCGTGGCTTCCTCCTCCTCGGTTTTCAGTTCTGCTCGTGGGCAGG
CAGATCTTTTGAAGATCTCTTCTGGAGATGCGAACAAATTATCTTTTGGTTTTTGAAGAG
GTTTCTTGTTGGCTTTATTTATTTTTCTAATGTTTTAGCTGCTCAATCATTGAGTCTTAT
ATGCTGGCTATCGGTTATCTGCTGGTTTAATGTGCGTTATAAATGACAAACGTAAATAAA
CATTTAGTTAAACACACACAGAGTATATATAGTTAGTTATGACGCAATGCCACCACTTGA
CTCTACTTCAATATGTATGAATCGCGCGTATCGTATTTGCATCTAATATTTTCGAGTATC
TGTGAAATACCAGCAAATGGTTGGGGGTGGCGTTGTAAACCTGTCGTAGCCAATGGAGCG
TAAAGTTAAGTAATGGCATCTATAAGACTCTTCAACATGTTGACTGCGGGCAATTTATGC
GACATATTTGCCGACATTTTTGCTGCTCACTTGTCGCCGCAGGTGACAAGCACAAGTGCA
ACTCGCGACACACCTCGCTGGGTTTCACTGTACTGCGTTGAAATGTGAGTTTAAATTTAA
ACGAAATTTAAACAGTTGCTATAATAACCATGCCGCCTATGCTGTGGTGTTCATCACATG
GTTGATTGCCAATTGGGAAGGTCAACATTATGGGCACTTCGATTTGGTAGAATATCAAAA
TATCTTATCGAGTGGCACGAACTTTGGAGGTGTAATCAACTAAGTTGGTGTCAGTTTAGT
TTTAGATAATTTTAAGGGGTTTTTGGGAGGGAATTTGCGATACGAATGGCATTTCCGATA
GATAAAGTGTTTAAGTCAGAAATTTTAGTGACTGAACAGATGCTAAAAGTTAAGAAATGC
AAAAGATTCCACTAATTATGTAACCCAGTTGGTCATACCCCAAATAATTAGGCAAATAAA
CATTAGTGTTTGTATCGTGGAAATTCCCTGCCTCAAAGCTGCAAACATTTAATTCGACGC
ACTTCCGTTGAAAAATTCTAGAACTCATTCCCCTCCAACGATTCGATTGCCTTTTGTTTA
TGCAAATGTACAGGAACATATATCGTATTTGGTGTTTTTTTTTCTTTTTTTGGGAGGGCA
GGCCAAACAATTAGCTATGCGTGAAAGCAAATAGACTAGTTAAACCGAACACTTCTTGTT
TCTTGTTTCTATTTATGTTCTGTAACTAGGCCAACTCAGACAAATGGGCGACTGTAGCTG
AATATAAAGCCAACTGGCTGGCCTTTCAGTGCTTGACTTCTTTTTGTTGAGGTTTTTTTC
TTTTGGTAATTGGTAATTATTATTAACGGAAAGAAAAGCCCATAGGTTTCCATTATGGTA
TTTTCAAAGAATTTCTATATACTATTTTTACTATTTTCCCGTACGTTTTAGACGCGCTCA
TTAAACGGCAAGAATGGCGAAATAAACATAAATAACAATCTACCGACTTATCATTATAAT
CACCATCATTAACTCACTGACTGACTGAACCATTCATAAAAGATGAAGATGAAACAGAAC
AGAAGAACCGACAGTCGAAACAGAAGAATTGAGTGTAGAAACCGATTTACCGCTTCTGAA
ATTTCTGGAGAATATATAATGGCCCGGGGGTATCTTGTAATCATTTCAAACATCATTATT
GAAATGGAAATTGATTTCAACAAACCTGAAAAGTCATTCAACTTGAACGTTACTCCCTGG
CCCGATTTTGCCCCTTTGTTAATTGTTTAACGCATAACGCGGTGTGTAAATTAAACATTT
ACATATGCTTTTACTTTTTGAGATTGCTTTTATTTTGCTAGACTTTCCGAAAGTCGAAAA
TTGTTTATTTGAGCAAAGCACTTAAAATTGTGTAATTATAATTAGCTATTGCTAACAAAC
TTACTTGTACGTTGTGTGGGAAGGTTTTTCCTTCGAGTTTTTACTGTCAGGATTTTTTGT
AGTATCAAAAGGTATCATTTTTATTCGATTGTGCAATCGGCCTGGTTCAGAAAGTTAAAC
ACTAAGTTTGATTAGCTTGACCTGCATCATGAGCACCATATTGTTATACTTTAAGTTCTT
ATCAGATTCCACAACTTCGAGTGCATTATTTCTTATCTCTGCAGTAATTGGCATTTTTTT
GCTATCAGCAAATTGTGGTGCTAAAAAAAAATACAATTACCAAAAATTCACATGATTTAT
GGCTTACTAAAAATGTTAACTAATCGACATGTGTCGCGCATATACATTTATTTTTGGACA
GGCCAAGAACGAAATATTGTACAACAAACTTAGCCAACTTGTTTTCTAAGGGAAATTAAT
TCAGTTAGCCAAATGCGGTAGTTATGTTAATATATTCGCAACGCATTCACGATTTGTTAC
CAAAAATATCAGGTTCATTTTAAACGAGTTTTTAAAGAAGATGTTTTTGGCCAAAACAAC
TTAATTGTTTGGAAAGACAACAATAGATATTAAGGAAAACAAATAAAAGTGCAATTAATG
GATGATTTCTAATTCTTAGAAATTTTTTTGAGCACTGCTAGAATGTCAATTAAATTAGTT
TAAACGAGTTATTTCCAAATTAAAAACACATGGACTTTAATTAGGAATATATGAACAAGC
AAAACAGGTTTATATAAGTAAATTAAATAACTTGAGGTAACTTGAAGCCAGGAAAATGTA
TATTGTAATGTTTCTAACCAAACAAATACCAAATTTAAAATGCCACATTTGTGGTAATTT
ATTATTGGATAAGATTCGATGTAGCGAATCTTTACAATCCATTAGAGCATTTTAACGTGT
CTGAAAGGAACATAAAAATGGCCATTAGGTTAGAATTTGTCTGTTTTGCGTTGCCGAATG
TTGGCGAAATTATTTCTTTCATTTTAAAAAGATTAATGTATATATATATTATACGTACAC
GACTTTCAGTTGGTTTGCAAATTGCGCAACCTTGAACTAATTTCTATTTAAATAATCTTT
TGTCAACATTTCTGAAATTGCGTCACTCAGCTGGCAATAAATGAATGAAAAGAAATGGAA
AACTTAAGAGACCACAAGTTGTGGGATCATTTAAAATTAATTATTACAATTTGTGTTCGT
ACTTTACTTTGTAAATTGTTTTTTTAATTGGCTAAGCGTTTGACGGTTTCATTGCTGCCT
CGATTTATTTTATATAATAATTCTTATTCCAAGCATTCCTCTTGTCTAACTGTAGAAATT
TTCCATTTTCGAAAAATGAGTATTTCTTATTTATTACGGGAAATCTATTTTCGTTCCATA
TTGTTGGCATGCGTTTGGCCAAATGCCAGACACTGAATAGACCACGCATTGGGCCAAGTA
TTCTTGGAGCTGAATTCCCAATGGGCTGGATTTGAGACAGCTGCTGGCCACCATTTTCAT
TTTCCATTTTCCATTTTGCATATTCATTTCCATTTCGACTGCACTTTTCCATAATGACTA
CGCTTAATGCGTTTCTTTCTCGCTCACTTGTGTATATTTTGATAATTGTTTACAAATTGA
TGTTTTAACGCCTTGTTTATTATTTCAATTTGTCGGCTAAAGAATGAAATTGAGGTAATT
AAGGCACGCAAAAAAAAAAAAAAACTAAATATTTGCTTTAGCAAATCTGAGAACTCGTGT
TTACAATTTGCGGTCTACCTCTTTGACGCAAGTTAAAGGGTCAACGAAATTTTAAATATT
TCTTGGTTCGAATTGTTTACGACTTAAAAATTGCGTTGATTCATCAAACAAAATTTAAGG
ATTTTAAAAGTAATTGTTAAGAAACTAGGCAAATCAAAGCTTTCCACTTCATTTTCAGTG
TACACGGGATTTTAAGTTTGTTGAGTTTATTGAGAGGATATAAACCTTTTGCGATAATAT
CGCGAACACAAACATGATGTCATTGTGTTAACTTGGTTTTATACATCGACTTAACTGATA
ATTAAGTTAAAGTCAACATCAGGCAAAATAAAAATGAAAACGAAAAGCTGGTGTTTGTAG
CATACAACGAAATGTATCTTATCGGTTGCTTTCGGTATCTTTGGTAGTATCGTCATGTCT
CTTTTTTTCGCCTTTTAAGTCTCTTTTTCCTCTTTACTGCCGCCACTTGTTTAACTATTA
ATTGCAAATGAACGAAATGTATTCCCCATTTACTGACATTTACCTTTTCTTCGTCTTTTC
TAACATTTTCAGAGGAGCAAGAACGTGTGCAGAAGAAGACATTCACTAATTGGATTAATT
CATACCTATTGAAGGTGAGTCTATCTTGTCTATCCCACTGAAAAGTCTCAATCGATTTGC
CATTCGTCTTGAGCATACTGCCAATGAATTTTGTCTACAACACCACAGTGGCATTGGAAT
TTGCATATAGATTTGCATTTGATAAACCAATCGTGAGAGGTTTTTTTCCGAGTTTGCCAA
AAAAAAGAAAATAAAACTAATCAAAACTAACTGAAAACAAAAATGGGTTAAGGGGCGTGA
CATGTCCATCACTTTGAATACAAAATCGGAATTTAAGCGTGATAAGCTTATTTATTTGTA
CAGTAATTATGATGGAATAATAAGCGAAAAGTATTTGTTCAGAAATCTGTGATATAACAG
ATATTAAACGCGTGAAATTTGAAGGTTGTTTGTTTTTGGGGCTTGTCATTGTCAAGTGAA
TTAGTGAAAAGATTTTGAAAGCTGAATAATTCGACTGCATTTTGTAAGTTAATTATTATA
ATTTTTGGTTGAATTTTGTGTTATTTTTCGGAGCACAACCTGGTTTTTGATCTTTTATGG
CCGCCATAAACCCTCGCAAATATCTTCAAAGCCTTCTGGTTTTATCATTAGCATATGTAT
GAGTAAATATGTACCTACAGGTTCTGGATAAACATTTGTCATGTCTGAACATATTGGAGT
CACTCTTTCTCGCTGGATAGCTTCCAAGAATATTTTATGAGCACACGCACCAATGCTAGA
AATTCCTCAACACAACTGTCTAGATGCTCTCCATACTTCTTACCACTTCAGACTTTGAAC
AATGCAAAAAAAAAAAAAAAGAAAGAAAGAAAATTGTAAAGAAAATATTGAAAAAAAAAT
GGTTGGAAGAAATCCAACCAAAGTTGCCCGAAAGCCAACAACCAGCGAGTTGCATTAATG
CCAGACAGTTCCGTTTCTGGCGGGGATCGGCTGGTGGTGGCTTCAATTGCATTGCCATTA
ACCCGGCAAGAAACCCACGCGACGCCTACTGACTTACTTTCATGCCTCCAGATCGGAGGT
GATTTAATGCACTTTTCAGTCTTTTTCCGTCTCCTCAGACTTTTCAGGCAATCTCCGTCC
AAAGTCACAGATTGAGTGAGCCATGTTTCGTTTGGTGTCTCAAATGCGTTATCTTTTAAT
ACCAACTGCAATCTGCAGACATGAGCCGGCGATTTTTTGTCGCCCACATTACTGTGGTTA
TAATGGTGCAGGATATTGGAAAGTTTTCAAAAATATACTTCAATGAAATATTAATCTATA
AAAAGAAAGTAGTTTGTACTATTCAGCCTTACTTACATTATAAAAGAAATAAACATCAAT
TTTTTTTTTTTTTATAAATCATGTACAATGTATGTGTGTAATAATTTATATTTTAAGGCA
TACAAATTTGACTTTAAACTTAATACATATATTTTTTGGTGGAATAAATGTGCTTACAAC
GGCATTTTCTCAATCGAATTAATTTTATGAGCCACTATTATTAATTGCAGACAGCCATTA
CAATTTTTTTCACTACTGTATAAGTATATAAGTGCATGTAGGAAAAACTGTTGCCGGCCG
GCTAATCTTCCAATGCAATCCAAATTCAATCCGAAAACCAGTTTCTCGACTGCAAAGAGC
TTGCAGCTCGATAAGGCTGTCAGTCAGCTATACTCGTATGTATTCCACATAAAAGGAGCA
GCTGAAATGCAGGGGTATCCGTCTTCGAATCGAAATACAGAGTGCGTGGGCTGGGCTCTC
CAGATTGAAGTTCAATTTTCAGGCGTCCAAGGAATCGCAGATGCAACATCTACATCAAGG
AGTTATGCAATATGCAAATGAGTCATTTAATGTGCATAATGACAGGGCAAATTGCTGTAG
CTGCCTTTGCAATTGCACAACGATTGGCTGGACACGTTTTACTGAGGCAATAAATAATAA
ATATTGCCGTTGCAAATAAAAAGTGATTTATTTAATTTGCGTTTACCTATTGAAGATTCG
TTAGACCCATCAATTAGCATGCGTCTTCCATTTCCACCATACTATTGTATATCCATGTAT
CCAACAGATACACACTCGAATGGCATGTAAAATCATTTGATGGGGCAGCCGAAATTCAAA
AAAATGTTTGTTTGGCTCAGTTTAGTTCAAGGTGAACGAGGTTTTTATTTGACTGCGCTG
ACGACCCAAAAACCCGCTCCCAACGTTCGCTTTCCATAGAATTTGATTAAAATTTATGAA
TTAATTTATACGCTCGCGGTGGGTCCGAGTGACAAAAAGCTCGTTGGATGTTCAATTTTT
GAGTGGCGGCCCCACAAACCCAGTTCCACAGTTCGCTTTCATTGCTCTATGACATAATTG
ATGGCAACGCCCTGGCACGAGTTGTGCCCTCCAGTTGGAGCACCCGCATGGGGAATCCAT
ATCGATGCGTCCAGACCCCCATGAAACCAAAGTGAAAGGATTCAGCTATTAGAGGCGATT
AAATTAGAAAGGATTTGATGGCGGGAAAGTGGGTCACGAATGCTGCGAACATTTGTCAGG
TGCCCGTCTAATTGCGTGGACAGGTGACGAGTGGAAAGATTACAGAAGATTTACAATTCT
CTAAGCAACTTTTCAACCAGGGTGTAGAATTATGGTTATGACTGACAAGTAGATAGCATA
AATAATTATACCCTTTGCTCGTAGAGTATAGAGGGTTTACTAGATTCGTTGAAAAGTATG
TAACAGGCATTCACACTAGCTGAGTAGCGGGTATCTGATAGTCAGGAAACTCGACTACAG
CATTCTCTCTAGTTTTAATTTGAAAATGCTATTCAAGAAGTCGACTAGATAAGTGACATA
CTTATATAAAGCTCCCTTCTTACCGAGAACTTTGTGAAACTTATCAATTTAAGCCAATGC
AATTATAATACTTGGCGGTCTCATCAAGGAAAGGTATCCATTGAGCGATTAGCTATTAAG
ACCCATTTTTCACCGATGTCATGACCGGGAAGAATTATGTTCCTAAGAGACAACCAGGCA
ACGGCTGTAATGACATATATGTCTGCCCGAAATAAACAGCGGAATGTGGAAAAAGTTTTT
TATATGAAGCACTATGACACCATAAATTCCGGAACTAAGGGTAAAAAAGATGGGCGTATC
TAGTGGAACCGGAAACGGAAGCATTGAAATTGATTTCGCTATGTCTGTTCTGAAGCAGAA
TTCACACAAAAATGAAAAGTTTTTGCCGTACAAAGTTTTTTTTACCATTGTCATTGTCTT
TTGCATGTTGCTGCTGGCAGCAGTTGAATAAAGTTTTGCAGAAACTATTTACCCACAAGA
AAGAAGCTCAATTAAATGCTACACTCAATTACAATGAATTTTCCACGTTTTGTTGTTTGC
TTAGTTGGTGGTTGTTTGTTTTTGGTGCCACTTCCGTTGCTGCCGCCTTAATGGCATTAC
CTTAAAAACTGTAATCTTTTGCGGTGGATTGAAGTTAAATGCCTGCTCGTGCCATTTGCC
AATTTGTCTTGGCCCACACTGCAAGTATCACCGCAAATTATCGCATCGCTATGGGAATTT
AAACTATTTTAATTGATTTAATGCGCCTCGAACGATTGCGTGAGCTGCATTTGATTGATT
AACCGAAAATAAACTTATGCAAATCTGTAAAGAGCAGTCGAAATTGTTCAAAATTAAATC
TATTCAATGCACCCCATTAAGTTTATATATATATTTATAGTGAGTGCATAACGTTGGCAT
AGTGCACTTAATAGCATCATAAAGTGCTCCGAAAATTACACTAAAAGCACTCAAGACCCA
TTGTGGGCTACTTAACTCTACTTAAGTAAGAGTTGTAATTTAAACGAAATTAAATTTATC
AAGCAGAAACACTTTAAAAAGAAGTTAACCCCAATACCTTCGATGGATTTCCCTTTAGGT
TGCTGCGCTTCTAGCCGAAGATTAATGGTTTAGAACACCTTTTTTTTATGTCTTAAGGGT
GAAAGTTTAAATTGAAGCGAATGACTTGATATATATTCAGTTACAGATACAGTTAGCTCT
AACCTATATTATTAATATTATTATTTTTCAGCGTGTTCCACCGCTTCGCATCGATGATTT
AATCAATGACTTACGCGATGGTACGAAACTAATCGCATTGCTGGAAGTTCTGTCCGGAGA
ACGTTTGCCCGTGGAGAAGGGTCGCGTTCTACGGCGTCCACATTTCCTTAGCAATGCCAA
TACGGCCCTGCAATTTTTGGCCAGCAAACGAATCAAGTTGGTCAATATCAATCCCGCAGA
TCTGGTGGATGGGAGACCACCAGTTGTGTTGGGCTTGATATGGACGATCATCTTGTACTT
CCAGGTAAGCATGCCTTATATACTATATATATATATTAAATACACCGAGTGCACCAGTTC
ACGAATTGAGAGCACCACCTACAATTGGTTGCTAGTTGTACACCTTCTCACGAGGCTACC
ACCAGTAGAGATGTACACTTCAATTCCAAATGACCAGCAATTTTGAAACTTTAAACGTAA
TTAACCCTATCAAACTTCTTTTCTATATACTTTTTTTTATTGATATCATTGATTGATAAC
ACGTAAACAAGCTTCGTAAAAAGAGGCGGAAAAACTTAGTAGTAGTTATAAATTATGCGC
CACAGGTGGGTCCAAGTTCGACATGAAATTGTTGTTTTGTCTTGTGTACCTCATTTATTT
TTGGGTAGAATATCGTCTTTAGTTGGTAGCCAAACCTTTTAAGGCACTTCCATATTTTAA
GTTTAACCATTACATTGCCATTGCATGCGGGAAGTATCGTAAATGTACTAACTCATTTAT
ATGTCCACAGATCGAGGAGAACAGCCGGAACCTAGAGTATTTGGGTCATGGTATTGGCGG
TTCGGTTAGTTCCCTCGACAGTGTTGGCAACCAGAAGCACGGCGATCTGAAGGCTGAGAA
GTGGAAGCAGGGTGCCAGGAAGACCCTGCTCAACTGGGTGACTAATGCCTTGCCAAAGTG
AGTGGACGCACCCTATGCTAAGTAGTTCATATTCATAATCAATACTCATTAAATAGGGAC
AGTGGTGTGGAGGTAAAGGATTTCGGCGCCAGCTGGAGAGATGGCGTCGCTTTCCTGGCC
CTCATCGATGCCATCAAGGCGAACCTGGTCAATTTGGCTGAGCTGAAGAAGACCAGCAAC
CGTCAGCGTTTGGAGACCGCTTTCGATGTGGCCGAAAGCAAATTGGGCATTGCCAAGCTC
CTGGACGCTGAGGATGTGGACGTACCCAAGCCGGACGAGAAGAGTATCATGACATATGTG
GCGCAATTTTTGCACAAGTATCCCGAACCAAAGGCGAGTTTTGATCTTTGAAGCTTTCGA
ATACAACGGGAGCTGTGAACGTTTTTACTTATCCAATCAAATTTGTTGCAGGGTGCTTCC
CGCGACCAGTCGCATGTGCAACAGGAGGCGGACGAACTGCGTCGCTTCCTGGTGGAGAAG
ACCACCGAGTACGAGCCCATGGTCATGATGAGCTCGTTCCCACGCGATTTTGGTGAATAT
TTACTGGCACGTTCTGAGGTCGATGCACATTTGGCGGCCTACAATCGCTTGAAACAGCTC
ATTGAGAGCCAGAGCGGATTCCTGCAGGTCTCCCGCCAATCCTGGGAGGAGATTAACGAG
CTGTGGCAGCGCCTCCAGTACCAGATGATGTACTGGCTCTGGTTGCTGGATTCGGAGCTG
CCCGGCGACTTCGGCACCGTTGGCAAATGGTTAGCCGAAGCAGAGAAACTATTAATGGAC
AACGATATACCCAATGCAATGAATGAGGAGACGGCCGCAGTGATCAGCAGGAAGCTGGAG
GAGCACAAGCTCTTCTTTGCCGACCTGCCGCGCATTTTGGCCATGTTTGATAATGCCAAG
CGGTCACCGGTGGCTCAACAGATTCCCCTGGAGCAGTTGCGCAACATGGAGCGTAGACTT
CAGGAGGTCGGACCGAAGGCAGCGGAGCGAAGGATACGTTTGAAGTTCCTGGAGCACAAG
TGCTGTTTGATTGCCTTCCTCAATCTGGTGGAGAACAAGATGCGCGGATGGACTGGAAAG
TATGGTCACGAGGAGAAGGTGGCCCAACAGCTGGAGCAGTACAAGAACTTTGTGTCGCGC
AACAAGATCTTCCAGGAGTTCCAAAAGGCCTTTGTCGATATGCAACAGGTGGTGGAGGAG
TACAAGCGCGATGGCAATGTGCCGCGCAAGGAGATCAACGACATCGATCGATTCATGTAT
GAAACCGAGGAGCGCTGGAAGCGCGTCTCCATGGAACTGAAGTGCTGTCAGAACTCCCTG
GAGGAAGTGGTCAACTGCTGGCGCAGCTGGAACCAATTGGCCCCCACCTGCGAGGAGTGG
CTGCAGCTGGCCGAGCAAAAGGTCAACCAAAGCGAGGATGAGCGTTTGGACTTCTTTCAG
GATATACCCGTTTGGAAGGACAAGTTTGATGCCCTCGCTAGCTCGGCTAACTATCTGATT
GCCTCCTGCGAGGAGCCCATTGCCCAGCAATTGCGTCAGCGACATGGAGCTCTCTCTGAG
CGATTCGAGCGTCTGTTTGCCAACACCAAGCAGTACATGCATGCTGGTGACATTATCCGA
TCCCGACAGGAGTACAAGTCGGGCATAGAACAACTGTCCAGATGGCTGCGAGGAGCCGAA
AGCGTTCTAGACCAGCGACAAGTTCTGGGCAACAGTGAACAAGTCAAGGAGTACGGCCAG
CAGTTGCAGCAATTGGCCAGCGAAATCGATGACAACGAAGAGCTGTTCAAAACCATCAGC
AGGAACTTCCAATCGCTGATCCAAGACCTTTCCCGCGATGAGGTGGATAAGATGATGAAG
CTACTCAAGCAAGAGAAGGAATCTCTGGTGCGCATACGTGCACAATTGCCTGCCAAGCTG
CATCTGTTCCACCAGCTTCAGATCCAACAGGAATCCCTGGAGGCTGGACAAAAAGAGATT
CACCAGTGGCTGAGTGAGGCTGAGCAGCTTCTGGGAACCCACAATCTCTCCGGAGGCCGT
GATGCCATCAATGAGCAATTGCACAAACACAAGACCTACTTCTCGCGCACTGTCTACTAC
CGATCCATGCTGGAGAGCAAGAACAAGGTGTTCCAGAATCTCTTGAAGGCTGTATCCTCC
GATGATAAGATCGATACTGCTCCTGCTTCCCAGCAAATGCAGCAGCTGAACGAGCGTTTC
AACTATGTGATTCAAAATGCCCAGCAATGGGAACAGCGCTTGGATTCGGCAGCCGGTGGA
TGGAGTAACTTCAAGGACAACGAACGTGTGGTCAGCGAATGGCTAACCCAAGCTGAATCC
ATGTTGGTGGAGAAGCACATCGAATCGAAGACGACAATCGAGACACAGAAGTACTTCTTT
GAGCAGGTCAACGATCGCTGGATGAATGACCTGGTGCAGTCGGCTCAACAACTTCTGACC
ACATTGCCCGCCCAGGAGCAACCTGCTGTGGTGCACAGTGTGGAGCAGTTGCAGTCCCGC
TGGAAGAATGTATTGTCCCAGGCTCCTTTGCATCTATTGAAACTGGAATTTAGACTGGAT
GAGAACGCATTCTATCAATCTCTGAAGGATGTAGAGAAGGAGTTGCAGCTGGAGCAGCAG
GCCCTCAATCGCAATGAGGATGTGGACTCCATACTCCAGCGTAACCAGCAGTTCCTTCTG
CAACAGGATGTCGTTCCTCGCCTGGAGCGATGCCTCCAGAACATGCAACGTTTGGCTCAG
GCCCACAGGCAACAGCAGCCCGGTGACATTAGTCTGGATCAGGCCTACGACAATGCCAAG
TCGCAGTGGCAACTGTTGTCCAACAAATTGGGCGACATGCGTCAGACTCTCCAGCAAATC
CCGGCCCAATGGCAGGGCTATCATCTGAAGTTCAACGACATGGTCGATTGGATGAACGGC
GTGGATCAGAGCCTTAAGAATATTGTGAACGAAGTGAATACCATGGAGGAATTCGAAAAG
GAGAAGGTGGTCTTCCAGGTGAGCTAGTAATAATGATCTATAAACATTCCATTTCGATCA
CCTATAAATAATAAATAAATAAATAATCCTCTCATTACCCATCATGCATTGCCCTGAAGC
TGAGGGAGCTAGTGGTAACTAATATGCTTCTATATATATCTCCTATGTTTATTTCAATTT
TTTATAAGCCATGGCTAATTAATTATTAATTATCTTAAAACAGAAAATCTGCCAAGATGC
TGACAACAAACGCGAGGACATGAAATGGTTGGTCAAGACCTTGGACTCTCTGCTTAGTTA
CGCCACCGAAGATGAGGCCAATCTGGAGCAGAAGAAGCTGGAGGATCTGATCGCCCGCTA
CAAAAACCTTATCCCAACGATTGAAATCACGATGGTCAAGACGGAAGTCTTCTCAAAGTG
CTACACTTACCGCCGAGAAGTGCACGAGGTTGTGTGTCTGCTGAGCAAGGTCAAGGATCA
GACTGCCAATATACCAGCTCCCGATAGTCTGGATCGTGTGAATCGTCTGATTGAGGAGCA
GCAGTATGCCATCAACCAATTGGATCACCAGCGTCCGCATATCATGTCCATGCTGCAAAG
AGGACGTGATCTCATCAAGGATGTCCATGCCCCGGCCTTTGTAAATGCCGAGGTCAAGAA
TCTGGAGACGGGATGGAATCAGGCGTACACAGAGACCTCCGACAAACTGCAGGCCCTCAA
GGGCACCCAGGCCGTTTGGAGCGAGTTTGTGGACCAGAAGAACGATATTTTCTCAATGCT
TCAAACTGCGGAGACGGAGCTGCGTTCCCTGACACCATTGCAAACCGATCCCAAGAACGT
CAGTCAGGATCTGAAGTCCAAGAGAGATCTTAACGTACAACTGCAGCAGGCTTCCCATCA
ACTGTTGCCTAAGTTGCATGCTCTCAAATCGGAACTGGCTCCTCTGGCCGCACCCGATAA
GCGTCCCATCCTCGAGAAGGAAGTGACCGAGGTGGAGAAGATGTTCTTCAACACCATGGA
GCACGTAAAGGATCGCGTCGGCTATCTGGAAGACTACAGTGCCAAGTGGAATAACTACAA
GACCCGTCTCGCTGAACTGCAGGAATGGGCCAACAAGGTCGCGCCCAAGAATATCGAGGC
CCTTCAATCGGAGGACCTCACACCGGAGGAGCGTGTGGTCAAGGTGCAGGCGTTCAAGCG
TATCCTTGGGGATCGCATGAAGCAACTGGATCTTCTGGCCGCCGATGCTTCCGAGTTGGC
GCCCAAGGAGGGCAACATTGCCGAGGCCAAGCGACTGAAGGGAGAGATTACCAAGCTGCA
GGAGGTCCTCAGTGCCATCAATCGCAACGTGGACCATCAGGCACAGGCTGTGCAGGAGGA
TCTTGTCAACTGGCAGCAGTTCCAGGCCGGTCTGCAGCAAATCAAGCCAGCCGTGGAGCA
AAGCGAAGTCAAGGTAAATAATGTAGTTTCTAAGCCCATCTCCCTCGAAGAAGCCGTTGC
CATGCAACAGAATGCCCAACAATTCGAGACACAGTGCCAGGAGCAATTGGACAAGCTCCA
TGGCATATCAAACATCAGTCATAAAATGTTATGTAAGACCAATGCCCCCGACGAATTGGA
CGCCATGCATTCGCGTTGGACTGCCGTCCATGAGAACGCGAAACAGGCGAGCGCCAAGCT
CGAAAAGTTGGTGGCCAATTGGAAGTCATTCGACGCCGATGCCGCCAAGCTCGAGGATTG
GGTTGGACAGGGTGAGCAGCAAATGTCCCGCCGTCCAGCTGTCCTCAACACCCCGCACAT
TGACAAGCTCGAAAAGGAGCTGGTCAAGCTGAAGTCGTTCAACAACGAGATCTCGCAGCA
ACAGGCCAAACTGGTGACTCTGGGTCAAAATGCCGATCAAATCAGTTTGCACTTGGCTCC
TGAAGGAGCAGCCGCTTTGAAGGATCGTGTTAACCAAATGAAGGGCAAGCTACAGAAGCT
TTCGGAAGCAACTCGAGGTCACATCAACGAGGTGTCCGACGCCATTATCTCCAGGCAGGA
TTTCAATGCCAAGTTGGTGAACTTCTCCAACTGGATGGAGCAGCTGCGTAACCAGGTCAC
TCAGGTGGAGGAGATCAACCCGGAGCGGGTGGAAACCAGTCTCCATGTCATACACGCGCT
ACTGCAGGAGCATGCCGATAAGAAGCCAAGTTTCAATGCCATATACGATGAAGTTAAGCA
ATTGGCTTTGGGAGCAACTCCCGAAGAGTCGAATGCCCTGAACGATGCCTACACCGCTTT
GGTGGTGAACTATCAGAACCTCGAGACCAACATGCTGCAAAAGAAGGCGGCTCTGGAGAA
ATGGACAGAGCTGCTGGGCTGGAAGAATGACACCGAATCGCATTTGAACTACCTCAAGCA
TCAGCTGGACAAGCCGGAAGGACCTGCTGCCGAGGAGCTGTCCAAGGTCATTGATGAGAT
CGATAATTTGGGTCAGGGTATTGGATACTGGAAGGGTCAGGCTAAGGAGATTGATGAAAA
CCCGGCCATTCAGTTGAGGGATGCTCTGTCTCGTCGTCCATTGATTGCCACCCAGATTGT
GAACGATGTTGAGAATAAACTAGAGAATCTGAAACTGCGCTCGCAGAGCCAGCAACAGCA
AATCCAACAGATGACCGTGCGCAAAGATAAGTTCCATGCCCTGGAGCATAACTTTGGACA
GGCACTTCAAGAAAATCGGGCTAAGCTAGACGAGATTCTCAGACAGCATCCGACTTTAAA
TAATATCGATCAAATCATTGCCGATTTGGTCGCTCTGAATGATGCCCTGAAATACCAAGC
CGATCTGAAGAATCGCATTCATGACGAAGGTTCATTGCTGATGCGTGAGGATATTGCTAG
CATGCCCGCCATTCAGGAGAGCCTACTTATCATGGACAAGAACTACGATTCTCTGCAGAA
TGAAATAGCTGATCGCATTCAGAAGTACAACCTGATTAGCCAGGCCCTGAGAGAATATGC
CGATTCCAAGGACAAGTTCTCCAAGGAACTGAAGAAGGCAGAAGATCTATACAATGCTAT
ACCTCAACAGCCACGCGATGAAACCGAGCTCCATCAAGCTTCCGAGAAGACCAGAAAGAC
CATGGAGCAGTTGCGTAAGTCGAAGCTCAGTTTGGATGAACTGGAGCGTCGGGGCAACAA
TGTGGGCAAACTTTTCAGTGCCATTGGAGAACCCATTCCGCAGGAAGTGCCACAGGAGGT
CACCGCAGCCAAACAACACTGGCAGGATTTGCACGACAAAACCGCTAAGAATGCGCATGT
GTACGAGACGGAAGCTGTTATTTGGTCACAGATCGAGGATGCCAAGAAGGATTTGCTTCC
CTGGTTGTCCGAAACGAATCAGGGACTCTGCGATGCTGCGGATAACTCAATTGAAATTGA
GTTTGGACCCATGCGTCTGAGCAAGTACCGCACGGAGCTACCTTCGTATCAGGCTCTGAA
GGATTCGATAGTGGAGAAAACCAATGATTTGGTTAAGATCAACAAAGGTGCGGAAATTCC
CGCTCTATCTGCACTCAACAAACTATTGTCTGAGCAGTTTGCTGAGGTTAACAACAATGC
AGATCGCCTAAGTGCCATAACCACCTCGTTCAATGACCAGGAACAAGAGTTGCGCAGGCG
TTCGAAGGAAGCTGGCGAACGGGTGAGCAAACTTCGTGAGCAGCTGATCAAATGTGATGA
CATGTCCGGTGATAATAACAAGATCATGGAGCGTCTTCAGCAATGCCGTGCCCTGCGTGG
TGAGCTCGATAATAGTGGAAACGAAATCGACAACATCAAACAAAAGGTTGACGAGCTGCG
TAATTTGTACCCAACTTTCAGTGAGTCCATCATACCCAAAGAACTGAACAATGTGCAAAA
ACGCTATGAGAACGTTGATCTTTACGCCAAGAAGATTGAAAGTTCTCTGCTGCAGTTCCT
CAAGAAGTTCCACGCCGATAAGGTGGGCATGCTGAAGCGTATCATTGCCACTCAACGCGA
AAAGGTGGCCTGGTGTCAGCCGGAGTCCTCCAGTGACAAATACAATCTGGATGTCAAGAA
GTCCTCTCTGCAGGAAGTCAGCAAGAGCATTGATGACTGCAAGGCACGCCATGCCGAGAC
CCTGAAGTCCTTGGAGATGTTGAAGGCGGTAGAGTCGCCACAGAACCTGGCTGAACTCAC
CAGCGATGCCGAGTTACTGCGCAAGGATATGCAGGCTCTGCAGGACAGCTTTGACCAAAT
CAAGGGAATCCTTGACGAGAACGTCGATTTGTGGTCGCAGTATGAGCAATCGAATGAGCA
GATTTCCAACTGGCTGCGTGACGTTGAAGGACGCGTTAAGGCAGAAACTAGCAGCCAAGT
AAATCTGTCCGAGGTTCCACAGAAGCTTCAAGAATTGTCTATCCTCCAACAGGATGTGTT
GGCCCATGAGCCCATTATTAATAACCTCGAGCAGACATCCCAACAGCTAATTGAAAAGAA
TCCGGAGGCAAGAATTGGCCAGTTTGTCACCCATTTGGTGCAGCGATATCAAGCTGTGTC
CAAGGCTTTAACCAGCTACATCGATAAGATCCGTGGTGCTCAGTTATCAAACGCTAACTT
TGCCAAGGCCGCCAAGGATTTCAACGAGTGGTTTGGTGATGCCAAGATCGAGTTCCAGGA
ACTTGCTCGCATGGGATCTCCCGGATCATCCTCTGCCACAGCTCAGCAACTGCAGACCGT
CAAGAATTACATCAAGACCTTCGACAATGGTCAGATACTACTGAATAATGCCGTCGATAT
TGGTGAGGCTTTGTACCCGGTGGTATCGCCCGATAATCGCGAACGTATCCGTGCTGATCT
TCGCCAGATGCGTGAGAAGTTCGACTACTTGCGAGATGAGGCCAATGCTTTTATGCAGCA
AGTCGAGGGTGTTTTGATTCAAAAGACTTCAATCGAAGAAAGCTACACTCAGGTTTCTCA
CTATCTTAACGAATCGAAAGCTAAGGTTCCCACCACTGACGAATTGTATCCCACTTTGGC
CACCAAAAAAGCTGCCCTCCAGAACTACAAGACCCAGCTGCAGGAGATCACTCTGCACAA
GAATGCTTTGAAGCAGTTGCACGACAAGGCTGTCACCCTTTGCGATGATGAGTCCGAGAG
AAAGACCGACGAGTCTATCCAGGAGTATAACACGCTATCCAAGAAGATTTCCGATAGGAT
TACAACAGTGGGAAATCATGTGGTCAAGCATGAAGCGTATGATCAGGTCCTGGAAAAGGC
ACAAGACTGGCTGAATACCATCAAATCCGAGGCCATTGATATCCTCAACGAGACGACATT
TGAAAAGGAAGGCGCCGAGGAGAAACTGCTGGTTGTGGAAAATCTTCTGCAACATAAGCC
TGAGGGTGATTCCATTTTCGATACCTGTCACAAGTTATTGGAAACGGTGCTCACACAAAC
CCATCCCAGTGGCCATCCAGCTCTGCTGAAGGGTTTCGAGGAACCGAAGCAATCTTGGGA
GGACTTTATGACTCTTTGTCAGGATTCGTTGGTAAAACTGAAGCAGCTTTGCTCTAAATG
GGATGAGTTTGATACAATCATTGAGGAGCTAGACAACTGGATGAAGAATGTCGAGGCGGT
GGTTAAGAACCAGAACCTTAAGAGTACGGCGGAAGCCAAGAACGCCCATTTGAAGCAGCT
TCAGGATATTTCAAAGGACATCGAACGGCGCGGTGCGGCCATCAATGAGCTAATGGATCA
AGGCCGTGAGATTGAGGGTGAAACCGATTTGAACCTTAAGTTGTCGCGCCTGAATACTCG
CTATCAGACCCTGAAGAATCTGTGCAAGGAATCGATAGCCAAGTATGTGAACTATGTAAA
GGATCACGAAAGCTTCGACAAGGACTTTGATTCATTCAAGCAGAATCTTCAATCTTCAGT
CGACGAGCTGGCCAAGACCAATGAAATTGTCGGCGATCAAAGCGTGCTGCAGGATCAGCA
AAATAAACTCCGTGAGATGTCCGACAAGCGCATTTTGGATTCCACTCTATTCGAGGGACT
CATCGATCGTGGCGAGAAACTCTATGGTCACACCAGCCCCGAAGGCCGTGAAATCATTCG
CCAGCAATTGCGTGCCCTGCGAACCCTTTGGGACAACTATACCGATGATTTGAACTCGGC
GACGCAAAAGATCGATCAGTGTTTGCTGCAGTTTAACGAGTTCAGCATTGCCCAGGATCA
GCTTACCAAGTGGCTGAAGGATGTGGACAAGGCCATGCAGAGTCACACTGAACCCAAGAC
GACGCTGCAGGAGAAGCGTGCTCAACTGCAGAACCACAAGCTGCTCCATCAGGAGATCAC
CACACACAATGTTCTGGTTGATAATGTCTGCGACAAGGCACAAATACTGGTCGACCAGAT
CAAGGATAACTCGTTGAATGTGTACTTGACCTCGATCAAACAGCTTTTCCAGAGCATAGT
CCAGAAGTCGGATGAAATTTTGCACAATCTGGATGATTGTGTTCAGAAGCACAATGAATT
AAACAACGCTCTGTCCTCGGCCAAAACTTGGATTTCGAATGAGAAGGCCAAATTGCTGGA
GTGCGACGATGCTTATGGTGAGAAGGCAGACATTAAGCGAAAGATTGAAACTTTGGGACA
ATTGGCTCAGAACAAGCCACAGGCAATGAAAATAATCAGCGACATCCGTGATCTCTTTGA
GAAAGTGAAGGCAACGACCTCCGAAAAGGGTAACGAAGTGCTGGACAAGGAGATCGAGGA
ATTGGAGACCACCATGAAGAGTCACTTTGATGACATCGAGGGCATTGAAGGCAAACAGAA
GGATGTGCTTGCCCAGTGGGACAAGTTTGAAAAGGCGTTGGAGGAACTTACCAAGTGGTG
CCGCAGTGCAGAGGCAGTGTTCCGCGAACAGCAGCTGCAGTCCACGCTCCATGAGAAAGT
GGAGCAGCTGGAGAAGTACAAGATTCAAAGGGAGTTGATACTCCAGAAGGAGAAGGAGAT
CGATGCCTTCGGAGATGCTGCCCACGCTCTGCTTAACAACTGTGGAGCCGATCGTCTAAA
GACTTTAACCACTCAGATCACCAATCGGTATCAGCTGCTTCAAGTCCTTAGCAAGGAGGT
TGTTAACCGCTGGTCAAATCTGGTCGATGATCACCAGTTCTACCAGGATAAGTACAACGA
GGTGGATTTGTGGCTGCAACCCATCGAATCGCAGATGGCGAAGGTCCTTTTGGATGAGCC
AACCCAGAGTTCTAACATTTTGCAAGTGCTGTTGTCTGAAAAGGAGCAAGCGGAGAGCTT
ATTTGCTGCTCTAAATGCAGCTGGAGAAAAGGCTCTTCCAGAGACATCCACTCAGGGTAG
GGAGAAGATCCGTAAGGACCTGCGCGATATCCGCGATCGTTGGGACAAACTGGACGAGGG
CATTCGCAACCTGGAAAAACGCCAGGAAGCGCAGGGAGTTCAGCTCTCCAGCTACCAGGA
TATTCTTAATCAAACCGTCAACTGGTTGGATCAAGTGGAGAAACTGATCCACAATGAGAA
CCCTGCTAGCTGGACCAGTGCCCAAGAAATTCGCTCCAAGTTGTACAAGTACAAGGCCAC
CAACCAAGACATCAACTCGCATAAACGCATAGTCGAGGCTGTGAATGAAAAGGCAGCAGC
TCTTCTGGGCAGCGCCGCTCCAGCCAATGCGGATGAGATCTCCAAGGCGGTGGCTGAGGT
GAACAAGCGATATGATCAAGTGGGCCAGGACTGTGCCAAGTTAGTTGCCGATCTGGATGG
AGCTTTCGATGTGTACCAGCAGTTCAGTGAGCTGCAGAAGGCTCAACAGGACTACCAGAA
GAATCTTTGGGATCGTCTTACCGGCTACTCGGACTACTCAGGCAATAAGGCAGCTCTGCA
AGCTCGCCTTCAAAAGATCAACGAGATCCAAGATGCTTTGCCGGAGGGTGTGGCCAAACT
CAAGTCCCTGGAGGATCACATTGAGCAACAGGCCAGTAATATACCAGCCCGATCCAAGGA
GGTAATGGCACGTGATCTGGCCAACTTGCATGCCGATTTCGAGAAGTTTGGAGCTTCGTT
GAGCGACGTAAAGAGTGGACTAGAGAATCGTCTACAACAATGGAATGATTACGAAATCAA
CTTAGATCGACTGATCACTTGGTTGGGCGAGGCTGAGAATTCCCTCAAGAACTACAATCT
GAAATCCTCGTTTGAGGAGAAGGAAGAACAGCTGAACGGTTTCCAATCCTTGGCTCAGAA
TTTGCGTCAAAACGAAGCTGACTTTGACAAGGTGAAGGACGACACCTCAGAGTTGGTCCA
GAGTTCTGGTGAAACAAGGATTGCTGTCAATGTGCAACAGGTTTCCTCCCGCTTCCAATC
GATACAGGCTACAGCTAAGGAGATTCTCAAGAAGTGCGAGCAAGCTGTCCAGGATCATGG
TCATTTCAATGACAAGTATAAGCAGTGCGCCGACTGGTTGGCAAATGCTCAGGCCCGTTA
CGATGATTGCTGTGACTTGTCCACGGTGGCATCTCGAGACGATCTTCTCAAGAAACAAGT
GGTCATCCAGGAGCTTCTGGCCCAGCAGCCAACAGCTACTCAGCTTCTAAATAGCACCGT
TGAGCTGGGCGAGAAGTGCTATGGGTCCACAGCAACCGAAGGACGCGAGGCCATTCGTAG
TCAACTGGATGATCTGACATTCGATCAGTTGTTCGACAACATTGCCATCACTGCAAGAAA
GATTCAGGATAAGATCGCCAAGTGGTCTGGCTTTGATGAGATCGCTGACAGCTTGAAGAG
CTGGTTGGATGAAACGGAGAATGCCCTTCCAGCTGATATTGAGCTGAAAACGACTCTGGA
TGAGAAACGCAATAAACTGCAAACCTATCGTGACATCTTGAACGACATCAACAATCATCA
GGTGGAGTTGGGTAATCTTCAGGAGATTGCCGCCAATCTGCCAGAGAAAACAGAGCTTGT
GGACCAAATCATAAAGGATATCTCTGACCGCTTTGGAAAGCTGCAAAAACGTGCCCAGAA
CTACGTGGAGCGTTACGAGGGTATTGTGAGTGCACATCAACAGTACTCCAAGGCTGTTAT
GGATGCTCAAGAGTTTATCGATGCTACCCTGAATACGGTTCACTATTGGGGCGATCTGGA
TCTGGAACAAATCTCACTGCACACGAACCTCGACCGCCTAAAGAATCTGAAGGCCAGTTT
GGCCGATGAGTTCCCACGCGTTGATCAAGTTAGGGCTTTGGGCGAGAAGGTTATTCCGGG
TACGGTGGATGTGGGACAGGTAAACATTAAGTCCCAGATCGACACCACCCAGCAAGAATG
GGAAAGCCTACTGACCACAATCAGCTCCACAATTGAAGCTATCGAAGCTCGCCTACAGCA
TTGGTCGGAGTACGAGCAATTACGTGACCAGTGTTTGGCTTGGATTCGAGATACGGATAA
CAACCTTCATGCTATCGATCTGAAGGAGGATCTGCCGAAAAAGCGTGCACAGTTGGATGC
ACTGAAGGCCCTCCAAGGAGATGTACGCGCCAAGGAATTAGAGGTGGATAATGTCACGGA
GAAGGCCCAAACCCTTCTGAAGGGTCCCAGCAGCAATCGTGCCTCGGGTCCTGAGTTGGT
AACCAAGTACCAGCAGATCTTCCACAAGGTCAAGGAGCTCAACAACCGTTGGCAACAGTA
TGTTACCTCACACGAAGATTTTGATAACGCTATCTCTGATTGCTCCTCTTGGATCAATGA
GATCAAAGAAAAATTGGACTATTGCTCCGACATGTCATCTATGAGTCCAAAAGAACTGGA
TAAGAAACTGGCCACTATTCAGGATGTTATCTTGCTAAAGGACGAAGGTTCTGCTCGTGT
TTTGAAGATCTTAGAGCAGGCCCAGCATGTTTTGGCTAACACAGCGCCCGGAGGTCACGA
AGCCATCAATAAGGAACTCACAGATCTCCAGGATCTCTGGTCCGGAATCGCTCTGCGCAT
CATGGATGTTAAGTCAAATCTGGATGACTCAATTACTCAATGGTCTGGTTTCCTGGATCA
AGTGCAAAATGTTCGCAAGTTTAATGAGTGGTTGGATGGTCAGGTTAAGGAGTTGAGTGA
GCATCAAACAACCATGACAGAGAAACGAGCACAATTGGATCGGGTAAAATCTACGGAGGA
GAAGGTGCGCGTCGAGAAGATTGATGTGGATGCACTCAAGATCCAAGCCAAGGAAATGAT
TGCCAGTGGTCAACAGAGTCAGGCGGCCTTCCAGGCGCAAAAAGTTCTGGATACATTCGA
CGAGCTCTTTGCCAAGACCCAGAAATTGTTGTCGCATCGTCAAGATCAGTACAGGGATCA
TCGATTGTTCAAGGAGGCCTACGATGATTTGGTTAGCTGGATTGGACGAGCCCGCGAGAA
ATTCCCTTCGTTGAAGCAGAGCAGCTTAAGCGATAAATTGGCCATTGAAAACGCTGTCCA
AGCTACGGAAGCTCTTCTCAACAAGCAGGCACAGGGTGAACTCCTCGTGGAGCACTTGGT
CCACACTGGAGAGGTGGTGCTGGCCAGTACATCTGCTCAAGGTCAGGAAATCATTAGGAA
TGATATTCGTGCCCTGCGCGACAGCTTCGAGGGCTTGTTCCGTGAAATCAACCAGCAGAA
GGAGAACCTTGAGGTGACCATGGTTCAGTGGCGAGCCTATAAGGAGGAATATGAACGTCT
GATGGAATGGCTTCAACAGATCGACATCCTTGTGAAGAACCACAAACTGAACCTGTGCCC
CAACCTACCCGAAAAGGAAAAACAGGTGGCTGATATGAAGGAAGTAATGTCCCGTCTCGA
GAAAGGCAAAGATGACATCGATAAGTTTAATGCTTCGGCTGCCAGTCTGCTAAAGTCCCA
TTTGGATACTTATGTGAACAATCAGCTAAGGCACTTGAGCTCCGTGTATCAAGTACAGGT
AAATCTGGCCAAGGATGTTCTTAAGAAGGTGGAAACCAACCGCGATCAGCATCGTGAATA
CGATGCCAATATGAAATCTGCCAAGGATTGGATAGCAAATGCCAAGGCTACAATTCAGTC
GGCGGGTGAAGGAGCAGGTTCCAAGGAGGCTCTTCAGCGTCGACTGGAGCAAATTCAGGA
TCTGATTCGCAACCGTGAGCTTGGCCAGAATTTGGTGCACACCGCTATTAATAATGGCGA
AAAGATAATAAGGAACACTCGCTCTGACGGACGTGACGCCATTAATACCGAGATGAAGGA
ACTGCAAACCGAATGGGATCGACTGGTGAAGAAAATGTCCACAGCCAAGGTGCAGTTGGA
GACAAATCTATTGCAATGGGCTGACTACAGTTCCAGCTACTCTCAGCTGCAGCAATGGAT
TACTGACCGGGAGGCCAAGTTGCAGCAGGCTTGTGAACAGAAGATCGTTAAGTCCAAGAG
GGGTCAACCTGGTCTCAGCAGTGGATTGAGCGAACGCAAGGCCAATCTTCGCCAGACGAA
CAACATTGTCCAGGATATTGTGTCATTTGAGCCCATGATTCAGTCGGTTACGTCCAAGGC
TTCGGTTCTTCAGCAGGGTGCTCCGGGCACTGAAATCTCCGATAAGTACGAGAATCTTAC
CAAGCAAGCTAAGGACTTGTACGAGAAACAGAAGAACACCATCGAAAGCTATCAGTCCTT
GATTGACGCGGGCAATGAATTTGCCACATGGCTGAGAAATGCCAAGGAACGATTGAGCAA
ATGCTCTGAACCCACGGGCGATAAACAAGCTCTGGCCGAGAAGACCCACCAGCTGAAGAT
TCTGCAGGGTGAGCTGCCGGAAGGCGCCCAAAAACTTAAGAATGCTCTGGAACAGGGCGA
GATCGCTTGTCGCAGTGCCGAGCCCGAGGATTGTGAGATTATCGAGCAGGAAGTGGCTCT
GCTTCAAGAAGAATTCGATGCCTACAGGGAAGCTCTTAATAAGGCCAAGGATTATCTGGA
AGTGGGTATTGTCAAGTGGTCCGACTACCAGGATCAGTACACCGAAGCTTTGGAGTGGTT
AAGTAAGACCGAAGCTTTGGTGCAATCCTACAACAAACTGCAGGATAGTTTGATCCAGAA
GAAGGTTGTTCTCGAGCAATTCCAGGGTCATCTGCAGACCCTATTCGACTGGCAGAAGAC
TCTGGATGATCTGAACATGAAGGCACAGGTTCTACTGGAGACTTGCTCCGATACAAGAAT
CAGCAATGCTATTATGCAACTGACCACCAAATACAATGCTCTACTAACTTTGGCCAAGGA
GGTTATGCGTCGCCTGGAGATGCACTACCAGGAGCATCAGCAGCATCACAGTCTGTACGA
GGAGTGCCAATCATGGATTGAGAAGACTCGTGAGAAGCTTTCCGAGTGCGAACAAATTCC
CGGAACTCTTAACGAGGTTCAAATCAAATTGAATACCGTAAAGAATCTTCGCCAAGGTTT
TGAAACCGGTCAGAATAAACTGCGTTATCTTTTGGAGCTCAAGGAGAAGGTGATAATGAA
CACCGAACAAAATGGTGCAGCCAAGATTCAGGAAGATACCGAAGCCTTAAAGCAGGACTT
TGACAAACTGTTGGTGGATCTGAACGATGTTCGCCAGAAATTGGCCAATCGTCTTGCCCA
GCTGGAGGAGATCTTTAAGCTGTACAAGATCCTGATTGAATGGCTGGAGGATGTGGAACC
GAGTGTCAAGACCAGTGATGAGTTCCTGAATGACTTGAGTGAGAAGCGAGCGGCGCTGGA
GAAGTTCCGCGTCATTCAGCGTGATATCAATGGCCACAATGATATTGTGGAAAAGATCAA
TCAGCGTCTTAAGGAGGACAACAGTTTGGATCTTAAGGACTTCCAGCCCGGCTTGACCAA
ATTCGATGACCTGCAGACCCAGGTGAATAAAATCATCGAGTCGCTGGAGAACCAGGTAAA
CAGCCACGAGAAATACAAGCAGGCCTACAATGAGCTGCAAGATTGGCTGCGACGCACTCG
CATTGAGGTGGAGCAGTGTGCCGACTGCCATGGCGAGAAGGATCAAGTGGAGAGTCGTCT
GAATCGATTGGGAGATATACAATCATCATCTCTGGAGGGCAAAGCCCTTCTTGAAGCTTG
TGAAGAGCTGAGTCAGGCTGTGATTGCCACCAGCGGAAGTGAAGGCCAGGACAATGTGGC
CCAGGAGATTAAGCATCTCACCTCGGAGTGGGAGACCCTCCAAACGATATCCCGCGATGC
TCGCAGCAGCTTAGAATCCTGCTTGGCCGCCTGGCAGACCTTCCTGCAGAAGTTCAACAA
GATCAACCTTTGGATCGAAACGATGAACAAGCGCGTTACCAAATCCCAGGAAGGCGAGAA
CAAGACACCCGAAGATTTGGTTAATGCCAAGGTAAGAACTCTTCGTCAAGTCGAGATCTC
GCAACTGTCGCACGCACCTCTAACCAAAAGAAAAGTAGTAAAAATGTAATCAAATATAAA
CATAGCCAAAGCGTGCACTTTAAGTAGAACTCACCGACAACAAAATTTGTATCTAAATAT
CTCGTACCGTGAGAAATTAAATCATGTACTAAACCCTCACTAATCACTACTGCTAACTTT
TCAGCTAATCACCTATTTGTATAATCAATTGCAGCTAATCATTTACACAGACACCTGTCT
AATGCCTAATTGCTTTATGTGCTATAATTAGCCAATATTAGATCTTGTAACTAAATATTA
TTTCTTTCTATTAGAAACTGCTTGAGGAAGTGCTGGCCGAGAAGGATAATGTGGAGGATT
TGAACGACAACTGTGAGCTTCTCATGGAGCAGAGTGCCTGCACTCGCATTCGTGACCAGA
CCATCGAAACTCAGGCCAACTACACCAAGCTCCTGACTTCCGCTCAGGGATTGGTTGCCA
AGATCGAGAAGAATCTGTCCGATCACACCGAGTTCCTTAACTATAAAAAGGAAATGGACG
CCTGGATCGAAAAGGCTCAACAGGTTCTCGACGATTGCTCCACCGATGGCGATGCTGCCA
TCATTGCCCAAAAACTGGACACGGTCAATGTAAGTTGTTTGCACTTATCATAAAAATATA
TATATTTTTTTCAGATTTTTATTGTTTTTTATTATATTTTAAATATAATTATAAACATCT
TATTCATTTTGCAGTCCTTGGCCTCTCGTCTTCCCGAGGGTCAGCATCTGTTGGCCTTGG
TGCAGGATGCCTACTCGAAGGCATCGAACATCACTCCAGAGGATAAGCAAGAGAAGCTGC
GGGAGCTGATGACCAAGGTTCGCGAGGATTGGGATGCCCTGGGACTGGCCGTTAAGCAAA
AGTTAAGTGACCTGAAGCAGGCGCAGAATCGTTGGAACGATTTTGCTGCCAACAAGGATA
AGCTTGAGAAGTGGCTCAATGAAACCGAAACGACACTCAAGGTGGCACCGGAAACCAAGG
GTGAACTGAGCGAAATGAAGACCCTGCTGGAACGATACAAGACCCTTTCCAATGAACTGA
AACTGAAGGGTAACGAGCTGGAGCAGCTGCAGTCGGAGGCTCGCGACCTGGGCACCGAAG
TGGATGCAGTGAATCGCTTGCAATCGCGATGCGACAAGCTCAAGAACGATTGTTCCGCTC
ACATTACGGCACTGGAACAGGAGATGTTCGATTATAATGCCTACCACCAGAGTCTGCAGG
ATGTGGAGAAGTGGCTGCTGCAGATATCCTTCCAGTTGATGGCCCACAATTCGCTGTTCA
TCTCGAATCGTGAACAGACTCAGGAGCAGATTAAACAGCACGAAGCTTTGTTGGTTGAGA
TTCAAAAGTACCAGACCAATTTGGATGACTTGAATGCCAAGGGTCAGGCGCAGATCAAGC
GTTATGAATCCTCAACACCAGCCATTCGTCCTACGGTTGAGTCACAGCTGAAGAATATCC
AAGATAGCTATAACTCACTGCTGCAAACGTCAGTGCAGATTAAGAACCGCCTGTTGGAAT
CGCTGGCCAAGTTCCAGGAGTACGAGGATACTTTGGATAGCATTATGCGTAATCTGGAGA
CATATGAGCCCATTATTCAGACCGAACTTGATGCTCCGGCTACCAGCTTGGAGTTGGCTC
AAAACCAATTGAGGTGTGCCCAGGAAATGCAGAACAAACTGAACAACGAGAAGTCCCGAC
TGGCAGCTGCCGTTCAGGCCTGTGAGGCAGCTACTGCCTCCATCAGTCGACCAAGTTCTC
CACTGGAAACAGCCATGCAGGCTATTCCCGAAAGGGAGCTCATTGTGCGCGCCAAGCTCG
AGGATCTGCTGGATCAGGTAGGATAATGTTTAATGCCTTTGCGATGCATTTGTAGAGTTG
CGACCACTTTCAATAGTTCAAAGTCAAGCAATTAAAATGAATGGAAGAATCATTTTGTAG
ATCTATGTTGTTCTATCATATTTTCTTAAAACCTTTTTAGATGTAATCAGTAGAGATTAT
GCTTGATTTCAAAACCTATTTTCTTTTTTAGATAGCTATTCTTCCATTCTATTATTCTTT
TATCACTATTATTTGCTAACCAATGACTTGTTCTTTTTATTAAACCCTTAACCCCACAAA
CCCAACACTGCCCTAACCCTTGTTGATTTGCCACTCTGCCCGTAAATGTTGTAAATTGCA
CTACCCACCAAAAAAATGCTATGCCTTGCGCTTTGCTGCCACAAAGAAACCGCCTCCAAA
GACTCGGAGCTCAACCGGAGGTGTCAGCACAGATGATGATAAAGACGAGGCTGATGTTGA
GATTCAGGTTGAGCTCAGCGATGTGAATGAGGCGCTTTTGGATCCCATTGCCCACGAGCG
TGTCAAGAACTATCGTCGCATAGTTCGCTTGAATAGCGCCCATGTGGGCAAGCTGAATGA
ATTAGTTGCTAAGGTAAGAGTAAGGTCTATTCCTACACAGGATCAAACAGGTGGCGGTCT
GCATGGCTATGATGTTTTAAATTGCTTGTTATGCTTAGAATATAACTTGTAACTCAATTT
AATTTAATTGCGTGTTTGTTTTTACTAGGTGCAATCCCACTTGGGTGGTTTGACTGCATC
CGTTAGCGAACTGGAGCAACAGCAGAAGCAGCGCGCCGAGCTGCAGGATTGGGTGAAGAA
GCAGCAGAGCTCCGTCTCCGACTGGATGATGCGTCCTTGCAAACTGCGCCCGGAGGCAGC
TCAACAGGAGCTGGTGTCCATGAACGATTTGCTAAACTCCATCGGTGACAAGCGGTCGCA
GTTGATGCTGGAAATGACAGGATCATGTAAGTGTTAGGTTTAAGATATACGCTAGCTAAT
AGGTTTCATGTAAAGTTTTGATCCTTGCATCAATCCTGTGACTCCCGTGATTTTATTATC
TATTTTCCCCTACATCAGTGGGCGACGAGGATACCGATTTGGACGATAACATTGACAAGC
TGGAATCTGAACTCATGGATGCCATTGCCAAGAAGCAGGCTGGTCAGAATGTAATCGATG
GCTATCGCCAGGGAATGGCTGATGTCCAGAACTGGTTCGATACACTGATCAAGCGCATGG
ACGTTTTGGATCGCGGTTCGGGTTTGAATTGTGCCCAGAAAATGGCGGCCATTAATGAGA
TCAAGAACGAATATGAGCTTCAAGGACATCCCAAGATTCAGGAGCTCAAGGGCAAGGCAG
CGCAGGTGGCGGAGGTCATCAGCAATCTCGATGGTCAGCAAGTGGAAGAGCAAATGAAGT
CACTGGATCGTCGCTTTGCTGATCTCGGCAAGCGCATCGATCGCAAGTCTCAACTCCTGG
ATGTGACCAACAAGGGTGTGGAGGGAGCCAAGGGCGAGATCGATCAACTCCAGAATTGGG
TGAAACAACAGATTGAGGAGCTGCAGGCACCCAAACCATTGGGTTACACTCCCAAGGATG
CCGAGGCACGCCAGCAGAAGATCAAGAGTCTGATGAAGGATGCCGAGGCCAAGCAATCCC
TGGCCGATGTCCTGGAGAAGCGTGTGGCCAACATGCAGCAGGAATTGGAACCTGTTGAGT
ACTCCCAACTGGAGTCCGCATTGCGTAATCTCAACACTGAAAACCGCAATCTATCGGGAG
TCCTAAAGGCTGAATTGGATCGTGCTCTGGAGGCCAGCAAGGCTCGCAAATCCCTGGAGA
ACGATTTGGACAAGGCACGCCAGTGGCTGAAGACCAAGATCTCCGAGGTGCGCAAGCTGC
CCGTGTATCATCCACTTACCTCTGCTGAGATCGAGAAAAAGATCCAGGAAAACCGGAAAT
ACGATGACGATGCCAAGCAGTTCAATGACAGCGTTTTGACTGATGTTCAGCGCCAAGCGG
CTAACATAATGAAGGATTGCGATGATGCCGACAAGGCTGCGCTTCAGCAGATCCTGGATG
AAATCGCTGCCGACTATCAGACCCTCAAGGATGAGAGCAGCAAGAGAGGAAAGTCTCTGG
ATGATCTCCTGCAAGGTCGCAAAGCCTTTGAGGATTCCATGAAGAACATGGGCGATTGGT
TGAACGAAATGGAAACCGCCACCGAAGGTGAGCTACGCACCACCAGTCTCCCCGTTTTGG
AGGAGCAGCTGGCCCATTACAAGAAGCTCCTCAGTGATGCCGAGAATAAGGGCGGCCTCA
TCAACGATGTTTCGGAGCAAGGAAAGAGCATCCTGCCCACACTTAGCAATGCCGATAAAT
TGAAACTCAACGATGATATCAAGAACATGAAGGATCGTTATGGCAGAATCAAGAATACCA
TCGATGATCGCGTGAACGCCTTGGGTGATCACATCAAGAAGTACAAGGATGCCAAGAGCA
GGTTGGCCGAGTGCAGTCAGTTCTTGGGTAATATTCAACAGAAACTCAGGGAACTCAATC
GCCCGATTGGATCCAGGATCGAAGATGTCCAGGACTTGTTGGGTGCCTATGAGGGAATTC
TCAAGGAACTCAAGGACAGCAAGAGCAAAATGGGCGATATGCAGATGGATGATTTGCCCG
AGTTGCAGAGCATTTTGGCCCAGCAGGATGATATGATTAAACTGATTGAAGATCAGTTGG
CCCATCTTCGCCAGCTTCTGCTGCTCCGCGAGCAGTTTATTGCTTTGATTAATGAGATTA
TTGCTTTTATCATGAAGTACACCGATGTTATCATAGACATTGAAAACTCACCTGATAGTC
TGGAGGATAAGATCAACAAGTACGATGATGTGATTGTGAAGATTCAGGAGTGCGAAGGTG
TCTTGGCCTCGGCCAATGATAAGGGCCAGAAGATTGCCTCCGAGGGTAATGCTGCCGATA
AGAACAGCATTACAGAGCAGTTGCAGTCCCTAAAGAATCAGCTGCAGAATCTCCGAAAGG
CGGTAGAATCGCAGCGCCAGAAGCATCAACTCCAACTGGAATCCCACAAGAAGATGGCCG
CCGAACTGAGTGAGATCCTCGATTGGTTGCACAGCCACGAGGGAGCGGCTAAGTCGCGTC
CTCTACTGGATCGGGATCCCGAGTCCGTGGAGCGCGAGCTGCAGAAGCACCAGTCTCTCA
GCCAGGACATCGAATCCTATCTAAATAAATTCAACAAAATCAATGATGGTGTCAAAACGG
AAATTGGAATGCCAAGTTCCCTGTTGGAAATGCTCTCCGAGGGCAGATCCCTGGTGGCTT
CACTGCCCCATGAATTGGAGGAGCGTGAAAAGTATCTGAAGAACAACCGCGACTCTCGTT
TGGAGTACATGCAACTGGTGGCGAAGTTCAATGACTGGGTCCATGAGGCCGAGTTGCGCC
TGCAGAACAGCCAGCATGGCATCGACTACGAGCACTTGGTCCAGGATCTCGACGAACACA
AGATCTTCTTTGGCAATGAGGCACCCATCCGTAACCTGGTGCACAAACAGATCCAGGAGG
CCGCCGATAAGATCTGGTCCTCGCTGAACAACTACGAACAGTCGGAACTCTCGGCGGAGT
TGGCTCAGTTCCAAACCAAGTTGACCAACACACTGGCCAATGCCAAGACCCAACAGAGTG
AACTGGAGAAGGAGGCGGAACGCTGGCGGGAATACCAACAGTCAATCGATCGCGTCAAGG
CCACCATCGAACGTACCAAGTTCGTTGATGAGCCCGTCCAAAATTTGGCTGGACTCCACT
TCAATATCCAGAAGCTGTCGCACGCCATTGGCAATGTTCAGGTGAGTTTGTTTAGGAATT
ATTGGGTGTATCTGGGATAGTAAACGCATTATAAACTTGATGAAATCCTTTTCAACGAAA
GAAAATGTTCTACCATTTCCGATTAAATAGTTCATTTATTTAGGTTTCAACTTTTGTCGT
TACTTAACATAAAAACCCAACATATTGAAGGCTCTTTTGTATGTATTTAGGCAGTCTTTT
GAATAGCCATGAATATTCAGCTGTTCGACTGCATGCTGTGTGCATATAAGTGTGCAGTCG
AAGAACCAGTTTTCCAAAAAATGACACATTGCACAAGGATGTGCCACTAACTTACATACA
TATGTACATATGCGAATGTATCGCCTTAAGAGCAACTTTATGGAGTGGCACCATAAAAAA
CCAAAGTGCAATCGTTTTGTATCTTTTGCGTTTCGTAGCAACGATTTTGCCGGCCGGCAA
AAGCAAATAAAATGCACTCTTGACTCGCATTCATATGCATTTAAGTGCTCCTCTCTTCGT
TGGAAAGCCTCCTCTCTTATTCACACTAAATATAAAGAGAGATTGCTTTATTTCTGAACT
GATAGTTGTTTATTGAACACGTTGAGTTTGTTCATTTGTTTACTTTCGTAAGCTTTTACC
TTGGGCACTCATTAAACTTTTAACCTACTAGTTCACTATTTGTCGAGCTTATCGTTCAGT
CGTCTGTCGTCGGACTTCCAGTTCGATTATAATTATTCAAGGCACTGGGCTCGATTTTTA
TGCTAGGCAACTGGAAAAAACAGCTGTTGTTGTTGCTGCTGCCGCGGAATGAATTAAGCT
CATGACATCATCAGCAGCGGCAACACTGTATCAAGCAACCAGTTTTGAGCCAGGGATGGA
TAAATCTTTAAACTACAATTTGATACTTAAAATTTTTGGATTTTAAAAGATAACAATTTA
TAATTAAAAATACATTTTTCAACTGCTTTTCTGTATGATTTTTCGTATTCCATTTTGTTG
GGATATTTCTAAAGGGCTTTAAAATATTTTTAAATCAATTTATATATTTTTTATATAATT
TATTCAGATACGTCAGTGCCCCCATATTTTAGTTTTTGATTTAGCCCTGGTTTTTCAATG
AGATATTGAGATACAAATGCTAAGTGCTCGTTTGTTGGTTTTTGCTGAGTGAGCTTTAAG
AGCACCGGCCCTTTGTCCTCTCTTTCGGCTCTTTTCTACACAGCTGTTTGGTTGTTGTAC
TTGTTATTCTTTGTTGTTTTTGCCTAGCAGGGCATGCCGGCAATTGTTGTTGCTGCCAAT
TGTGAAAGAGAGAATGGCAGCAATACAGAAAGAGAGTGACGTGCACACGGTGGCGTATGC
GTAATATACATATTATATGTGCGAAGCCCAACTTTGACCGCCCACGCCCACCCAAAAACG
ATGTTCAATACACATACATTATGCCAAATGGTTGAAAAAAAAACGTGTTTGCCCGGCTTT
TTTGCTCTCTTTCGACCCGTTCTCCGGCAAACTAAGAGAGATTCTAACTCGTGCTTATTT
GCTTTTGCTTTTGGGGCTGTTGGATTTTTTTTGAGTTCCGACGAATTCACTTCAAGTTGA
GACGTTTATCTGTGCGGTTGGCAGCGTATTTTAGACTCGTATTCGCGATTCGTACCATAC
ATATATGTGTATAGAAAGAGAGCAGAAGAAAGAAAGAGGAGAATCGCTACATTTGTTAAA
TTTGAATTACCCGTTTCGTTATAAAAAATTCGCCATGTGTCTTCGGCAAGGCGCAAATTG
AAATTGAGCAAAAGTAAAAATACAACAAAATCGCCAACCAGATAGACATCGATATCGAAA
AGCCAACGGCTAACGTCATCAGCCATTTAAAATCTATAAAAGACCAATAAGAAACCAAAC
AAAATAAAATAAAGGCCACAAAAGGAGGCTACACTCGAGGTGTGTGTGTGTGTGTGTGCG
TTTGTGTTTGTATAGAAAAATCTATAAAATTTATATATGAATTAAGCAACGTTTGCCTTT
CAACTCCGTGGGCCAGGCATATGTCAGAGTTGAAATAGGGCACACTTAGCAAACTCTAGA
CCAAAGACGTAAAACCGGAATTTCAGATATACCACTTACATATATGTATATATATTTTGT
ACCAACCGCGATTCCGGAATCGTCGTTACGTCAGAATCAATTTCATGCCGTTTGTTTTTT
TTTTTACCTTCGCACATTCACATTTCAGAGCCAAAACAGCGACTTAACGCTAGTCAACCA
GCAGGCCCAATCGTTGATCCGCCAGGCGGACGCTCGCAATCGCCAGCTGATCGAGCAGGA
TAACGCCGGACTGAATAGATCTTGGCAGGATCTGGTGCGCAGCCTGGAACAGCGACGCGA
CAACCTGCAACAGTTGGCCGAACATTGGGACGGCTTCGAGAACAGCCTGCACGCCTGGGA
AAAGGCACTTGGTCGACTGGAGGACAAGTTCCGCAATGTCGATCCGACTGTAAGATCCCG
ACGTCACTTGGAAGATACGAAGAATGCCATTCAGGTGAGTTGCGACATTTTCGGGTGACA
CTGGGAAAAAGTCACCTGAGGAGTGTATTATTTTAAAAGGGGCTTGGATTGGATTCAACA
TATGAAAGAGTAGATTTCTTTATTATCATTTCTTTATTTTATTTAAAAATATCCCTCTCT
TTCATACATTTGATAACAAATCATGTTCATATCACAGTGTGTTTGCACTTGGGGGGCACC
CATTCATTCAGCTTCGTTGTGGCAAAACCGCCCTCCCTTGGGGGCTTTTATGTTTGTCAA
ATATTTTTACCAATATCCATGCATAAACACATTCCGACAGATATGTAAGTGTTAGATATA
TATGTATGTAGTATATTCGTTTATTGTATAGCCGTGCCGACATCAAGTTCATGGTCACGT
TGTGGACCGGAGCTTGCGCTCTTGTAGTTTATCACGCTCTTCGGACTCTCTTAAAACGAC
TCGAGCTTCTCGAAAGCCATGGAGCAGCTGAGTTTTCGAGGCAGCTCCAAAATATACATA
GCCAACGATGTGTTTTGAATGATTAACACGGAAAGCCACTAAATCACAGCAATCAAGAGT
GCGAATAGCGAATAACAACAAAACAACATTCTAACTTTCGGTTTCGGTAGACTCTTGATT
TTAGCTAACCTACAGAACCAGAGATACTCCGATGATTAATGAGCCATAAATAACTTGAAA
CTGTTTGCATACACCTGATTTTATTTATATTTACATATTAATTGCATTATTATATTGTAA
CTTCACGAACTCGAGTTAGTTAACTAAACCAGCAATTATCATTTGTAGTACTTATCAGCA
ATGATTTGAGTGATTTGTAGGCGAGTGAAATCACTGTTTGGAGCGATAACAACTTTGGAC
GCTTGTTTTCAATCGGTCAACTAAAAATAGTACGAATACACAAATTAAGTAACTGAAAAA
GGAAGTCCCACCTCAACGTCAATAGCAGGCTTTCAAATCACATTTCAATTGAAGCAATTT
TCAGCCATAAAAGCTAGGCCCGTCCAAATCAAACTAACGATGTTGTCATACACGTCCCAT
ATAAAGCAGCATTCAGCGATAACGAAACAAAAAAAATGAAACCATCAAACTTGCCAATGA
TAAACAAAGACAAACAAACACTTAGTTAAGGTTTTAGTTTGTCTTTTCGAAACTATAAAT
TGTATTTCTTTTTTGTTTCATGCTTAAACCACATATTTCATCTTCTCGATCAAATAACCT
CAAGCTCCAAAAGCTGCCAAGTCAAGTCAACAAATTTATTTACTTTTATGCGGCGGTGAC
CTTCCAGAAAAACTGGAAATAAAACCGAAATTGAGGGAGATACACAAAAAAGAGATCTAG
AATGTATAGCATCACATAACCACACCAAATGAATCATAATTGAACAAACATTGTAATTAG
TAGTAATAATTTCTTATATTTTATAGGAACTGCGTGAAGAATCAAATCAACTTAAATCAT
CACATAAAGAAATCGAGGCGCTCTCTAAATCCATCCTCACATTCCTTGGGGAAGTACACA
AACCCTCGGCGGAGGCCATACAGGCCAAAGTGGATAAGTTAGTTGAACAGCAGGCCAAGT
GAGTACCCACCGAACTTACCAATTACCAGAGCCATATACCTTATACTACTACATACCAAT
GTGCCTAACTACGCGTGACTGGGGACCCAAAAAGTGAAAAAAAAATGCCAAAAACAAAAC
ACAAACAAAGCTCCCAATCGAAGCGTTTAATTCCGGAAATTGTATTGGCTTGCATACATT
ATATCCAGCTGCCAAACTTGTTGCCTAATGAAAATAAATGGCAATTTAGAGAACTTAACT
GGTTACAGATGAATATCGCAGCGGCTTTCATGTTTATATCACACTCATATTTAAAGTGCT
ATGAGGCAATATTCTAACAGAACTTTTTACAGCTAAACTACATACTTATAAGGTTTAGTT
AGTTAGAGCTCTAAAAAGAAATGCTTCTCGCCTTTTCAAACCTTTTACTTGTTGCTTGGC
CCTCGAAATGCCATCTTATAGTTATAGTTGAGTCGAAATCTGACGTCAGACCAAGTGTTA
CGCTTCGTTGTCGGCGTTGTTTTGTGTGCATTACGTAAGCCGAGGCTTATAGTTTTTTTT
TTGTACCCCTCTCAGTCTGCTATTTCCCGAAATAATTGTTATTTTCATTGTTCTGGGAAT
GAGCCGTTTATGACGGAAAACTCTTTATTTTTAATCACTTGTTTTCTCTTTGTTTTTTTT
TTTTTTTGGGCTATCCCGGTCTTCAAAGAACTGTGCCAAAGCTTCGGTCTTATCAAACGC
GATAGGGTTCTTAGGAGCTATTAGATATATATATATATATATTACGTGTAGTATGCTTTT
TGCTTTTGCGATAAGCTACACAGCGAAAGAAGAATTCTTACTTGTTTTTATCGGAAATGC
CTAATATTTATTTATATATGTGTTGTTGCCTGGCGCTAGAAAAACACAGAAACTGTGCCA
ATATGCCAATTCATTTTATTGCTCTTGTTGTTCATTGTATCTTTGAAATTCTTGTGGATT
TTCTTTCGCTAATTAATCACGTGCCAAAAGTTTGGCAACATGTTGCCAGCAACATTTGTA
TATGTTGATAAGCCACGATATTCGGATCGCGTAAACACTTTTCCGCTGACAGCGCCCCAC
ATTTCTCCCATTTGGCCTTTCACACTGACACAATTTTTGGGAAGCTCACCGGCCCCTCGT
TTTCCCCCCAAAACTATTTTGTTTTATTTTTACACACAATTTGTTGTTTTCTTGACAGCA
GTCTGCTTGAAAAACGAGAGCAGCAGCTGTGTCTATAATTTTCCTCAAATTTTCCCCGCA
TTTTCCCTCAAAAACTCACCGCAATGTGCGTAAGTTTTCAGTAGGCTTAAAGCGAGTGAA
ATGACAAATGTTTTGACTGCTGCCAGACGATGACGGGTTCTATACATCATGTACAAATTC
GATGGATAATCACGTTTCACTGTTGATTGATTAAATAACAATCGAATATCATTTCGATGT
ACATCACTTGAATGATATAATAATAATATAATGTCATTCCATTGATTACCCAGAGGCTTC
CCCTTTAATTCACTGAAGTATTTCTTCCTTTAATTGTGATCACATTCAAATGTGGCTGTC
CCAAACTGAACAAATAAACTATGCCATCATCGCGCCAAAAAGAGTGATCTAATATACCTC
CAAGCGGCATGTCATCGATAATTATATAGACACAACTGAGATATATTGTATATCCCAAAA
TGCGTCGCAAAATTTCAATGCATTTACACACTTGAGATATTAAACACATTGTTTCGGCAT
GCAAAAATCTAATCAGCAAAAATACATTAAGTCTCTTGCGTTTTGTGGGGATTTAATAAT
TTATTTTTAACAATTCGCGGCGTTTGTGAGCGTGTTTATCTTGAAGGCGACAATTAACTC
CATTAGCGAGTAAATTTGATTTTTGCACAAATACTATATAGAGATTTTAAAGCAGAATAT
AGGTATATATATATAGGTACATATATGCCATTGATGAAATGCCTGAGAGGAAACAAGCTA
GGCAATGTGAGCAGAATGTGTAAACAAAAAGCCGAAAAAATCATAAAGAATAAGTAAATA
AAAAGCACAAGTGAAAATTGAATTTTTTGCTTGAGTTTTGGGTGACTTCATCAGTAAGAA
ATGGTAAAAGTATGAAGAAAAGGTGAACTAAAAACCATATGTGCAACTTATTAAAGTGAA
TGACAAGCGAACCACTGCCGACTTGCAGATTCACTAACCTTATCAGGTGTATAAGCCATC
ATTAGGCACCCAAAGAAATCCAAGTTTAATCTGAGATTTGCATATGCATTTGCATGAACA
ATTTGTCATTCGGGTAAGGCCGAAATAAAAAAGAGAAAATCATAAATAACAGACAACAAC
AGAAACGAATAATAATAAAAACTTTGACCAAATGAGGTAATCGGGTAATAATAAGTATAT
TTTCGCCACTGTTAGTCGTTAACAGAGTGCTGTTAGCTTTTTCGTTCCATTCAACTGCTT
TGCTCTCTCCTTTTCTTTTTCCGGTTCTCTCGAGTGGTAGGTTTATTGCCGGCTTTTCTT
ATCTAAACCGGTGAATTGGCATTATGGTCTTATCAATCAGCCCTGCATTTGGTGTACTAT
GTTGCCCTGGAAAAGGGTGAGAGTTTCCTGCTAAGTTCGTTGATTTTAGCCGGTTTATTC
AATGTCAAGCGATTTGGCCATAAAAATAATAGCTTTCAGTTCCCACTTTTGCTCAGATAT
TTCGGTGTGGTGAGTTTGGGCTCTTAGCAGTTTTCGTTCTTTTATTTCCGCAGCGCCTTC
GTGCGCCATTAACGATCGACAGCCGACGAAAGCCGAAGCAAAGTTTTTGGCAATTTTTAG
CGTTGAGAATTCTATTCAAATCAGTTTTTATTTAGAGTTAGTTGCAAGCGGACGTGTTTC
TCAAACTGGATGGCTGGAAACTAAATGAAAGAGCAAACGAACGAAGCGACCGCAAATACA
TATACGCATATTTTTAAATCAAATTAATTAACTAAGAAGTAGTAAAGACCAGAGAAGCAG
CAAAGCAAAAAAAAAAAACACAATCAAACCGGCGCCCCAAGAATACAAGAGAGAGATGTA
TGACAATGGATATATATTCTTTTGGGCCAACGGCTGCTAATCGGAATTTACATTTCTTCT
CCCCTTCGATTCTTTCTATTTTCATGTTGAAGTTTCGAACGCCGCTTTGTGGATTACCAG
GCGTATACGTAACGAGCGAACAGCAACGAGTCCGGGAATTAATTTTCCATTTGCAGCGTC
TGCTTGGGTTTCACCGCAATTCCGCTTACGGAATTGAGGCACTGGAAGTCAAGCAGAGTG
CTCGCAAGTTCCAAAAGTTGAGCACACTTCTGCCTCCAAAAGTTACAGGAGGTCCGAAAG
TTGTCGCCAACGAGCCAAAATCGCAGACCGAAGACTGAGCAGCAATTAAAAATTGTGTAG
CTAATTGCCGGCCACTTACGCACACGTAGTTCAAGTCGTGAAAAGCATAAGGTGATTAAT
TTCCCACACATGAAAAAAAAAAATAGAAGAAGAAGATAGGAATCGCGTACTTAAACGAGA
GCTGTTAGAAATTTTGCAAGACTTGATTAAGTCATCGTAGATATGCAAAACATCACCGGT
CTCTGGTACTCGTATTGTCATATACTCGAATACCTGCCAGGGTCGTCAGGTGTGTTTGTT
TTTGTTATTTTCGCTTCATTCGATTCGCTAGAGAAACGGAGAGAAAGAGCATATTGAATC
GCAGGCGTTTCTACTTTAAACGATGACGTAGCCAAGGCGACAGAAATAGCCAGACCCAAA
TGCTTATCGTCGTCGCTGTGGGAATGATTACATTCCTACTACCGCCACAATTGATCAAAC
TATTTTTCGTAAATGTTTTGCTATATTTTGCGATTTGTTTTTATGCACACTCTCGTTTCG
TTTTGGAACAACACGCGCCAATTTATACCAATACCATTTGCCTTTCACTTTCACTCGTGC
TCGCCACGGCATTTCTAGCATATTTTGCCATTTAAATTAGAGCCGCGTACTAAATTTAAA
TCGTTAATTTGTACAAAATGGCAGCCGACTGAAAATAGCGTAGAGGAAAAATAATTTTCG
TATTTTTTTTTTTTGCTCTTAGATTTATTTTGCTTGCCTGTCGGCGGCGGCGGCAATTCA
AACCCAAACAAAATTGAGCAATTCACTAGTTCGATATTTGTTGGCTGCGAAAAATGACGC
CGAAATAATTCTGGCTAGTTTATAGACGAGTATCGTTTATTTCCGCTGCCCGATTTTCTC
AGTTTCGGCGCAGCGCATTTAACAATTAAATTTGAAAATGTGTTCAGCCGACTTTTCGGT
CAATTGGCCAAGAGCCAGAATGTGAGTTGACTTGGCCTCATCTTGGCCAGCATTTCGCTA
CGCCACTCGGTGTCTGTAAAGGGCAACAAACGTTCCATTAACGAATCCGTCATTCCATGC
CAAGTGCAATGGTTGGACATGAAAATAACGAACAAGTATGAACAACGTGATGCTTGAAGT
ATACCTCAAGCGCTTTTGCTTTGGGCCACCAGGGCGTATGAGTGATATGCGTCATATGCT
GGAAATACGGAGCGGAAATCAATGCGAATTTCTTTATATACGATCCATGTTACTCATTGA
TTTAATGCGTTCACTGCAACGCCCCAATGACGTCAGCTTGTCTACGGCCGAAATGCAAAT
CGAAAAAGCAAAAAAAAAAAACATAAATAAATGAGGGGAATATAAATTTAAACATGCGCC
GCTTTTAAAAATACACCCAAGCTAAAACTATAACAAAAACAAGACATTTTGAAAGTGGTG
CGTGTCCAAGAAGCGTTAGGGAATACATGTATTTATTTTTTTTCTTTCTTTGGCGGCTTT
TTAATGAAGAAAAGTTTCGCTCTTTGGCTCTCAATGGGATCAAGGCGATTTCGAATTATG
AGAAATGTACGAAAAACTTTTTCGAAAAATTGCCGAGGCCCAAGCAAATGTGCTCGAGGC
ATTTCATTTAGAAAACTCTCTTGTAGCCAAACGGCAGCATTCATTTTTCACGGAAATCTT
CGCAGCCTCGAGGCCAAAGCCCAGTGGATCTTACACACAAACACACATATATATATATAT
ATATAGCGATTTATATATATATGCGCAGCAAAAGAACATTGAAAACTTCAGAATATTTCA
GCCTTTTGTGCCAGCAGAATAACTTTTAGCACCACCAAATATCTCTATAGATAGAGGTCT
TTCAGATCTCTACGCGTGTACGGAATAGAACTTGGTCTATGCCATCAGGAACCGCGTGGT
CTTCACACTGTCTCCCCATCCACAGTGCATGCCATTGAATAACGTGCCCCTGAAACTTAA
AAAACCGCTCTGTTTCCTTTCAGATTGAACGACACTCTGCGCGATAAGGAGCAACAGGTT
AGCAAGGATCTCGAGGAGATCGAGCAAGTCTTCCGTCGCATCTCGCAGCTGCAGGACAAG
CTAAACGCGCTTCACGAGCAACTACAATCGGTTCACGTCTACGACGAGCACATAGCCCAA
ACGGAACAGCTCCTCATCACATTGAACAGCCAGGTGCAGCAGGCCGCCGAGGAGAGCAAA
TTACTGGTGGCCCAGACAACGGCCCACTACCAGGCCAAACAGAATCAGCTGCCCAGCGAT
ATTGCCCAGGAGTTTACGGCTCTTGAGCTACTTGCCGAACGCGTCCAAGTGACCATGGAG
ACCAAAGAGAAGGATTTCAAGCGGGCCAAGACCGTGCGCACCGAATATGTGGACGGTGTG
GACGAGGTGCAGCGTTGGCTGCTCCAGGCAGAGGTGCAGGTGCAGGAGAGAAGCCTCACA
CCCACACAGATGAAGGAGCTGCTGCAGCGCATTAACCACGAGATCACCGCCATCTACGAA
CGCTTCACCCTGGTCAAGACCAACGGTCAGCTGATCATCGAGAACTGTCGCAACAGCGAG
GAGAAGACGCTGGTGCAGACGACCATCGATCAGTTGGCCGCATCGCTGGCCCAGGTACGC
GGTTGGCTGGATGAGAAGAAGCAGGCGGTGGGCGATAGTCTGGACGCGTGGACGAGGTTC
ATGAACCTCTACCAGATCGTGATGTCGTGGGCATCCGAGAAGCGCAACTTCATTGACCAG
ACCATCGAGCTGCGCACCCTGCCCGAGGCACGCAACAAATTGAACGACTATGTGACGTCT
GTGAAGAGTATTAAACCGATTGTGAAGCATCTGAGCGAAATGGACAAGGAACTGGAGCAC
ATTGGCCAAGTGACGACTGTGGGCGATCTCAAGGACAAACTGCAGGAGGCCGAGGATGCG
AAGATATCCGTGGAAGCGGTGCTGCTAGAGAGGGTAAAGTGGCAATCCAACACCATCACT
ACCAGAGTGGAGGAATTTTTGGGGAATCCATCAATTATTCAACTCTTTTCCCCCACATTC
TATATTGTATCTTGTAGAACTCCCTGCTGCAAGAGGCCTGCGAGGAATGGGACCAATGTG
AACGCAAGATTAAGGATATACGCTCCTGGCACGAAAAGACGAAGCAGGGACTGGACTCCT
CGCAGCAGCAGAAGAAACCGCTGCGCGATCAGCTCGGTTTCTGTGAGAAGACCCTGGCCG
ATATCAATGTGCAGAAAACGAAACTGAGACTGTCCATCGAAAAACTGGAGGTAAGTATTG
GGGGCGTTGGCATGGCTAATCCCTGCTTACCATCTCGTCCACAGGTTCATTTCCGCAATG
GCATGGGCGGTGATCCGCGCCTGAGCGAGAACGTCGATGATCTGGTGCGCGTGCTCGACG
GCCTCGGCGAATTGGTCAAGGCCAAGTCGCAGAGCCTCGAGCAGACGCTGGCCCAGATCG
ACGTTTACCAACAGCAGATGCAGTCCCTGCGCCAGCGTATCATCCAGGAGGAGCAACAGC
TCCGCCTGGTGATGGCGCCCACGTACTTGCCGCACGATCGCGAGCGCGCATTAGCCGAGC
AACAGGTACGTACCGTCCAGACTTTGCTAGATCTACAATAGTTAGACCCGTTTAGCAAAC
AGCTAGGCAGCTAGGAGTTAAATTCAGTTGTAGCAGATATATGACCAGGATACTCGTTAG
TAAAGTCGGTTATCCAATGTTGAAGCCCCACCCCTTTTGATATCTATCTCATTTCTTCAT
TGCTGTGAACGAACCTTCATCGCTATGAACAAACAGTTGACAGAACAACCAAACAAAGTT
ATTAACCCCTTACCCGAATATATAATATAAACTTGATTAATCTTTGAAATCGTTTTGCCC
CAAACGCTTTACTGTGTGCGGGTAGGTCTGAAGAAAAACAGTTGCACGGTGGCTGCGTAT
ATTTAAGTTATTTTATTTAGTTTGTTTAAAAACAAATGAAATCAAGGCGCCTTATTATTT
TCCTATTTTCATTACATTCTATTTTGTTCGGCTAAATTCTATTACGTTTTTTTATTTTCG
AATTCGTTTTGCGCCATTATATCTCACACAAATGCTCACACCAATCAGCATTCATCATTT
TCATTTCATCTTTGTGTTTCCTTATGTTCAAACATCATTCATCGCTCATTTACCAACCGT
GCAGCTCACAATCTCAAAACTCATTGCTTTCACATCGCTCTCATTGGGAAAACTACCCAC
AAAATTATACCACATCAATATCGGATCTTTAAGATCTTTAAGAACTCATCATTACCATTT
GTCACGTGCTGCGGCCCAAAAGCATTTTGAATGCCAGAAAAAAACAAATAAGTTCTTGCT
GTCAGGGTTAGGCCACCCAGATGAGAAAAGCGAATTCCTCCTCCAGATAATCACACGTAC
TATTTTTAGAGCCACGCTGCTTGCCATTGTTTTTTTTTTTGTTGTTCATAAACAAAGTGA
TTATATTTAGAACCAGGTGGCCTAGCAGCAATAGGTTAAAATCAAGATTTCCCTAGTTTT
TTAAATAGCTCGTAAATTTATTACTAAAATTTAACTTTACATTGCGAACTGCAATGTTGG
CGGTAAGTGGCAATCTTAGAATTCAATTCAATTTGGGGCAGTAGCTAATTTTGATGATAT
TTGTTGGGGCAGCTCTTGCTATGAGAACAATTTTTGATTTCCCTTCACCTGACCTTTCAC
ACACACACACACACACACACAAGAGAAAGTACAGTCATCACATCGCATTTAAATCGTCAC
ATCTTATGGCACATTTATGACACATTAAGCTTTGGCCTAGACATTTAAACAACAATACTT
TTGGTTTAATTTCATTTACTTTTTATTTTAGTTTTTTTTTTTTTTTTGATTTATTCATTT
AGCCAGCTTAGCCAAGCAATCATAATATTCTTCACCAAGCAGCTCTTTCTCTTTCTCTCT
ATAAATCTTTCTATATCTTTCTGGTATCTTGTAATAGCGAAAGTCGGTTAATATTTAATT
ATGGTTACGGTTATAATTTGATTTGGTATTTTATTTTTGACAATTGTATTTCTTTTTATC
TTTTCTCTACGTAACTTTTGTTGAATATAAACAAAAAACCTGGTGTCGTTGCGCTGAAAA
CAATCGAAAAACAAACATGCAAATTATTAAACACACTTCATAAACATTGTTCTTACTAAT
CGTATATTAAACCAATTACAACTTATCTTGGGCTTTGCTCGCTTGCTTGTTATGCTACTT
ACAAAACGGTGACTAATTCAAATCTGCCCCATTCCGATTTAACCTTTAACCCCATCGAAT
AACAACCCCTTATCACACACAAACACACACACGTATATAAACATACATGGGTACTGCTTA
CTTCTTCTAATAAATCGAAATATCGAACATGGTGAATGGTCGCTTTTCCTGTATCTATCC
CACATGGCGTATGATGTGCTCGCTGTCTATGAAATACCATAAACGATACTCAATATATAT
GCTGACATCTCTTGTATTTCTTCTCTATATATATATATAAATATATATCTCTGCTCTCAC
GCCAAACATTCGATCCATGCACCATCTATACCCTATATACGAACAATAGGCATGCCGGGA
ACGTGTCAAAAATCTGCATTCGAAAATAACTGCACGTAATGAGCGCATCAAGTTGTTAAT
ACATCGCGGCACGCCGGACGATGCCAAGCTAGAGATTTAGGATGCCACAACCTTAACCAT
AAGATAAAGCCAATCTAGGACTAGATCAAAGCCAAAGCAGCCACCCCGGCGTCTTCCGTT
TGCCCCTGCCACCGATTTCCTTCTCCCAGGAACGGTGGCTACGGTACAACTGTCAACTGC
CGTCATTACTCTAATCAATGAAACATGACCCGTGTTTTAGAATTTACTATTATCTATATA
TATATATATATATATATATACATACATATATACTATTTTACAGAATAAATTAAATTACCG
AATTATATTTATAAAACGCAAGCCCCAATCGAGTATAATTTATGAGGGAGTTAGGATTTG
CAACTTTTTACTCTTAGGTAGCTTAGCCTTGAGTCCCCATTTTTCAAAACCCCTGCAATC
ATATCAAAGCTAACGTTTTTGGCAAATCTTCCCCCCATCTCTCCCACTTTCTCTCACTCT
GATACGTGAACCGTGATGATGAACAATTAGGCAATGCGGGAATCAATCGATGGCATGCAG
CAAGTCTACGATGCGACCGCTCGAAAGTCCTATGCGCTGGATCCCCATTCAGTGGTGACC
ACTTCATCGACTGTCTCGTTGCTTATGAAGCCAACGGCGGCAGTAGGTCTAACCTATGCT
GAAGTGCTGTCGGGACAAGCGAGTCCGGTAAGCAGCGGTAATGAATCGGTAACCAATTCC
CGACCAGAACGAGACCCCTCCACGACGACAACAACAACGACAACACGGCAGCAACAATCG
AACGATACTCAGAACACGACCACTATTACAACCATTAAGACTACCACAACTACGACAACG
ACTTCGAGAAGTACGCACGGCGATGATGATCAAAGCCAGGAGAGACAAGAGCTCAATGGC
GGTGGCAGCACCACAGCCACAGCAAACTATAAGCGCCCCCAACAGGTCACACCACCCAGC
GAGAATACCTCAAACACGGTTCCTAACACAGCTACGACAACGATAACCAATCCCAATATC
CAGTTCATCGAAAGCGAGCGGAGGCATCAGCATCACCACGCGAAAACGGGTAAGAAGCTT
CATGCGCCGCGGCCAGAACGACGTGGTCGATCGCCCAGACGACGACCACCTCAACAGCAA
AAGCCAGTGGAATCATCTCAACAACCCTCGATCGAAATTCAATTGGAGCGCCAGCAACCA
CAAGAACAGGAGCAACTATTCTTGCCAGCTGATGACCGAACTAGATCTCGCAGCCCCATG
TGGGTACCAGGATCGACTTCCTACGCTGAGGTTCTTCGGGGACTAGAGCTGGAGCGGATC
AGGGCCGAACAGCAGGCCGCCCAGGCAGTTCAGGGACGTTCCGATCTGACCATTCAGGAT
GTTGTAGACGCTAGCGCCGAAGTTGCAGGCAGTATTTACATACCCCAACCAGATCCAGAG
CCGCCCATTAAGGAAACGCAGCAGCCACAGCCACCACAACTGGAACAGTATATTACCGAA
ACGAGCACATTACTTGACTATTCGACTACCCAGCAACAGGAACAGAAACCCCCAATTAAT
TACGAAGTCCCAATGACTGCCGAAGAGATTGCAGCCACCTACTTGCAGCCCGATCCGCAG
TTGTATCAGACAATGTACGAAAACGTGGCCGATAGCGGTCAGTGGGGTTTTGTCACGGGT
TCGACGACAGATCCACAGCAGCAGCAGGCTCCACAGAACTACTACGAGCAGATAATGCAG
ATGCAGCAGTATCCCATACAGTATCAACAGGTGGCTGTACCACCAGCCGCCACTACGCAA
TATCAGCTTTTAGCAGGTTACTATCAGCCGGTGGCTCAAACGGAGGCCTATTCCACGGTT
TATCCGGCAGAACCAAATCAAATCTACTATGCACCACAAGCGACGGAGTACTCGCAGGAA
TTTTCACAGCAGCAGGAGCAGCAAGTCGAACCTATGCTTGAATACCAGCAGGAAGCAGTG
GAGCAGACATATCTGCTTGATCCATATCGTGCGGAGAGCACTCTTCCCTCGACGACCGGC
AACAGCGTGCTGGATCGCGTTGTTACCACACTGGCATCCATCGTTCAACAGAGTGCAGAA
CCCCTGACCACCAGCACCCAGCAAATCGAACCTCTTGCTACTGTTGTCCAGAGCGAGCCG
TACTATATTGAAGAGCATGTTCAAATGCTGCGACCAGTAGAGCCACAGGAACTTGAGCTG
GACGAACCGCGACCTGATATCACATTTGGTCAGTTTGAGGTTGATGCTATTGAAACCATA
CCATTGGATGAACCACAAGCTCCACAAACGGAAGTCGAGACTACTGAGTCTCAAGTCCGT
ACTCAACAAACTATTACGACAACCACCTATGTAACAGAGACTTCAAATGTCTCCGAACAG
ACACAGCCAACTGTGATAATGCAGCAGACTCAGGAAGTCATCGCGATACCAGATACACCA
GAGATCCCCACAGAAGAGCCCACAAATGTTGTGGTGCACCCCAAGCCTCAGAGGCGAAGC
AACCAACAGGTCCGGCCCCAGGACATTAGCACAGGCAGCACTTACGCCGAAGTCCTTTTC
GGTCTCCACCACAAAGAACATCCAGTTTTCCAGCCATCCAGTCAGCAACCGACCCCAGTG
CGCCTCACGTCCTCGCCGCCTTTGCAACGCAAGACAGAACAGGCTGGTCCTATCAGTAAC
ACAGCTTTTACCAGTAAGACTACCCAACCAGGCCGTCAAGTCGAGAAATCGACGACATGG
GAACACAAGAATGATAATGTAGACTCACGAAACTCGCGAAGTAAGAGAGTGAGGCACGAA
GCGCAACCGGAACCACTACCGATTAAACAGAGTACCAGGAAAGACGGTAGGACGGTTAGA
AAGCCCCAGTCTGCGGATACAAATGGTATTGCCTCGGTGGAAACCAAAGTTGTTGTGGAT
ACCCCAGCTCCCAGTGTTGTAGTTGAAGAGACTTCAAAGCCTGAGCCAAAGCCAAGAAAA
TCGAAGAAGTCTAAGAAGACTACTACTGATAATGTGGTTGAATCAGCCGTCGATATTTCC
GTGCCATCTAAGAAAGATACGCAATCGGTCCTTCCCTCTGTAGGGAAAAAGGAAACTGTG
GTCGAAAAATCTGTGATAAAGAAAACCGTTGAACCATCTGTTGAGCCAGTAGAACCAGTT
CCAGTTCCCTCGAAGAGAGAAAAGAAACACAAGCCGGTCAAGGAAAAGGAAACTCCTCAG
TCAGATGAACCAGTTCTTGAAGTTTCACCAGTTGCTCCAACCAGAAAAGAGAAGAAACAA
GTCAAGACAGTTGTTAAGAATGTTGAAACTACCATCAGGAACGAACCATTAATTGAAAAG
GAGACTTCTAAGCCAGCTGATGTTCCAAAGACACAAGTAAAGCAAACTAAATCTGTGGTC
GAAACGGTAGTTGAAAAGAAGGTTCTCCAACCAGTCGTTACTGAGGACGCAGAGTTAGCA
AAGTCTGTAACACCGGCAGCGCCTTCGAAGAAGGACAAGAAAAAGAACAAGACAGTTGTT
GAGCCAGAAGTGATAAAGAAGCCAACTGAGATTGTTATCGAAAAGGAGGTAGTAACGCCA
ACTGTGATTGAAACAACCGATGTTTCTCAAGTACAAGAACAACCAACTTCTCCTACTTCT
TCGAAAAAGGAAAAGAAACAGTCGAAAAAAATTGTTGAGACCTCTGTCATTGTCACAGAA
AATGTGGAACCGGCTGTTCAGCTAGAGGCTGCTCCTCCACTGCCCACGAAGAAGGACAAA
AAACGGTCTAAGAAGGAACCTAAGGAAGATATTGAAATTTCTTTGCCATCGGAGCCGTTA
GTTTCTGTTCAGGAAACCGTTGAAAGTGTTGAAACCTTATCCGAAACAATTCCTGAATCA
AAATTAGAAGGAGAAAAGGTGACAATTCAATATGAAAATGTTTTTTCAGATTCTGCACCT
AAAACAACCAACACTGTAACCGAAGATTTGGCATCATCAATTGATGTTCCACCCACCAAT
ATAACTGAGACTATTATCGAAGGCGAGCCCACGGTTACCACATCGACTAATACCATTTCA
ACGGAAAGTGGAACTACAACTATCACAACGCGAACAATAACCAAGCATATTACCAAGCGC
ATAGTGAAGCGTATTGTAGATGGTAAGGAGGAGATTGTTGAAGAAGATGTCATTGATGAT
TTGCCAGAAGAGAACATCTGCGTTGAGCAGTACAATCTACCAACAATCGAAACCACCACC
AATGACGTGCCAATCGATGTGACCGGATTCGCTACAACCCAGGATACAATCGTACAGCAG
GGATCGATAACTAAGACCGTTATTACCAAGACAAAGCGCATCCTGAAACGCATCACCGAA
GACGGAGAGGAAATAGTTGAGGAGATCTTCGAGGATGAACCCGAGGTGGAGCGCGACGTT
ACACTACTGCCAACAACAGTGGTGACTTCGTTGGATGTCATTAAGGATGCTGCCCATAAT
GTGGTTGCGGAAGTTATTAAACAGGCTGAGGAAATAACGCAACCTGAATTGCAAGAATTG
CCTGCTAAGGTAGAAAGTCCCACTGAACCAGAAGTTATCAGCGAAGTTGTTGTTGAGCAG
GAGCAAAATAAGCCACAAAAGCCTTCGAGAAAGGACAAGAAGAAGCAAAAGTTATTGGAG
AACCAACCAGAAACTGTAATCGAAACGAAGGTTGTTGAAATTGTCAAGCCGCAACAAGAA
ATCACAGAGCCCCAAACAGAAATCACAGAGCCCCTGAACACAACAAGTGCAATTACAACG
GATAATAACCAAACCGTTTCGTCGGAGCAAACTACTGTCAGCGATGATAGTGGCCTCATT
AAGACCACAGTTATTCGTACAACCAAAATCGTAAAGAAAATCTCAAACAATCAGCAGGAA
AGTCAGGAGATGAACTCTTCCACCTATTCAGATGCACCCTCGTCTTTGGGTTCTTACGAT
TTGGCGGAAGAAGCAATAGAACCTGCTAAGATTGAAAAATCAGAATCGAATAGCCGTGAA
ATTAGCGATGAGGGCGTGGTTAAAACCACTAAAACTACAACTACCAAAACAATCATATCC
CCCAAGGTAGAAGAAGTCCAAGAGGAGCCATCATTGCAAGTGACATCCACTGTGTCGCCT
CCAATCGATATTGAGTCTGAGGAGGGTGGCGTAATAAAAACAACTATTGTGCGTACCACC
AAAATTGTCAAGAAGATTTCCAATGAGACCGAAAATATCAGCGAGACAAGCAGTGAACCC
GAAGTATCTCTACCAATTGTGGAAACAGTCATTCAAGATGCACCTGTAGTAGCTGAATCG
GTTACAACCGAATCAAATAGCGATGGTATAACCAAGACCACAACGACGCGGACTACAAAG
GTTGTGGCCAAGACTGTCACCGAAAATGAACAAGAAATCCTTAATCTACCGGATGTTCCT
GTTGAACCAGAGAATACAACCGTTTTGGGTGTAATTGAAACCGTCGAACTGCCAGAAGTT
CCGGAGGCCCCTGTTGGAGTCGAGGACAAGCTCCTAGTCACGGCAACATCTACTAAACTT
TCCAAGGCTAATCAAGAAAAGTCCAAAATATTGGACTTTATTAGCGCAGAACAAAATGCG
ACTGATAAATATATAGCGCCTGGAAAAACTGTACCGCAGATTCCAGTTATCGAGGAGCTT
GAGAACAGTTATCCAATTGAAGAAAGTACGGCACCTGAGCCAGAATCTTCAGGTGTTGGG
GATGTTGTCAAGACCACAATTGTTCGAACAACGAAAATTGTTAAAAAGGTAACCCAAAAC
ACGGAACAAAGCGTCAATGTAATCATCGATGCTCCTGAGCCGGAGACTGAAAAAACGGAA
CCAGAAGAGCCTATTGAGGAGGCTAGTGGTGGTGTGACTAAGACAACAACTGTGCGTACT
ACGAAGATCGTGAAGAAGCTGAATGAAGATGGTGAAACAACCACGGAGGAGACCAGAACT
GCCAGTGACCCAGTGACAGTGCGCGAACCTTCGCCAGCTTTTTCGGAAGTTCCGAGCGAT
ACTTCAACCACATCCAGCCAAATCGATGGGGCAATTATCAAAACTACGACGATTCGCACG
ATGCGCATTACAAAGAGGGTCTCCAATGACGGACGTATTCACCTTACGGAAAGCGAGACA
CCAAGTGATGTAATCGTAACTTCTAGCATCGAAATGCCCGATCAACGACCAATTAGTCCA
CTTATATCGTCGAGGTCAACCTCTCCTGCTGTGACTCCTAGTTCCGAACTAAAGCTAGAT
AATTTGGGTGCAAATATTCAGTTAGGATTGAAAGACAGTCCGACCGGGGTCAAGGTTATT
GGCATCGAAACTAGCACAGAGAACTTGCCAAAGCTTTCTGAACAGCAGTTGGCTACAAGC
AAGACTAATGGGGACATTAACACGACGGATAGTATTACCACTACTACGACGACCACCAGG
AATACGATACTTACGACTACGCAACGACGAAGCTTCGAAACCGAAGATGGCACAAATGTT
CTTTTCGTGGGAGAAGGCATTGACGGTGCATATCCACCGGGCACAGTTCAAAAAATTTCC
CTTATTACCCATGAAGAGAAGCTGAAGACACCTATTGTGAAAATGCATCTTGATTTTCCG
GAGGTTAGTCTTCGGGTGACCGAGACTGTGACTGAAAATGTGGAATCCCTGCAAAGAACA
GCCGAAAGTAATGAAAATTCCGTGATTGAAGTTGTTGAATTGTCCAAATCTGAAGTTCCA
GAAGCAATAGAATTGAAGACAGCTCCCGTTGATGATCATGTTAGCAAGTTAGACGAACTA
GTCAAGATCCCAGAAGCGACCCCAACAGTTTTACCCGAAAGTAATCCTGCAGAATTAAGT
CCCGAAGAACAGAAGCTTTTCGAGGATATTCAGAAGAAATTGTCTAAGAAAGATAAAAAG
AAGCGCCCAGCCATTCCAGAAGAATTTATTAAGCAAGAAACGGTTCAGGTTCTTCTAGAA
GAAAGCAAAGGTAATGATGCTCCTAATGTTGTCCCAGTAGTTGAAGAACTTACGGATGTC
GCTAAACCCTTAGATAAGCAGGACCCTGTTGCCCCGTCTGTAAATGTAGAAATAGTTTCC
GAAACTACACTTGTTTCAAACACTGATGACGGCGAAGTAGATACTAAGCTGATCCCTGTT
CCAGAGTCAGAGAAACTGCTCAACATCTTTGAAGACTCGTCCCTAATCTCAACCTCTAAG
TTAATCGAGCAAAGCAATTCAGAAATTCTTTACCACGAATCTATAGTAGAAGTTGTCCCT
GTTTCTACCCAAGAAGAAGTGCAAGTAGAAAATCCATGTGAAACTCAATCAAGCCCTGCT
CCTACTAATATCGCTAATGAAATTGTTCCTGATAAACATAGCGCATTAATTGCTGAAGCA
TTTGTGGCTAACACGGTAAGCACTTTAAGTATAATCACTAATATTGAGAAACTTTCACCT
TTAAACAAAATATTTGAAATTCCCAAATTTGACATATCCAAATTTACTATTGCTGAGGGT
AATTATCACATAATAAATTCTAAAACTAAACCAATTGAGAAGTTGGATCCTACCGAAACT
GTTCCCGTATCGCCACCAAAGTCGGTAAGCGTCGACATTGACACCGAAACAAAAATGGAA
TCTACCGTCACCGACGTGGGTTCAACAACAACAACACAGGTTTCCAATGTAGACCAACAA
AAAGATAATATTCCAGCTATATATCACTTCGAGATTCCCAAATTTGACATATTGTCCCTT
AGTAAGGCGGAAAGCAGACAGAGAATTCTTCAAGCTTACGAGCTTCAGGAAGCATCCAGA
ACTGAAGAAGATCACACAACAGCCAACGAAACTTATATTTCTGAGGATCCCCAAAAACCT
GAACCAGTTCCTCAGCCACAACATGAGGAATCTGTAACAGAAGAATTCGTTAAGCCAATA
ATTAAAGCTCCACTTGAAGATGGAAGCATTATAACTGAAACCACAACAACAATAACGACC
GAGTCTTTGAGCAAAACTTCTATTCCTGAAACGATACCTGAAGAGCCCAAAAAACCAGTT
GTGGACGATTCCAAGACTATTACAACAGTTACCACTACAACAACAACTACCGAAACCATT
AGTGAACTTCCTATTTCCGAAGAACCCAAGAAGGTAGTAGAACCGGAGAAGATACCTGAA
GAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCTAGCTCGTGGATG
GATGTCTTGGATGAGCCCATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAACCA
CTAAAGGAAGAAACTGTTGTGGAAGAAATAGTCGAGGAAAAGCCAATTGTTGAAGTTTCT
GTTGTCGACGATTCTAAGACTATTACAACAGTTACCACTACAACAACAACTACCGAAACC
ATTAGTGAACTTCCTATTTCCGAAGAACCCAAGAAGGTAGTAGAACCGGAGAAGATACCT
GAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCTAGCTCGTGG
ATGGATGTCTTGGATGAGCCCATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAG
CCACTGAAGGAAGAAACTGTTGTGAAAGAAGTAGTCGAGGATAAGCCCATTGTCGAAGTT
TCTATTGTGGACGATTCCAAGACCATTACAACAGTTACCACCACAACAACAACTACCGAA
ACCATTAGTGAACTTCCTATTTCCGAAGAACCCAAGAAGGTAGTAGAACCGGAGAAGATA
CCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCTAGCTCG
TGGATGGATGTCTTGGATGAGCCCATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCT
GAACCACTAAAGGAAGAAACTGTTGTGGAAAAAATAGTCGAGGAAAAGCCAATTGTTGAA
GTTTCTGTTGTCGACGATTCCAAGACCATTACAACAGTTACCACCACAACAACAACTACC
GAAACCATTAGCGAACTTCCTATTCCCGAGGAAACCAAGAAGGTTGTCGAACCGGAGAAG
AAACCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCTAGC
TCGTGGATGGATGTCTTGGATGAGCCCATGAACTTCTCTGACGACGAAGAGGAACCAGTT
CCTGAGCCACTGAAGGAAGAAACTGTTGTGAAAGAAGTAGTCGAGGAAAAGCCAATTGTT
GAAGTTTCTGTTGTCGACGATTCCAAGACTATTACAACAGTTACCACCACAACAACAACT
ACCGAAACCATTAGTGAACTGCCTATTTCCGAAGAACCCAAGAAGGTAGAAGAACCGGAG
AAGATACCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCT
AGCTCGTGGATGGATGTCTTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCA
GTTCCTGAGCCAGTGAAGGAAGAAACTGTTGTGAAAGAAGTAGTCGAGGAAAAGCCAATT
GTTGAAGTTTCTGTTGTCGACGATTCCAAGACTATTACAACAGTTACCACCACAACAACA
ACTACCGAAACCATTAGTGAACTTCCTATTCCCGAGGAACCCAAGAAGGTAGTAGAACCG
GAGAAGAAAGCTGAACCTTCGTCATTCGACGAACCTATGAACTTCTCTGACGACGAAGAG
GAACCAGTTCCTGAGCCACTGAAAGAAGAAACTCTTGTGGAAGAAGTAGTCGAGCCAATT
GTTGAATCTTCTGTTGTGGATGAAAGCAAAACAATAACAACTGTTACGACCACAATTGTT
ACATCTACCAATCAAACTAATACTTTGGAAGAGGAGAACTCTCTTCCCGCGCCAGCTGAA
CCGCAAATTATTAGTAATGTGGTAGATGATGTCAGTCAATTGGAGAAGCCTCTTGAGGGA
CCCATTGATACATGGTCCAGCGTTTTGGAGGACACCATTTCTAATACTGGAAACATTGGT
TATACCTCAACTTTATCGGCGGACGCACCTGAGTTTACTCCATCTTATTTGAGACATACC
TTCTCCGATCAAACGCATACATTCCTTGCCAATGAAAGGATATACAACGAATTTATTCCC
AGGAATAGGCCAGAACAAACAATTGGGCCACACCAAAAGCCTAAAAAGGCAAAGCCATCA
AAGCGACAGAACAAGAAGGTGGAAATCCGAGAAAAAATTATTGATGTCCAACCTGCTCAA
GAAATAAATATTGTAGAACCGGTACAAATTGTCGAAGAAGTGGAGAATGTTTGGAACATG
AACCGGGATGGTAAATCGTATGCTGACGTGCTACTCAACTCTGGAGTTACAGGTGACGAC
GTCCCATCTACTGAGTTACATAAGGAAATCCCTCACAAAACAGACATAGTCAAAACTAAA
GCCCAAGAGCCAAAGAAGAAATCGAAGCCAGAGAAGCGGCAGGCAGAAAAGGTTATTGAA
CTGTCCTCAGCAAGCATCGAAAGCGAAAAATCGAAGCCAAACAGCGACAGTGAGCAATCT
AAGCCTACGACAGAAAGTGAATTATCCAAACCAACGACAGAAAGTTCCAAAGAGCCGTCT
TCTGATGAAAGGGATGTTTCCAGCACATCCGAGTTGACATGGTCAGCCCTTGTGCAAAGA
CCCGGCGAGTGGTCAGATTCAACCGTAAATAAAAAGCAGACTTCTCATACGGCTGTCACA
ACTAAAGAAACACATCGCCAGAAAGAAAAGGAGGAGCCCAAAAAGACCACAAAGGCGAAG
AAGACAAAGAAGTCCAAGAAACCCGTTGTAGATCCCGTCTCGACTACATCTGAGGACGAA
CAGCCCGAGACTGTGCCCGAACCAGTGGAGGCAATGCCTGCACCAATAGAGTCAAAACCG
GAGCCTGAAGTTGTTCAGAAGCTAGAGAGTAGCAACGCATTCTCCTGGGCCTCACTTGTA
AAGAGACCAGGCGAATGGATTGACAACACTGTTACTCACATTAAAACCGCTGTCACCCCA
TTGCCTGATGTAAAAGAACCAATCAAAAAGGACAAAAAGCCACAAAAGCCCAAGAAACAG
AAGGCAACCAAAAAACCTACTCCCGTTGCTCTGCCCGAAGATGAAGTAAGCAGTGAACCC
TCTGAGGAAATAGTTGTGGAGTGTGAGGTGGAAGAGAAAGAAACTAAATCTATCAAAAAT
ACAGAAAACGCCTTCTCTTGGGCGTCCCTGGTAAAGAAGCCCGGCGAATGGGTTGATGAC
ATTGCTTCTCGTAAAAAGCCAGTTGAAATCATTCACGAGGAGCCTAAGGAGGTGCATCCA
CGGAAAGAACGTAAAATTTCAAAACCTCAGCCCAAACCTCAGTCTGAAAACACCACCAAG
CGTAATAACAAAAAGGAAACTCGTGAGCCCGTAGTTGTTCATTCGACTTCAGAGGAAAGT
GATGTGGTTGAGGTATTAGAGCCTACAAATGAAAATACAATTACTTGGGCTAAAATAGCC
AGTCAAATTGATCATATGACTGACTTGAAACCAAAGGCTAAACAAGAAACAAAGCCAAAA
CAAGGAGAAAGGGTAAAAGAGCAAATAAGATTCGATCGAATTGAGAAACATCCAAAAGAT
CATGCTATATCATCAGATCTAAGTCAACAAAAGGGAGATTCTGGTCATTCCTGGTCATCT
GTGGTAAGTCATCAAGTCACTGATTTTATTGAAGCTGAAAGTATAAAACCAGTTCCTAAG
AAGTCTGTGAAAAAGTCGAGTGGCAATACCCAACCAAAAATTGCACCAAAACTGGAGGAA
CCTTTGCAAGAACCCGTTCAAAAGGACGTAGAAAGTACACCCCTAATGCCATGGTCTGAA
ATCATTGACGATGGGTTGGATGACGTGGTCGTTGAACGAAAATCGTGGAAAGAACTTATA
GAAGACGAAATAGAAATTCCTCTTCCTCATGAGAATGGAGAGAAAGCCAACATTGACAAG
ATTATTGAAACCATCCAGGAAATACAATCAACCAGCGAAGAAAAACCAAATAACGAATCC
AAAACAATTACAACAGTAACCACCACAACACTATCAACTGAGTCTATCAGCGAATCTGTT
ACTCCAATGGAACCCAAGAAAGTTGCCGAACCAGTGCCTGAGCCACTGAAGGAAGAAACT
CTTGTGGAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCC
AAGACCATTACAACAGTTACCACCACAACAACAACTACCGAAACCATTAGCGAACTTCCA
ATTCCCGAGGAACCCAAGAAGGTTGTCGAACTGGAGAAGAAACCTGAAGAACCCAAAAAG
CCAGCATATGCCGGTCTTCCTGTCGATGACTCTACGAACTCGTGGATGGATGTCTTGGAC
GAACCTATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAGCCAGTAAAAGAAGAA
ACTGTTGTGCAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGAT
TCCAAGACTATTACAACAGTTACCACAACAACAACAAATACCGAAACCATTAGTGAACTT
CCTATTCCCGAGGAACCCAAGAAGGTTGTCGAACTGGAGAAGAAACCTGAAGAACCCAAA
AAGCCAGCATATGCCGGTCTTCCTGTCGATGACTCTACGAACTCGTGGATGGATGTCTTG
GACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAATTCCTGAGCCACAGAAGGAA
GAAAGTCTTGTGAAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGAC
GATTCCAAGTCCATTACAACAGTTACCACCACAACAACAACTACCGAAACCATTAGTGAA
ATTGCTATTCCCGAGGAACCCACGAAGGTTGTCGAACCGGAGAAGAAACCTGAAGAACCC
AAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGACTCTACGAACTCGTGGATGGATGTC
TTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAACCACTGAAG
GAAGAAACTGTTGTGGAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTG
GACGATTCCAAGACCATTACAACAGTTACCACCACAACAACAACTACCGAAACCATTAGC
GAACTTCCTATTCCCGAGGAACCCAAGAAGGTTGTCGAACCGGAGAAGAAACCTGAAGAA
CCCAAAAAGCCAGCATATGCCGGTCTTCCTGTCGATGACTCTACGAACTCGTGGATGGAT
GTCTTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAACCACTG
AAGGAAGAAACTGTTGTGGAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTTTT
GTGGACGATTCCAAGTCCATTACAACAGTTACCACCACAACAACGACTACCGAAACCATT
AGTGAACTTCCTATTCCCGAGGAACCCAAGAAGGTAGTAGAACCGGAGAAGAAGCCTGAA
GAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGAGTCTTCTAGCTCTTTGATG
GATGTCTTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAGCCA
GTGAAGGAAGAAACTCTTGTGAAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCT
GTTGTGGACGATTCCAAGTCCATTACAACAGTTACCACCACAACAACAACTACCGAAACC
ATTAGTGAACTTCCTATTCCCGAGGAACCCAAGAAGGTAGTAGAACCGGAGAAGAAGCCT
GAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCTGTCGATGACTCTTCGAACTCGTGG
ATGGATGTCTTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAATTCCTGAG
CCACTGAAGGAAGAAACTGTTGTGGAAGAAGTAGTCGAGATAAAGCCAATTGTTGAAGTT
TCTGTTGTGGACGATTCCAAGACTATTACAACAGTTACCACCACAACAATAACTACCGAA
ACTATTAGTGAACTTCCTATTTCCGAGGAACCCAAGAAGGTAGTAGAACCGGAGAAGAAA
CCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCCGTCGATGACTCTACGAACTCG
TGGATGGATGTCTTGGACGAACCTATGAACTTCTCTGACGACGAAGAGGAACCAGTTCCT
GAGCCAGTGAAGGAAGAAACTCTTGTGGAAGAAGTAGTCGAGGAAAAGCCAATTGTTGAA
GTTTCTGTTGTGGACGATTCCAAGACTATTACAACAGTTACCACCACAACAACAACTACC
GAAACCATTAGTGAACCAGTTATATCCGAGCAACCCAAGAAAACAGTAGAACCAGTGAAG
AAACCTGAAGAATCCACAGAAGTCGAGCCAAAACCATTGTCTTCTAATATATGGGAACTG
CATTCGTCATATGCTGATGTCTTGCGTCATACTGTGGACTTCATAAGTTTAGAAAAGAAT
AATGTTGAAGTCCCAACTGAATCAAATTTAGGTAAAGTGCCAACAGTAAAAGAGCCTGCT
AAACTTCCAGAACCTTTGATTAAGACAAAGGCTAAGAAAGAAAAACCGTTAAAGAAGGAA
AAGGGAGCTAAGCTTTTGACGCCTAAAGATGAAGTTCTACCAATCGAAAGAGAATCAGCA
AAGGATGAAACAAAGACGTCGTGGTCAACAATGGTCGAGAACGATTTTGATGATAACGTT
CAAACAAACATACTCAGTGCCGATAGCACTTTGTGGTCTTCAATTGTCCGACAAGGTGCC
CAGGAACCTATTACCAAAATGACACAATCTGCCGACCATGATGGTAAAGTTCTAGAACCT
GCATTCCAGAATTCACAAGAAATAAACAAATTCATTTCCCAAGAAAGAAGCTCCACAGTG
ATTGAAAAGACTAAGAAACAAAAATCAAAGAAGGAAAAGAAACACAATAAGATAGAATCA
GTAGTTGAAGTGGCTTTAGAACCATACGTTGATAGCACTTTCATGCGCGATGATCCTAAA
ACACAGCAGAATGCAGAAATTCCGTCTGTTTTGGAAAGTTTACCTATTCAACCCAAGTCT
TGGTCATCTATCGTCTCACAAACCGAGGTTCTGCCTCCAACAAGTATAGAAAGTAAAATA
TCCCAGAAAGCCGTTGATCCTCATAGGTCAAAAGAAGTGCAGGAGTTCATTAGTAAAGAA
CAAATCTTTTCAACGACTGTAAATGCCGATTCTAAGAAACCTGAAGATAAGAAACCCTTA
GAAGAAAAACCGAAAAAACAAAAATCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCT
CCAGAACCCATCGTTGAGTCTGCAGTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTG
ACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAG
ACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCG
TCTATCGTTTCTCAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAA
GAGCCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAA
AAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGCC
GTTGTTGAACCAACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACA
GTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCC
CCATCGCAACCACTATCATGGTCGTCTATCGTTTCTCAAACCACGGAAATTACGACAAAT
GTAACAGAGACTCGCTTCACGGAAGAGCCTGAAGATAAGAAACCCTTAGAAGAAAAACCG
AAAAAACAAAAATCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAACCCATC
GTTGAGTCTGCAGTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTGACATTTGTTGAG
GAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAA
CCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCTATCGTTTCT
CAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAAGAGCCTGAAGAT
AAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAG
GTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGCCGTGGTTGAACCC
ACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAA
GTAACGCCCGAGACACAACCGGAACCCACTCCAGTTAGTGAGGTGGCCCCTTCGCAACCA
CTATCATGGTCGTCCATCGTTTCTCAAACCACGGAAGTTACGACCAATGTTACAGAGACT
CGCTTCACGGAAGAACCTGAAGATAAGAAACCCTCGGAAGAAAAACCGAAAAAACAAAAA
GCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCA
GTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTT
GAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAACCCACTCCAGTA
AGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCTATCGTTTCTCAAACCACGGAA
GTTACGACAAATGTAACAGAGACTCGCTTCACGGAAGAGCCTGAAGATAAGAAACCCTTA
GAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCT
CCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGCCGTTGTTGAACCAACTGTTGAAGTG
ACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAG
ACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCG
TCTATCGTTTCTCAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAA
GAGCCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAAGCAAAGAAGGAA
AAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGCC
GTTGTTGAACCAACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACA
GTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCC
CCATCGCAACCACTATCATGGTCGTCTATCGTTTCTCAAACCACGGAAATTACGACAAAT
GTAACAGAGACTCGCTTCACGGAAGAGCCTGAAGATAAGAAACCCTTAGAAGAAAAACCG
AAAAAACAAAAATCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAACCCATC
GTTGAGTCTGCAGTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTGACATTTGTTGAG
GAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAA
CCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCTATCGTTTCT
CAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAAGAGCCTGAAGAT
AAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAG
GTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGCCGTTGTTGAACCA
ACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAA
GTAACGCCCGAGACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCA
CTATCATGGTCGTCTATCGTTTCTCAAACCACGGAAGTTACGACAAATGTAACAGAGACT
CGCTTCACGGAAGAGCCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAA
TCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAACCCATCGTTGAGTCTGCA
GTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTGACATTTGTTGAGGAACCAGTGGTT
GAGGTGACTACAGTTGTAGAAGAAGTAACGCCCGAGACACAACCGGAACCCACTCCAGTA
AGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCTATCGTTTCTCAAACCACGGAA
GTTACGACAAATGTAACAGAGACTCGCTTCACGGAAGAACCTGAAGATAAGAAACCCTTA
GAAGAAAAACCGAAAAAACCAAAGGCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCT
CCAGAGCCCATCGTTGAGTCTTCAGTTCCTGAGGCCGTTGTTGAACCCACTGTTGAAGTG
ACATTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAAAGCCCGAG
ACACAACCGGAACCCACTTCAGTTAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCG
TCCATCGTTTCTCAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAA
GAACCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACCAAAGGCAAAGAAGGAA
AAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTTCAGTTCCTGAGGCC
GTGGTTGAACCCACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTTGAGGTGACTACA
GTTGTAGAAGAAGTAACCCCCGAGACACAACCGGAACCAACTCCAGTAAGTGAGGTGGCC
CCATCGCAACCACTATCATGGTCGTCCATCGTTTCTCAAGCCACGGAAGTAACGACAAAT
GTAACAGAGACTCGCTTCACGGAAGAACCCGAAGATAAGAAACCCTTAGAAGAAAAACCG
AAAAAACCAAAGGCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATC
GTTGAGTCTGCAGTTCCTGAGGACGTTGTTGAACCCACTGTTGAAGTGACTTTTGTTGAG
GAACCAGTGGTTGAGGTGACTACAGTCGTAGAAGAAGTAACGCCCGAGACACAACAGGAA
CCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCCATCGTTTCT
CAAACCACGGAAGTTACGACAAATGTAACAGAGACTCGCTTCACGGAAGAACCTGAAGAT
AAGAAACCCTTAGAAGAAAAACCGAAAAAACCAAAGGCAAAGAAGGAAAAGAAAACTAAG
GTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTTCAGTTCCTGAGGCCGTGGTTGAACCC
ACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAA
GTAACCCCCGAGACACAACCGGAACCAACTCCAGTAAGTGAGGTGGCCCCATCGCAACCA
CTATCATGGTCGTCCATCGTTTCTCAAACCACGGAAGTAACGACAAATGTAACAGAGACT
CGCTTCACGGAAGAACCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAA
CCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCA
GTTCCTGAGGACGTTGTTGAACCCACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTT
GAGGTGACTACAGTCGTAGAAGAAGTAAAGCCCGAGACACAACCGGAACCCACTCCAGTA
AGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCCATCGTTTCTCAAACCACGGAA
GTAACGACAAATGTAACAGAGACTCGCTTCACGGAAGAACCTGAAGATAAGAAACCCTTA
GAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCT
CCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGACGTTGTTGAACCAACTGTTGAAGTG
ACTTTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAAAGCCCGAG
ACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCG
TCCATCGTTTCTCAAACCACGGAAGTAACGACAAATGTAACAGAGACTCGCTTCACGGAA
GAACCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAA
AAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGAC
GTTGTTGAACCAACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTTGAGGTGACTACA
GTTGTAGAAGAAGTAAAGCCCGAGACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCC
CCATCGCAACCACTATCATGGTCGTCCATCGTTTCTCAAACCACGGAAGTAACGACAAAT
GTAACAGAGACTCGCTTCACGGAAGAACCTGAAGATAAGAAACCCTTAGAAGAAAAACCG
AAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATC
GTTGAGTCTGCAGTTCCTGAGGACGTTGTTGAACCAACTGTTGAAGTGACTTTTGTTGAG
GAACCAGTGGTTGAGGTGACTACAGTTGTAGAAGAAGTAAAGCCCGAGACACAACCGGAA
CCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCACTATCATGGTCGTCCATCGTTTCT
CAAACCACGGAAGTAACGACAAATGTAACAGAGACTCGCTTCACGGAAGAACCTGAAGAT
AAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAACCAAAGAAGGAAAAGAAAACTAAG
GTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCAGTTCCTGAGGACGTTGTTGAACCA
ACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTTGAGGTGACTACAGTTGTACAAGAA
GTAAAGCCCGAGACACAACCGGAACCCACTCCAGTAAGTGAGGTGGCCCCATCGCAACCA
CTATCATGGTCGTCCATCGTTTCTCAAACCACGGAAGTAACGACAAATGTAACAGAGACT
CGCTTCACGGAAGAACCTGAAGATAAGAAACCCTTAGAAGAAAAACCGAAAAAACAAAAA
CCAAAGAAGGAAAAGAAAACTAAGGTGGTGGAAGCTCCAGAGCCCATCGTTGAGTCTGCA
GTTCCTGAGGACGTTGTTGAACCCACTGTTGAAGTGACTTTTGTTGAGGAACCAGTGGTT
GAGGTGACTACAGTCGTAGAAGAAGTAACGCCCGAGACACAACCGGAACCCACTTCAGTT
AGTGAGGTGGCCCCATCGCAACCACTATTATGGTCGTCTATTGTCTCTCAAACTACTGAA
GATGTAGCAGAGGCTCTTATCACTGATGTAGCTGAAGATCAGAAACCTTTAATGGAAAAA
CCGAAAAAACTTAAGGCAGGGAAGGAAAAGAAATCCAAGGTTCAGAATGTTGAAGAGTCA
ATTTTGGAGTCTGATGTTCCATTGTCCGTTGTTGAACCCATTATTGGATTTACCACTGTT
CAAAAGGATGTACCACCAAAAACGGAATCGCATACGTTTTCATGGTCGTCTATTGTTGCT
CAGTCTGTTGAGGTTCCACGAACAATTCCAAAACATGTAGAATCAAAAACGGGCGGAATT
CAAAACTTTATCGCACAGGAGCAAAATTACTCTACGGTTGTGAATGATTCAGTCAAAAAG
CCGAAACCTAAAAAGGAAAAGAAAATAGTTCAGCCTATTCAACAACCAACCGGTGAAAGC
GTTCCTGTCCGAAAAGATCACATGCGAGAAGGAGTAACTAAAGCAGTTCCTGAGCCACAA
ACTTTGTCTTGGTCGTCAATCGTTTCGCATAACATCGATTTGACGCCAACGTTTACTGAA
AACCGTGTCATTGAAGCCGTCGATGAGATCAATCCCGATGACAGCAGTAGTAATCAAGAA
GGTGAGCTTCCCATTCATGTTGATGAAAGGAAACGAAAACCCAAAAAGGACAAAAAACGA
GATCAAAATATTGAAACTTCTGTTGTCTACGAAGAGATTCCAGAAACTGAACGCGTAGCT
GTGTCTTCCACGCCTGAATTCAGCATTCAGTTGCCGGCACCAACAAAACCATCAGTGTGG
TCATCATCAGACACCTATGCCGAAGTTGTTAAGAAGTCTGGTTACAACAACAATACGAAC
ATTAAATATCAGAAAATTGAGGCAAGGGAACCAATCAAGAGTGAACCAAAACACACATTT
GTCGAAGTGCAGACACATGAAGATCTTCTGGAGTTCCCGGACCCTATCATTCCTGCAATT
GAAAGAGATGAAGCACTTGAGAAACCCTCTCAGCTATCATGGAAGGACCTTGTAGATGAG
GATGATGTGGATCCGCTGGAGTCGTGGCATAAGGGAGAAACAGATTCTGTAGAGATAAAG
ACACAAAAACCAATACAGGAAAGACATTCCCGAGTGAGCGTAAAGCCGGAAATTCAAATA
ACCGAGGTAGTTACTGAAACTCAATCGCAATCCGAGACTGACCAAGAATTCTTGGAAATT
ACTTCAAAGAAACGAAATCGCTCACGCTCACGTTCGCAACAGTCACAGGCTTCGAACATT
GATGAAAAGCATCAAAAGAAAAAATCAAAGAAGCCAAAAAATACGGTACCTAAAGCACCA
GCTCAACAGCCTACGGAAGCTCCTGAGGATGTCCAGCCTCCTAAGGAATCTGTACCATCT
GTAGAAGAACCGTCTCCACCACCAGCTCCTTCTCCTAATACCTCAGGTATGTCATGGGCT
GCTATAGCCGCCCATAATGTGCCAGAACCAGTTCAACATATTCGACCCCTCCAAGCTGAG
GCCAAACCAACTGTCGTTGAAGATGTAAGGAAATCAACAAATGAGCACACAGTAAACATT
CCAATCACTTTCGAAACTACTGAGCCAAAGACTAAAAAGCCAAAGCAAAAGTCTAAGCGA
AAGTTGCCAACCGATGTGGTTGATTTCATTAATGCAGAAAAATCGATACATCAAGTGATT
GCTTCCAAACCTGAAATAGTTGAAGAACCTGGATCTATAATAGTTGAAGACGTCAACAAT
ACTTTAACATCATGGGAAATAAAAACTCCACTTGCTCCCTTTGAATTTGTTGCCGAGTCT
GAAGTTGAACCAGTATCTGAGTCACATATGGAAGACCTCCCTGTCGAAAAAGTTTTGAAG
ACGGAGCCAATTGTTGAATCTACGGCGGTAGACGAATCTAAGACTACTACAACAGTAACC
ACAACAACAACAACTACCGAAACCACTAGCAATGTTTCTATTCCCGAGGAACCCAAGAAG
GTTGTCGAACCAGAGAAGAAACCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTTCCT
GTCGATGACTCTTCGAACTCGTGGATGGATGTCTTGGACGAACCTATGAACTTCTCTGAC
GACGAAGAGGAACCAGTTCCTGAACCACTGAAGGAAGAAACTCTTGTGGAAGAAGTAGTC
GAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCCAAGTCCATTACAACAGTT
ACCACCACAACAACAACTACCGAAACCATTAGTGAACTTCCTATTCCCGAGGAACCCAAG
AAGGTAGTAGAACCGGAGAAGAAACCTGAAGAACCCAAAAAGCCAGCATATGCCGGTCTT
CCCGTCGATGAGTCTTCTAGCTCGTGGATGGATGTCTTGGACGAACCTATGAACTTCTCT
GACGACGAAGAGGAACCAGTTCCTGAGCCAGTGAAGGAAGAAACTCTTGTGGAAGAAGTA
GTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCCAAGTCCATTACAACA
GTTACCACCACAACAACAACTACCGAAACCATTAGCAAACTTCCTATTTCCGAGGAACCC
AAGAAGGTAGTAGAACCGGAGAAGAAACCTGAAGAACCCAAAAAGCCAGCATATGCCGGT
CTTCCTGTCGATGACTCTTCGAACTCGTGGATGGATGTCTTGGACGAACCTATGAACTTC
TCTGACGACGAAGAGGAACCAGTTCCTGAGCCAGTGAAGGAAGAAACTCTTGTGGAAGAA
GTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCCAAGTCCATTACA
ACAGTTACCACCACAACAACAACTACCGAAACCATTAGTGAACTTCCTATTCCCGAGGAA
CCCAAGAAGGTAGTAGAACCGGAGAAGAAACCTGAAGAACCCAAAAAGCCAGCATATGCC
GGTCTTCCTGTCGATGACTCTTCGAACTCGTGGATGGATGTCTTGGACGAACCTATGAAC
TTCTCTGACGACGAAGAGGAACCAGTTCCTGAGCCAGTGAAGGAAGAAACTCTTGTGGAA
GAAGTAGTCGAGGAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCCAAGTCCATT
ACAACAGTTACCACCACAACAACAACTACCGAAACCATTAGTGAACTTCCTATTCCCGAG
GAACCCAAGAAGGTAGTAGAACCGGAGAAGAAACCTGAAGAACCCAAAAAGCCAGCATAT
GCCGGTCTTCCCGTCGATGAGTCTTCTAGCTCGTGGATGGATGTCTTGGACGAACCTATG
AACTTCTCTGACGACGAAGAGGAACCAGTTCCTGAACCACTGAAGGAAGAAACTGTTGTG
GAAGAAGTAGTCGAGAAAAAGCCAATTGTTGAAGTTTCTGTTGTGGACGATTCCAAGACC
ATTACAACAGTTACCACCACAACAACAACTACCGAAACCATTAGCGAACTTCCTATTCCC
GAAGAACCCGAGAAGGTCGAACAAGCAGTCGTCAAAGTTGAAGAACCAAAGAAACCAGCA
TATGCCGGCCTGCCGGTTGATGCCTCTTCAAGCTCTTGGATGGATGTCTTGGATGAGCCC
ATGAACTTCTCAGACAGTGAAGAAGAACCCGTACCAGAGTCACAAACTGAAGTAACACCC
TTGGCACCATTTAAGGATGTTGCAGTTGATAAGGTTCAAAAACCAGTCGAAACAGCTAAT
ATATCTATTGACTCTGGAAATACTGAAGCCGAGAAGACTCCCCTGGCGCCCTTCGAAGAA
ATTCCTGACTCTCCTTTAGACGATGCGTTTATATGTGAGACTTCCTACTGGTCAGCAACT
CTCAAGCCAGGTCAAAAACCGGCATCCACAGTTGAAACAACCGAGACAAAACAAGAGGAA
AGCCAACCCATTAAAGTAACTATTCCAGACGATGAAGGCATTGACGAAGTGGCGGTAAAG
TCACCCACTGATCAGCCAACAACATGGTCAGCAATTGTCCAAACCGAGACAACTGTGTTC
CCAACACCAGATGTACAAAAGGACAATGAAAAGACTCCTGATTGGTCTACTCATGTTGTG
AGCAAAACAACTGACTTCCAGGAGCCGAAGCCTCTGAAGAACGTGGTTGATTCGGAGAAT
ATAACAACAACGACAACAACATATGTGACCACAACGGTGACTACACATAAGGATACATCT
ATCGTGGAGAATGAATCGCCAGCAACATCTTATGTGTCCACTGTGGTAACCAGCCATAAA
AATGAACTGGATTTGGAACCAGAACCTTTTGAACTAACTAAACCGGATAACCTTATCGAG
AATCTTAATCGCGAGGCATTCAAAGTGCATCCCCAATACGAATTCTTGCAGGGACAATAC
CAACAACTGAAGGTGGTAAATATAACGAAAGAACCGTATTTGGAGGAACCCAAAGAAGAT
GTTCCTTTGGTAGAAGATTATGTGATAATTGAACCCGAAGCGATACCTGAAATCAATTCC
GAAATCCTTGCTCTTAATCTTTATCTTGACCAAACCAATATATTGCCCAAGACTCGTATA
GATGTCGACACCATTAGCCAGTTGCTCACCCTTCAGAAGTCGTCTGATCCTATAGTAGAA
AAAGAAACTGTCCAAGGGGAAACTAAGAGTGTAGAAATTCTTGTCAAAAAATCCATTGTA
GAATCGCCTATTGAACCCATAGCTGACGAGCCACTTGTCATTGAAACATCTCAATCTCCG
CCTGAACCCAGTAAATTGCTCTGGAACCTCAGTCAAGATAATTTCCTCAAACTTATCAAT
CACTATAAACAAACGGCAGGCGATGCATTCGCATTGTTGCCAAGGACAACCACAGACACG
ACGATAGCTCAGGAAACTCAAGACGATAAGCAAAAGACTGACGGCATTACAGAAACTGTA
GTGACAACCACGACGACCACGATAACCGATCGCGTTGTAGAAAAGACTGAACCAGATGCA
TCGTCATTACCAATCATTCCTACCGCCCAGCCATTGACGGCACCAACGCTTGGTAACCTC
GATCAGTTGCGTCTGAATCTGTATCTGGACGATTGGCAGCCAGCTAGTGTGGATGCACAT
TTGGCTGACGATTTGTTCGATGGATTGAAACGTGTTGATGTCGCCGGTAGCGAAGCGGAA
CTCGACAAAGACAAGAACCAGGAGCAACAACCTGACGGTGATGCCAAAAAGCCAGATGGT
GTTACTGGAATACCAGACAAGGACGATCATGACAGTGACGATGATGACGACGACGACGAC
GATGACGACGACGAGGGAGGTAAGCCGACTGTGCCAGAAATTCGCAAGCCGAACGACGAT
GATGATAAACCGAACGACAAGGATCCTGGTAGCGGTAGTAGTGGTAATGTGACCCCCACA
CCCGAGCACGATGCCCAGTACGGTCAGAACCGTAGCTGTTCATCGGAGTATAGGTCCACC
GATCTACCGGGTGGTGTGGGTCATTGGCGTGACGACAGTACTTATCTGGCTCTAGAAGCC
GAACAGCCTCAGGTTAAACTAGAAAGTGTACCACTGGCACCCACTATATCGGGTGTTGAA
TCTGTACTAACCGAAACTAATACCACAAGTCCCGCCCCCGCCCCCGACCCCGTCACAGCC
CCTGAAACCAGTCCCAGTACAACTACTAGTTCCCTAAACGTTGCAAACGCACTAATCCAA
TTGGCAAGCGCCACAACTCACACGCTGTCCGCCAAGGCGAACGCAGCAGCAACAGCAACA
CATGCAGCAGCGCTGGCAGCAACCAGTGCTCTACTTCCGGTTGCAACGGCCGTAGTCGAT
AAGCTAACGACGACAACAACAGCAGCAGCGGAGACACCAGCAGCAACATCGGATGTTGCT
GCCGTAAACCCCTATGTTGCACGTGCAACACCGGCAGCAACAACAGTAGCAGAAGCAGCA
ACAGCAGCAGCAGCAGAAATACCTCCGGCAGCAACTCACACCGAAACGACAACAACTAGC
AGCAGCAGTGGAGAGGTGGTGGCATTGCCCACCGAAAATACCGGTGCGGTACGACGCACC
ACAACAACAACCACAACCGTAACGACAACAACCACAGTTGAAACGCCATCGACAACTAGC
AACACAACGACAACGACAACAACCACAAGCAGCAACGAACTGCAAGAACAACGCCAGAAG
GTGAACATCACATTGAGCCTTCGTTTATTCATAATTCTAATTTTTGCAGCTTTTCTGTGT
GGTTTCGGTATTTGTTCATGGCTTTTATACGGCAATCGATCGTGTTGCTGTTGTGGCCAG
GTTCCGACCAACGGACGCTGCTGCGGCAACACATTGCAACAGGCAGCAGCAGCAGATCAG
GGAAATTGCCCGCCGTGAAGTTGGTCCGGGCCTGGCCATAATGGCAATGGATAATGCAAA
TGCCTAACTACTAACGTAAATTGATAATCGAAAACATGTTTTGAGTTTTTATGTTTTACT
TAAGTTTTTCATTTTTATTATATTTGTATTGTATGTGTTGTTGTTTTTTTTGGCTAAACG
CATCCAATAGGCTTATGTTTTGAGTTTGTATACCTGAACGAAAAAGTTACTATACCTTTA
TAAAAGCACCTAACTTAGACGTAACCCAAATATGTAGATTTGTTGTAACTTAGTTCCTTT
TACTAATTGATATTAACCTTTGTAAAAGCCCAGTAATCAGAGACTACTAATGGTAGTGAT
AATAATAAAATCTATATTAACCAACTTGCACGTTTTAATACCGAGCTGATCTATATCCCC
AGCGTATACGTAGTTTTCTTCGCAGATTTTTCACACACGAGAGCACAAAACACAAGCACA
CAGAATCACGCATATCGAGCACTTTTCCTGCCACCCTCCCCCCACACGACACAGTGCCGC
ACAAAAGTGTGTGTACACGCAATTACCGGGTTCCCAAATGCAGAAAATGTCCATTATGTG
TACCGCACGTATATACGCGTATGAGTTCATTGCCTCGCCTACCGCCCTGCTATCAGGAAT
TTGCGCGCAGAGTACTCCCTGCCACAGCTATAAATACCCTACCCAACCGTTCAGATGCGA
TCCCATCCCATACGATACGATCCGATACGATCCGATCCATGCGGTGCAGGCCGTCTTATT
TGCTCGAAAATAGTCTCCCGTTCATTTTAGAATTTTTAGTCTGCAACTTGCAATGAACGC
GTTGGGTTTGACTGCGAATCCCGAAGAAGTATTTCTTTCAAGAATCTAAATATTTTGTTA
GTGCCAATGTGTGTGTGTAGTGCATTAAGAGTAGGTAAACAAGATCTGAAAAGAGTTATT
TCGAGGATTATTCTGAGTTTGTAATATACAAGTATAACGAAAGAAAGTAAGTCTCTTTAC
CATTGCATTTAATTTTCCAACATTACCTAAAGACAGGCAGTAAGAACCGCATATTCTGGT
ACTTTTGTCTATCCGCCTACCGCCATTTAAAATAAGATAATTATTTATGCCAAATGCATG
TGTTACGTTACTTTAAACGAAGTTAAGTCATAGAGCTAGTGTTATTTTTAAAAGCATTTA
TTCGCATTCCCTTCAAAAAAAAAAAAAATAAAACATCTTGTTGTATGGCTGTGCATTGCA
TACATTTGAATTTTATAAATACCTACATATAACTTTTCTACTTCATGTACATATGTTTTA
TATGTGTATAGAAGCCGGCCACAAATATTTACATCAATTTCGTTCTCTAGCAATAATCCT
CCAGAAATTGCAATCTTTATTAATATTAACACACTTTCTACACCGTTTCCCCAAAAACCA
AAATCACTTACAAAAACTATAGGATCTAATTACGCAAGAGCTCGACGAACTGCTCCAATC
GCTTTCGAGCGTCGAGGATGGCATCGCCAACATGAACCAGAGCAGCCTGGATGGCATGCT
ACATGGATTGAAGGTAATAATATTATTAATCTAAGGCCGAAATAACACCACCTTTTTGGA
TGCTTGATTTGGCATGTACTCAAAGTAGTTAGATTAATTTGAATTAAAATATCTACTCAC
ACCTTGTACATAACTTTTGTAAACGATTATTGGATGCTGGCGTGTGTCAGAGAACTTTAA
TAACTCAATCGCATCACTCCATAAAGAATCGTACATATTTTGTTAGGCTGTTATTTTTGT
ATCAACAGAATACCGTTTAGTTGTTAGTTTTGTCCAGTTGTAGTGGTCGAACCTTTGTCT
GTCTAAGTAATACACTTTTCTAGGCCCAAAATCCAATTGTATTGTTACGTAGATTTGTAT
ATTTCGAAACAACATATATCTGAAACACATATTTTACACGCCCGATGTACAGCTAATCCA
GAGCAATCTCGAAGTACACGAAAGGGACGCCATCGAGTTAAAGAACCAGGCGAAGAAATT
ACCCACGGATCCGGCTACCGAACGGTTGCTCAACGACACCGTGGACCGTATTGACTTACT
ACTACGCCGCACTCAGCAAGGCATCACCATGATAGCGGTGAGTGGTTAAGATCTACGTCT
ATAACTATCCGTACTAATAATCCCTCATTCCGTTCAGAATGCTATGCATGGTCAGAAGAA
GCGCCAGCAGGAGATCGACGAGTACCAGCAACATCTGCTGGAGCTGGAGCAATGGATTAT
CGAGGTATCCGCCGAGCTGGCTTCCTTTGAACCCACCTCGGACAGCAGCACGGATGAGCA
GGTGCTCAAGTCGCAGGTGGAGAGGAGCCAGCAATTGCTGCGCACCCTCAAGGATCGCCA
GCAGTCCATGGAGGATTTGGTGGAGCAGACGCGCCAACTGCAATCCCATCCCGATGTTTC
TCCCTTGGCTGACACGCTGATGGAGCAGCTGCAGAGCATCATTACCATTCTGCGGGAACA
GGTCACAGTGGCCACCAAGCGCATCTTTACCATTGAAAAGCGCATTGTGGATTTGCGAAA
GGCCAAGAGCGAGGAGGCGCAACGCCAGCGTGTGCTTGCCGATTCACTCATCAAGCCACC
AACCGAAGCTCCAGCGAGTCCAGAGGCGCATGAATCCATCGAGTCCAACGAGAACACCAT
CGACTCGAGTTCCATGCCCGAAGAGGAGATCAAACCGACTGGAGTGTATGTGGAGACGCA
GACATCGCTCAGCCTGCAGCAGCCGCCAGTTCAGGTGGTGACCACCACGACTGTGGAGGC
CCAGACCAGCTTCAAGGAGCCAGCGGTAGAAACCGCAGAGGTGGCTCTACAAACCCAAAA
GGAACGTTCGCCCACCGAAAACATTATGGTAACACAAACGGTGCATCATGGCCAGGAAAC
GATCCAGATCGACACGACTCGCAACAAGGATGTGCCCGATGAACCCGAAGATGTCCAGAT
TGAGGCTCGCTACCATCAACGACCCAAGGGCGATGTGGACCGCGCCACCGAGCTGATCCT
GAAAAATGTACCTCAGGCATTCGAAACCACTTTCGTGGAGCCAGATGAGACGACCACCGA
AGTGATTGTGGGACCTGATGGCACCAAGCACATAGTACTCAAGAAAGTAACTCGTACCCG
CCAGCAAGTTGTACAGCAGCAGCAGATTAGCTCAATTGAGACTATTAGCGATTCAGATGG
TAACATCGAGGTTCACTCCACGGGACAGATTAATCTGGAGAATGTGCACACCACGGACAC
CAAAGCTGATCCGGAGGAGGGCAGTGTCCACACAGTAATCACACAGCAAACGCGTGGTGC
TGTTGTGGATTCAACGCAGCCCGAGGGTGTGATCTTGCAGGAATTCGAAACCGAGCCAAC
TATTGAGACGTACGAAGAAGTGATTGCCCCAGGCTCGCAGGCACAACTGATTCCCATGCA
GCCGGGAGATGTGCAAACCCAAGGCACCATCCGAGCAGTAGTTCAGCAGGTGACCCGTAA
GGTGATCCGCAAGACGCGCAAGATAATCAAGCGAGTGGTTATCATCGACGGAAAGGAGCA
CATCACTGAGGAAGTGGTCGAGGAGCCAGAGGAAGTGGAGATCACCGAGGAGGAGACAGC
ACCGCATATCAACGTAAATATTGTGCGAACCGTTGACGGAAAGGTGGTGAGCGAGGAGGA
GTTCCAGCGAATGATGCAGGAGCCCGGAGTTCTAATCGAAGAAGTTGCCACGGATCTGCA
AAAGCCGACAGCAGAGCCGCAGCAAGAGGTATTTGATATTGAGTCTACCCAAGTCACCAC
CACCACAAGAACTACAACCGCAACCACACAAGAACAAGAACAGCCAGAACAACAGACACA
ACCAACAACAACAGAAACGACTAAAGAAGCACCAGTAGAGTTGCCAGCACCTCAAGTAGA
TGTTGAACAACCCGTAGTTGTTGCCACTACCAGTCCCGTTCATGTTCCAACAGCGGATGT
AGTCGAGCCCAAGGACTCCTCACCGACATCCACTACCGCAGCTGTTGTAGATGTCGAAGC
AGTGGTTGAAGATATCAACGAGATTTGGCCACTGGAACATCACCTGAAACCCACCAACAT
TGACTTCTCCCAGCACGTCGAAGAATTGGCAGCACCAGCAGCGGTCACAGCAGAGACTGA
AGCATCCATGCCAGTAGAGGAAATTTGGCCGACAAGTCCAGAAACCGGAAACTCATTGAC
CCTGGAGCAGTACGAGTTTGAGCCACAATCACCACATGAAGAGAGCACAAAATCTGATCT
AGTTAAGCCCCAAGAGACTGAACCGCAAGTTGTTGCTGAAACTAAGCCAGAAGGCATTAC
CACTGGAAGTATTACCATTACCAAGACTACAACCACCATCACAAGCTCCACAGAAGTACC
GGAGGAAACTCTTGTCCAAAATGTGCCTGCCGATGAACAACAGCCTCCTGCAAACAAAAT
CAAGACTGACATTCAAAGTTTCCTTGAAGCCGAACAGACTTTGGCCGCAGCTCTAAAGGA
GCAGTCTTCAACTCCGACTGGAGCTTCGGTTGCTGAAGATGTTCAGACTCAGCCTGAGGA
AATTGTTCTTGAGGAAAGGACTGTTGAAATTTCAACCATCAAGACTGAAGAGAATCAACA
AGAGCCAGTTATAGTGGAGGAAGTGAAATCACTCCCTGTAGAGCCTGAACCAGTAGAACC
AGAGCTGGAGGAAGTGGCCATTGCAATTGTTGAGCAGACTGAGGAAAAGCCAGAAGAGCC
CGTTATTGAGAAACAACCAGCTTCTGGCCCAATCGACCTGCGTGCCGCCACTCAACTCTT
CATCTCTGGAGAGGCCGCAGCTTCAACGGCTCCACAGAAAACCTTCCAAATCTCAGCACC
CTCTCTGGAGGACAATGGCGCTGGTGTGCTGAAGGTTGTCCTGGGCAAGGAAAGTACCAA
CGAAGAGGATACCGCAGCTCCAACTACCGGCAAGGTTAGCATGACCATCATTGAGACCGC
TGCTGCTCCCGCCGCCGACGCCAAGCGGCGTCGAAAGAAAAAGAAGAGAAGAGATACAAA
GCACGAGGAGGAGCTTGAGCAAGAACAAGAGACTGAGCCGGAACCAGTTGCCGCCGTTAA
GGAGCCTGAGGTGAGCTCTGATGTGCCTGTTTCTCCGGAGGATTCACCACGCGATACCGT
TCGTCATGAGTCCATTGTTGAGATTAGTCCCGATAGCGATTTATCCAGCATTGAGATTGA
CACGAAAGTGAAGATTGTGGAGGATGCCGTTGTATCTTCACCATCGGAGTCGCCACGAAC
GCCAATGGTCGAGCTGGTCATTCCCACTGAGGTTGTTGAGTTAGCTTTGGTCGAGGATGA
GGAACAACAGACCACACCGCGTATTCCATCGCCCACTGAAAAATCGGAAGTCGAGCAGGA
TATTAAATCCGTGCAGACTTCACCACAGCATCAACCCAAATTAGATGAGACTGCAGTGCA
GACGAGTCTAGAGGTGCAGCCGGATAACCAGGAGAATGAATCGCAAACACTCATTGTCGA
GATAACGGAGACTGAAGCACAAACCACTCCGCGAAGCGAGGAGCAGTCGGTGGCTGTTGA
GATTTCCACCACTGAGATTCAAACCGATGTGAGTGGCCAGCCAGCTGAAACTGTAGAGAT
TTCCAGCCAAACTACCGTGACCACCACTATCGAAAAGGAACTGCAGACCACGCCAAAGGA
TTCTCCTCGAGCACCAGAAGCAGGCAGCAGTGATGTGGTGGAATCTCTGGTGCAGGATTT
GGTTAAGGATATGACTACCGATCTGCCAGTGCGTACAAGCGAACAATCTACCGTGACTGA
AACTACCACAACCACTGAGACCCATGTGCAGACAACCACTCCGGAGCCAAGGGAACAAAC
TGAAGTCATTAAACCGGAAACTGCACATGAAGAAACCTCAACCGTTGAACTTGTGCAGTT
CGCGGATGGTGAGATGCAAACCACGCCTCCTGGAGATCAGCAACCCGCATCTTTAGATGA
TAGTTCTCTGACAGCCACTTCGATATCCGTTTCGGAACCCTATGAACTGGAGGTCAAGAC
TACGGTGGCCATTCCCGCTGATTCGGATACATCTGTGGCTGAGCCAACGGTCTATGAATA
CACACAGACCATGCAGCTGCCGAAGCAGGAGAAGAAATCCAAGAAGGACAAGAAAAAGAA
GCAGAAGAATGTGCCTGAAGTGGAGCAGCAGCTGCCAGAGGATCAACAGATCAGTGTGAC
CGTTGAAATCGCACCAGAGTTACTATCTGAGTCCGGCATTGTGGTATCCACCAACCAGCA
GATTGAAGATGTGCCTCATGTAACACCCGTGGTAGACACTCCCATCGAATCCGAAGAAGT
GGAAACGCCCAAAGCTCAAAGAGTGCAACTTCAAATCACCAAGACCACTGTCTACGATGA
GTATCCCGATCTGCCAGTGCATATAACTGAGCAGAACAAGGTGCTCATTGCATCCCAGCA
GAGCAAACGATCCGGAGCAGGACCCACATCCTCAGCGGTGACCATCGAAGAGGTGGGCTC
ACCCACGGAGGAGTTGGTAGTGCCCATCACCCCGGGACCAGACAATCTGAGTGGCGAGCC
CCACAACATCTGGTTCAGTGCCACCACCAGTGTGGATAAGACACCCATTGAGCTCTCCCA
GGCTTTAATTATGAGCGAGAGTTTGCAGCATTATCCAGGACAACAGAAACTGACCCAGGA
GCCAATCCTGATTTCCACGAAGGAGGCCATTGGTGACCGCATCAAGCAGCTCAAGCAGGC
GTCGCCCCAACAAGCCACTCCACTGAGCAATGTCCTCCACTTGGCCACCTTATCTGAACA
GATTAAGGAACTGCCCACCGAGCAACGCATCTTGGAGGTCAACGAAGGTCTCAAGGATCT
CGATGTTGCCATTAAGAATGGTGATAAGACTGTGATTCAAACCACTGTGATCACGGTTAT
CGAGAAGGTATCAACTTGGTTGGAAACCATCGAGTATCGCGTGTACCTCATCAGGCAGAA
CTCTAATGAGGGACCCTCCGAAGAGAAGCTGGATAACTATAACCAACTAAATGACGAGCT
TAGCACCATCAAGCAAAATGTCGTCCAACTTGAGCGACAATTGTCCAAGGCTGAGCCGGA
ACCACAGTTGCTGCAATGCGTGGATAGCCTGAAGGAGCATGTGGATGCAGTGGAGCAGGT
TACACAACAGAACCAGGTGCAGGACAGCAATGATCTGGACAAGTGGCACAACTTCGAGGT
ACTTTTGTACAACGTCTCCTCCGTTTTGGCCGACCTGCAGCAGAGCTACGATCTTTTGAT
CAACCAGGAGTATCCTTTGTCCGCTAAACTGGCCCAGTTGGACGAGTTGGAGCAGCAGCA
TGAGGCGGCGCAGCAGCAACTTGCGCATCTCTGTCAAAACGCTCGAGCTTTCCAACGCGA
TTTTCCAGGCAAGAAGATGCCGCAGGATGTGCACAATGCGTTCGAGACCAGCAAGAATAT
TGCCAACAACATTCAGGCAGAGCGCGAGCGTGTGCTTCAACTTCAATCCCTAGCGGAGGA
GTACGAGCAGACCCTTAAAGAGTTCACCAAAATCACGGTTCTTGCCGACAAGCTGGTGGA
GAGTCCAATTGTATCCAGTTCCCTCGAGCAGCTAAACAACGAGGTGCAGAAACAGAGGAA
GTTCTTCGTAAATCTCAGCCACTGTCGCGCCATGTTGGAATCCCTGGAGGAGAACATCGA
TAGTGAGACCCGCGAGAAGCACTCGGAGTTGCACAAGGAGCTCTACAACAGAGCTACCAG
TCTGCTGGACAAGGCATCCGAAAGGTCCTCCAAATTGGTGCAAGCTGCCTCCCGTTGGAC
TGTGCTGGAGAAGGGCATGCGAGATGAACTGCAATGGCTTCAGGTGGCTCAGCAACGAGT
TCCCGACTTATCTGCCGTAACTTCCGCAGACTACGATCAATACACCACTCTGTACCAATC
CCTGAGCAATGATATCTCACATCACTATGTGAAAATGACACAGCTTTCGGGAATAGCCAA
CAAGTTGCAGCTTTTGGTGCAAGCCCCCAATCTCGTAGAGGAAACCAATGAGGCGTTGAT
AGTGCTACTCAAACTCCGCGAGGAGGTTGCTCTCTACCTTCACCGCCTTCTGGTCTTCAA
GGAAATCTGGGTGCAGTACGAACAGCAAACGGATAAGCTGGAGGCCTTTGTACGCGAAGC
AGAGCAGGAATTGAGGAACATCCAGATACCCTCGCAGCCCACTCACCAGCCCATCGAGCA
CATGCGTCAATTCTGGGAGATTAAGGCCCGTTTCGAGCTCCACAATAATGTGAGAACCGA
TACGGGTCTGAGCTTTGAGAAATCCCTGCAGGTTATCCCCTTGGCGGACGAGATGCTACA
GCGGCAGTTCCATGCCCAACTGGAGGATCGCTGGCAGGCAGTGGCCCAGGCCATTGAACT
CATTCAGCACAACATTGTGGAATGCCTGTCGTCGGAGGATGTGCCCGCTGACGAGAAGCT
CAAAATGGTAGAGCGAGAGCTGCAGGAGATCTACCTGACCATGACCAGCATGAAGGGAGT
CATCAAGAACGAGGAGGAGCTCTGTCTGTACATCGAACGAGTCCAAGTGCTACGCACTCG
CGTCGGATTCATTGGCAACGAGCTTGGCAGGATCGGACTGCAAGAGCCCGCCATTGAGCC
GGAAAAAGTTGGTGAGCTATTCTCGCTCTCGCACAAGATAAGTACCCAGATTGCCGAGGA
GCTAGAGGGTGCATCTGTGCTGCGCGACCAACTGCAGGCCATCCAGGAGGGCATTAGCAA
TCAACGCAAACACCAGGCCAAGATCTCGGTCATTTTGGATGAATGTGAAGCCGCCGAGCG
CCAGGGAGCAGATGTTCTCGAAAAGGCCGTCGCCGATTGCCAGGCCGCCGGCGAGGAGCT
GGTGATCAGCTGGCAGGAGATTATGCGAATCCGCCAGATGCTCCACACCCTGCCCATGCG
CCTCAAGATGTCCGTTTCACCGGTTAAGTTGGAGAGGGACATCTCCCAATTGCAGGACGA
CCACGCCTTCCTCGAGAGCAAGTGCACCAACATAATGGCCATCCTGAGGAGCCGCCTAGC
CGTCTGGCTGCGCTATGAGCGTCAGCTGGAGCTGGTCCACGGATCCGTCCAGGAAACCGA
CTTCATGATGGAACTCATCCGGGTGCACGGTCAAGTGGACTACGAGCGCCTGCGCAAAGC
AACTGAACGTTTGGAGGTAAGTTTTTAGCTCACAATTTTATGACTTTGTTTACGCGCGCG
TTTAGGGATCGATTTGTATCTCAGATATATTTGTATCTTTCAAAATGCGCTACCTGCTGA
GCGGAATTTTTGCGAACAGCTTATCAGCTTAGTTTTCCCAGAGGAAAATTAGAAATAAAA
TCCGCTACATATTTGTAACGCGCCTCATTCATTTTCCGATACTCGAAACAGAAACATCAT
CTATACGTTTTGTTCTAAATAATAATTTAATCATTTAAATTTTAAAATTTATTCAATACT
ATTTGCGAAGCAAAGACTTTCATGTAGAATGTAAATTTAAAAAGCTATCGGTCGTCAAAC
TTTCGGCAAGCTTTTTCGTAAGCTCCCGCCGCATGTGGAGCTCTTTACGTAGCAAGTTTA
TCGCGGCCCCAGTTGACGTTAACTTCGAACCGAGCGCGTATCTCCCGTCGCGGTCGGAAT
CCCATATACAACTAGACTAATCCATCTTTATACGTGCAAATTAACCCATCGCAGGGACTG
GCTGGCGATCTGCATAACCGCGAGCAACTGATCGATGAGCTGAAGGGTGCCGCCAAACCG
CTGATCGAGAGCTGCGATGTCCAGATTGTCGAACAGATCGAGTCCGCTGTCCAGGAGGCG
GTAGTCGCCTGGAATGACACCAGCGAGAATCTGCAGCAGCTGCGAACCCGCTACCAAAGA
GCCGTCGAACTGTGGGATAAGTATCGCAACGCCTCAGCCGCCGTCAAGAACTCCATTGAC
CAGCAGATGGATGCGGTCAAGTCGCTGGAGCAGCCCCTGGATGCCCTGCAGCACGCCAAG
GTGAGTGCCCACAAATGCCGTGACCCGTCCGGCACACGGGTCGTATGAGTGATTTATATC
GCGTGTGGGCGACAGTGATGCCAACGACCTGTTTGTCACATAGGTAAAATCGAACCGGAA
ATATATAATAATTGAACAAACAACAGAGACAGAAAATCGGTTAATAATTTGTGCATTCTA
AGTACAAAGATATATCGATTGGTTTGTTATTTAAAGTCAATTAATCTAATTTAGTTTGAG
CATATTTCAAGTGTAGTGTAACATAAGGTAAGGTAAGGTAAGGTTTTTTGAGATCTTTTG
GGAACATAAGTTATCTAGATAAGAGGCTCTTCTAAAACTGATAAATCCGCCTTAGGTGCA
CATATCTTTTTTTTATTTTTGGCGGCTAACTAGGACAGAAATGGGGCTCTTTAATTGGCC
ACTGGGGACGCGGGTGTTCCAACTAGTAATTACATTGATTTTCTCCGTAGTGCTCGCCCT
ATCAATTTTTTTGGGCGCGTCAATGTAATCGGTTCGTAATAGTTCCGCCGTGAATGTACA
TATATGAGCTAACTTGGCCGGGCTGTGTTTGTGTCATAAATTATGTTTTGGGTAAATATG
ACCGACATCGTACGTACGATTTCCTTTTCGGCATTTACTTAAAAAATTAACGCATACTCG
GATCGCCGTTTTGTGTTTATTGATCATTAGGGTCATTATATTATGGTAGGGGGCCCAACT
CGATGGTGTAATTATATTTTCGGACAGGCGACCAACTGTCATTTCACACAGGAGAGTTTA
TCAACCCGCTGCTGTTGGGTGGCTATATTTTCGTATTATTATAGTATTTTATGTATACAT
AATCAGCTTTATCAACAGCAGCAGTAGGAGCAGCAGCTGAAAAACAGCGGGAACAGGTTC
GCAAATGCCTTGAGCTCCGAAAGAAGATAAATGTGGAAAAAGATAGACAGACACAGAGCG
AACAATACCTAATCTATGTTGGTATTTTCAATGCCAGTTTTCTAAGCGTTTGTTTGCTTA
TGTAGCTCCGTGATAAAGCATCGCCAAATACTTGCCAGATGATATCATAGGGCGGACATT
ACAAAGGGCATTAGAGAACAACTTATGCGTCGGCAAGTGGTGGTGACCCGTTTTCCCCTC
GAATTGAAATCGAAAGTGCGCCGGGCACTCACAGCCCTAATTACCATTGGCGAGCAGGGA
AATGCACTCGACAACACAATTGATAAGGGTCTGAGGCACGAAATGGAACACCAGCCCGGC
CGGCTTGGGCTAAATACATTCGTCGTTGTGGTCGTCGTCGAGTTAAATATAAACCAGTGA
CATTTTGCCAGGCATCCAATATAATTGGGGTATGTTTAGTTCAGAAAGAGCTTTTCGGTG
GCGAGAAAGAACAGAAAGTATTAGAAATAGTTAGGCAAAAGGCAAAGGGAATGTTAAATG
AATACAATTGATAGATGACTTCTATTGAGATGGTTTTAAGTTGATCATTTAAGCTAATCA
CTTGTTTAGAGGAACAAAAACGAGTGATTATACCCTGGACTTCATTAACTAAATTGGCCT
CCATATCTCTACATTTACACAGGTTTGCCAAGACAACCTGACGACCCAGAATGACAGAAT
CTTGGAGTTGCGCGACATTGTGGCCAAGATCGCCGCCGATGTGGGCCTGGATGCCTCAGC
GCTCATGCAAGGTGAATTGGATGCACTGGGTCAGCGATTGGCCGAGTGCAAGGATGCCAT
CACCACGCTGGCCAACGTGGCCGAGACGCAGGACAAGGAGCGCAAGGAGCTCGACAAGGA
GGTGACTCTGGCCAAGGCCTACTTCAACAATGTGCAGCAGGTGAGTGAGAGGCGAATGAA
TGAAATTGTGTTAGTACACGGAAGTAGGACGTGTATCCCACTGGGATTAGACCCATCTAT
CCTGACCAGCTATCGATTGTGGCGTCGAATAGATGGATATTTTGCATATGCTAGCTTGGG
CTTGGCGTGTGGAAATTCCCACACTAACAAATACCGATTAGCCGGCAAATGTTTTTGCTG
TTGTGCTTGAAGCTTGTAGTTGTTAATCCAATACGAAGGACATGCTATTTTAAGTGGGTT
AAAAGTTGAAAAAGTTTTTGTGTATCCTGGCTGGTAGCCCACTCACCGTGGTCCCAGTGC
TCCTGCCCATCATTATTGATTGATCAGAGGCGTGAATATAATTTTTGAGAGTACGATTCC
CCAGTGAAAAACTTATAAAATCGTAATTGACACTTGCTGGCCCGTGGGAAGGTTGATAAA
TTTTTAATGACAATATGTGCATATATGTGTTCCATGTTTTGGTCTTTGGGGCTAGGAAAC
TTATTGCGGACTATTTCTGTTTTGCACTTCATTTCATTTATCAAACAACTAATTCACTTC
CCTGGGGAACGGAAGTTGAGCATTTTATGAAATTACAAATAAATTAGTTCTGTGATAAGC
GCATTCTTTAAGAGCTCTAAAGAGCTTTCCCCTTTTAAATCAATGCCACCATAAATATAA
ACGGAAGCTTGGCTGATTAACGATCGTACAGTTTTACGATTCATTCAAAAGAGGGGGCAT
AAACAAGTGATTTCATTGATAGGTGGTGGCATACAAGTGCCTTTACAAATTAACGTACCA
AATTGGGCATTTTTTGGTAGAACTTTCCAAGCACCTTGCACCACGGTGGGCTCATTTGCA
TGGCACATGCCAACCAGTTTGGATTTCCCCCGGCTCCCTTTTCCGCTCACAGTCCAACTC
CGCCGCCCACTTTTGGCCCCCTCATCGACGCCTCAGACAATTGAAGTTGGTCACTGGGAG
CGCGTGTCGTTGGCATGAGGTCATTGCCAGTTGGCGGAAAGAGTTGCAATGTGCCACAGC
CACAGCGATTCCCATTGTCTTGGAAGCCATGCAGTAGTGGACAGACGGACGAATGGTAAC
CGGAGACCTGCGAGCAGCCATATTAGGGTCAGGCCAATTAGCGATGCACGAAGCATATTC
AAAGCTGACCACTGAATGAATGAATAAATAATAATTGTTTTCGTTTGCCTCCTTGCAGGA
CATATCCCGAGAGGCACCGCAAAATCCCAAAGAAAGCGAGGAGCAGCTGGCCGCCTTGCG
AGCCCATCTCCAGACTTTGGCCCGAACGGAAGAGCAACTGCGTCAGCTGAAGGAACGCCA
TCAGAATAGCGAAGTAGCACCATCGGTGGCCAGCAGCGATGATGACGGCATCCTGGAGGT
TCTAGCCCTGTGGCAGAAGATTTTCCAGGACACCTTCCAGGAGTATCATCGCCTGTCCAC
GCGACTCGCCCGCAGCCAAAACAGTTCGGAGGCTCTGCGATTGTGGAGGCAGTACCTGCA
GCACGTCCAGTCCTTCCTGTCCTGCGCCATTCCCGAGGATTACAGCAGCCTGCGAGAGCA
GCAGCAGCTGTGTGCCATCCACCAGAACTTGCTCATCTCGCAGCAGAGTGTGCTTTCCGA
GACACCACTGGAATCGGAGCTATCGGAGCAGTACAAGGCTCTGACCAACCTGCACAATGA
AACCCTCTCGAGGATCATGCAGCGCAATGGTGAGCTGGAACGGCGAGTTAGTGGCTGGAA
TGCCTACCGCCAGCAGCTGGCAGCCCTTTTGGACTGGCTGCGTCAACGGGAAGCGGAACG
CAATGCCCTTCAACTGCGCTACATTCACCTGAAGCGAGTGCCCCACCTGAAGCACCGCCT
GGATGCCATGATCCAGCAATTGGATCAGGGAGAACAACAGAGCAAGGCTTTGCAGGAGCA
GCAGCAGGAGCTGGCCAGGCATTGTGACGACGCGCTGGCCACCGCCATGCGAATGGAGCA
GGCCAGCATTGGTCAGCGGATAAGCAATCTGCGCGCAGCCCTAAAGACCTGGCAAGGATT
CTTGCAGCGCGTTACCCAGCTTTCGGAAAGCTACGAGCAGCGAGTTAACCAGTTGCAGCA
GGAATTCGGAGCAGCACAGAAGCTTCTGGATGCCAACAGCGAATCTCTGCCCACTCAGCC
AGCGGCAATTGAGCAACTACTGGGATCCCTGCGTGCGCAAAGGGTCCAACTTGGTGCCCA
AGTCTCCGCTCTGGAGAGTCTCACTGTGACCCAGGAGGAGCTCAAGGAGTGCATCAGTCC
CCACGACATGAAGACCATTCGCCAAAGGAACTGGTTGCTCTGGCAGCAGCACGCCGATCT
GGACTACCAGCTGGCCAACCTGATCAACTCGATTGAGGAGCGGCTTTCCCTACTGTCCAA
CTATCAAATCAGATACGATCGCATCTCCCAGTGGCTGCAACGTTTGGAACAGCGTGTGGA
AAAGGATGCTGATGTCACTGCCATGACAAATCCCGAACAGGCAGCCAAGCAGCTGGAGCA
GCAGGTGAATTCCGAGCTGCAATTGAGGGACAAGGAACGGGAGTGGCTTCTATCCACCAG
CCGGGAACTGCTCACCCTCTACTCCGAGCCAGAAGTGCGATCCCAGGTGCAACAACAGAG
TGACTCCCTCATCGATCGCTGGCAGCGTCTCAAGTATTTGGCCAAGCAGAAAGCCACCAA
GATAGGAGAGCTCAAGATGACACTTCTCCGTTTGGAGGAGCGAATCGCTCTGATCCGCGC
CTGGCTTTTCGAAGTCGAATCCCAACTGGACAAACCCTTGAATTTCGAAAGCTACACACC
GAATGTGATCGAGGCCAAGCTAAAGGAGCATGAGCAAATCCAACGCTCCATTGAGCACCA
CAGCAGCAATGTGGGCGAGGTCCTTAATCTCGTAGAGATGCTCCTCAACGATGCGGACAG
CTGGCGCACGCAGGTGAACACTTCTGGATTAGCTGCCTCAGCTCAGAATCTGGAGCAGCG
CTGGAAGAATGTGTGCAGCCAGTCGGCGGAACGAAAGGCCCGCATCCTGACCATTTGGAA
TCTTCTCCAGCAGCTCATCAAACTTACTGCAGAGCATAAAAATTGGCTGGGAAAACAAGA
AAGCCAAATTGCCGGCTTCGAAAGAGATCAGAAGTCCCACAGCAAGCATAAGCTGGAGGA
GCGCCAGATGGAGCTGAGAGCCAAGCTGGAGGAGCTGGAAAGTCAGTCGGTGAATCTTCG
CCAGCTGGAGCAGATCTATGCTAAGCTGGCCATGAGTGCTGGCGTCGAGCCGGAGAACAT
CCAGAAACTGACACTGCCCACCAAGGTGATGGTGAGCATGTGGCGCCAGTTGACGCCACG
CTGCCATGCCCTGTTGGATGCCATCGACAAGGATGCCAAGCTAATGCGAGAGTTTAACAA
CGCACAATTGGAAGCCACCAACTCGCTGAATGCCATACAAAAGGCTTTGGAACAATTGCC
CAGCGCAGAGAATCAACAGACCTCCAAAGCGGAGCCGAAAGCGGTGCTCCAACGTCTGGA
GAGTCTAGAGAAGAAGTTGCAGGACGCACAACAACATGTCCAGCAGGCGGATAACCTGGC
CCAGGAGGCCAAGACGAGGACCAAGCAGCAACCCCAACTGAAGCAATTGTTGGAACTTGT
GTCCGCCTATACCACCCTTTGGCAGACGGTCCAGACCCGCATTGTCACCCTCAAGACCAC
CTGGCTGACCAGAGCAGCTCAGGCAGCCGCCTCTCTGCCGGTCAGTGAGGCAGCCAACGC
CGCCGTCCAGGTAAACACCCTATCCCAGCGGAAACTCCGCCAGGCCCAACAGATGCAGCG
GGAAACCTCCATCACGGCCAAGGATGCCTACATCATGGAGCTGCAGACGGCCATCACGGA
ATGCCAGAACAATCTGGACGAGCTGCAGCGCACGGTGGTGGACAAGACCCGCAAGCCGGG
ACCCCAGAAGATCGCCAAGCTGCTGGGCAACGCTCAGTCCTCCACCGAGTTAGTGAAGCA
TCTCAGCCATCTACTGCTCACCGAGTGCAAGGCAGATGACCAGGCTGCCGAGGTGGACAC
CGTGGCAGAGCTCACGTTGCGCTTCGATACACTGCAGTCGCAGTGGAAGGCGCGACAGCA
GCACGATCAAAATGCAAGGTAAGATTTTATATTAATTATCTATATATATTTGTTGGGATA
TTTTTCAAGATACTTGCCAAACCAGAAAACCATTTTGATAGGAGGCAAAGTGGCATATTT
GGGAATATACCTTCCCAATTGTGTCTCAAATACTCCAAAAACAACTATGTAATAGGGACG
AACGGCATCCTGAATAGTGCATCATACTATAGCAGATGACTTGTGTTCGTGCACATGTTA
AAAGTTTTCTAAATTTTTATATATATAATAATAGAAGTAACCCTTTTCGGTTTGGCAAGT
TCTGCAACATTTTCCGCTGGTGATTTGGGACCTGTTCTTGACTAACCAATTGTTTTATTG
CTTTCCATTTCGCTGTTGCCTACTTTCTCCTTATGTCAAAACACGCACACGCATATTCAC
ACTCAAATATATAAACTTACCCATGCTTAACTCGAACCTGCGCATTCATGATGACACCAG
GTGCCACCTACCTGCATCCTACAAGTACAACTGCATCCAGTAAGTGTATCTACCTGTCGG
TGGGCAGTTCCGACCTCCGACCTCCTGTTGTTTGATCCTTTGTTCCATGTTCTACGTGGT
TTTCCACTAGACAAAAGCTGGCAGTGGACTACAAATGGCTGCCAGTCTCCAAGGTGGCGA
ACAGCAAGAGGTCGCCGAGCAAACGCCCTAACTATCTAAGTTAACCTTAAAGCCAAATCA
ATGGACTTTGGAAAGGCGAGCTTAAGCTAACATTTAATCGATTACTACCATAATCACTAT
CTGCTATGATTATTCAATTACTAATTTCTCCACTTTTTTGACCAATTCTAGCGAGGTCGG
CCGGCTAACGTGTCCGCTCTGCACACAGCGAAATTGGCAGCAGATCGACAACGATCTGTG
GCGCCTGGAGCAGTGGCTGCAGTTCGCCGAGAGCACCCAGAAGGCCCAGTCAGCTCCACC
CTCAAACATCGAGCTCCTCGAGGACGTCACGCAGGACCATCGCGAGTTCCTCCTGGATTT
GGAGAGTCACAAGTCCATCATATCGTCGTTGAATGTGGTCGGTGACCACTTGGCTACGCA
CACTTTGGATACCGAAAAGGCGCGACAGCTGCGATCTCGTCTAGAGGCGGACAATGAGCG
CTGGAACAATGTGTGCATCAATGCCACCAAATGGCAAGGTCTTCTCCAGACCGCCCTGAT
GGGCAACAGCGAGTTCCATCAGACCATCGGTGAGCTGGTCGAGTGGCTGCAGCGCACCGA
GCAGAACATCAAGGCCTCCGAGCCCGTTGATCTCACCGAGGAGCGCTCCGTTCTGGAGAC
CAAGTTCAAGAAGTTCAAGGATCTGCGAGCCGAACTAGAGAGATGCGAACCTCGGGTGGT
CAGCCTGCAGGATGCCGCCGATCAGCTGCTCCGCTCCGTCGAGGGCTCCGAGCAGCAATC
GCAACACACGTACGAGAGGTAAGGTGTCCAGTGGGCCAGTTCCGAGGGCGGAACGAAACG
ATTCGTGGGTGCCGCTTGAGCTTAGGTCCTGGAGAGGTTCCAGTGTTAGTTGGGCGGAAA
ACAATTAAATTCTATATATTTTATATGGTTTCAGTTGGTATTCTTAGTTCATTTGACTAG
CTTTAGCAATGATCACTTGGAAACTGTAGATAATTTGTGCTTTTTTGATATGTGCCCTTT
CTATAAACTCCTTGTAGAATCCAAACATTAGTTTTTTATCCTTTACCCAAGAGCTTTTTC
CTATTTCTCTTATTCTATTAGCAAGTAATTCGGCCTTTTAACTATCCAAATATCCCAAAA
CTTCCACTGTGCACTATCCACCAAAATCCTTTTCGGTAGTTTCCGCTTCAAAAATTTGAA
TTCACATTCTTTCAAAATTATACTAAAAAAATATCGCCAAGGATAATTAAGCCTTTTGGA
ACCTTCCACAACTAAACATTTTATAGCCATTTAAACTAGTAGAACGTATTTCAGCTATAT
ACAAAATCAATCGTATCGATCGATCATTTATTTTTTGCCTCTACACATATTTTGTGTTGC
CGTTTTTGTTGCGTATATTATTTTGTGTTGTATTTTTGGTACTCAAAATTCTTTCGTCCG
CCCATTCTAACCCTCCATCCAAACATACACCGCCAAGAGCACATGCAAATGTTTTAAATG
CTCCAGAACCCTTTCCAGATTGACCGATCTCCGGCTGCGTCTCCAATCCCTGCGTCGTCT
ATCCGGCATCTATATCGTCAAGCTGGGTGCCGTCCTCGGCTACGAGGGCGACAATCTCGG
CGTGCCATTGCACATGTTGTCTAGTGAGGTAAGTCCAAGTGTCCCATATTCATTGCCCAA
CACCTTGGTTTCCTGTTCAAAAAACATGATTTGTCCAAAAAAAATGGAAAATAATTAAAT
TTTTGATTTGTTGATTTGTGAGCGCACCAGAAGTAAGTGAAACCCATTGGCAGTCTAACG
AAAAAATATGAAAAGAATTGAAACTTATGATTTCTATTATTTTTAATTTATTTATTTTTC
TTTCTTTCTTTTTTCTGTATGGCAAACATAGCTTTTGGATAATACTACATTATCAACCTC
TTCCATGCAGGCCGCCGCACCCAACACAGAAAATGCAAAGTAAATATCTATAGAAATTGA
TTTTAAGTTTTTGAGTTTTCTCACATGCATCGTAGTTGAAAAGTATTTATTGTTTGAACA
ACTTGTGCACTTTATAGTTGAAACTGAAAAGAGCACGTAGTTTGTACTCAATTAGTTGCA
TGATAGTGCTTTAAAACATATTGAACATAAACTAATGGACTTATAATTCGAATCTTTAGC
AACACCGATGGCGGCGATGCTGTCGATGGCGATGTCATCAATACCACGGTTCTGGCGCGC
GGTGCACGATTCCTAGGCCGCGTTGCACGTGCCTCGCTGCCCATTCAGGCGCTCATGCTG
CTGCTTTTAGGTGTGGCCACCCTGGTGCCCCACGGTGAGGACTACACCTGTATGTTCTCC
AACACCTTTGCGCGCAGCCTGGAGCCCATGTTGTCGTATCCCCACGGACCGCCACCCACG
TAAAGCTGTCGAGTTGCAATTGGATTAGTGCAATGAAACACGATCAAAAAAAAAGTCAAG
AAACCCTATACCCTAAGAAGAACCCCCTATGAAAAACGCCCTATGAAAAAACCCAGTTTA
AAGATGCCTTTTGAAAGCTAAATTTCAAGTAAGAAAAATTTAAACAAAAAAATGTTGAAT
ATCGAAATGGAAGAGTTGTACATTTGTGTAGTTTATCACATTTTGTAATTGTATGTAATT
TTATAGTCATTCGATAGCTAGAGGCATTAATAAAACAACCAATTTGTATATAACCTACTG
AACCGAACAGACTCGACAAGCCGAACATGAAACACGTAAAAGAATTAAACAAAAAAATAA
AAAGAAACAGAATGAACTAACTATTCAAACTAACGACAAGTAACCGAAACCCTTTTGTAA
AACGATATATACATTATACATATATATTTGCACAGCAAACAATTTATATATTCATATATA
CCCACGTATATGATCCCAAAAAAACTATAGAGAACCCAAACATTTTGTATATAAAAATAT
CTAAGCTAAAACGAAATCAAAATACGCACACGAACATTTTACTCATCAACGCACGTTTTC
GCATTTAGAGAGATCCTGGGCAGCAGAAAATTGCGATTAGCATCCTGCCAATTTCGTGGA
ACATTTTCGCAGGATATGATCTCAAGTTCCTGCTGCCAGCGATGGGCTAGAAAGGCAAAC
GAAATCCCAAGACAAAATCATGACCCACATAGACCAATCGCCTGGAGATCCTCATGGCAA
CCAATGTTCCTAGTTTCCAGCGCGTCCTTCTCCCAAACTCAGGGCTATGCTGTCAACAGT
GGGCATTGACCTCCATTTGGACTCCGGCTTCTAAAGAGACCCCGTGTCAAGAAGGATCAC
TCTACCCAAGGCCAAGATCTCTCCCACGGCCAAGGGTTAGATGGGATAGCAGCCAGTGCG
CCAGCCACAGGTCACTGGGCTCGAAATCAATCCTTAAACTCCATCCCGACACTGGGGCCT
AGACATTTCAAGCATTCCTGATACTCATTTCCAAATTACCAATAGACATTGACCATCGAA
GCCAGCTCTCAAAGAAAAGAAAATGGAAAACGTGCGTGCCACGAGCATTGAACAAAACGA
AGCAAGTGTCCTATGCCGGTGCTAAACCAACCTACAAATTTTCTGTATAAAGAAAAAATG
TAAAATGCGTATACAAAAAACAAAAATATTATGAATTCATAAAAGAAGAGATTAATTCTT
TGAAAAAAAAAAATCGTAAAAATGCAATATGCATATTGACAAGTGACGTAAGTCCATCCA
GTAAAAGATACCTATTTTGTTGTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2876, 9432..9493, 13531..13803, 14290..14456, 14516..14792, 14871..17477, 17683..30870, 31214..31528, 31634..32776, 33166..33372, 33508..33745, 33858..36640, 38848..39153, 40586..40737, 46103..47072, 47177..47389, 47444..47704, 79462..79572, 79972..80136, 80197..87315, 87834..88139, 89722..89979, 91198..94157, 94971..95597, 96306..96447, 96691..96758, 96959..97545
1001..2876, 9432..9493, 13531..13803, 14290..14456, 14516..14792, 14871..17477, 17683..30870, 31214..31528, 31634..32776, 33166..33372, 33508..33745, 33858..36640, 38848..39153, 40586..40737, 46103..47072, 47177..47389, 47444..47704, 79462..79572, 79972..80136, 80197..87315, 87834..88139, 89722..89979, 91198..94157, 94971..95597, 96306..96447, 96691..96758, 96959..97199
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved