Drosophila_melanogaster Locus RpL27A
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL27A
Drosophila_melanogaster
RpL27A
2L
snoRNA:Me18S-C1831
1691..1762
3189
CCCAAACATCGCGGATGGCGCGTCCAGGATGGGCACCACGTCTCCGAGGGCACAATACT
GGCCACCCAGCTCACAACGCGCTTTCATCCGGGCCTGAATGTGAGTAGCGCAGGAAGGAG
TTATCCCGGCATATTTTTATACTTTTTCCCATTGAAAGGTGGGCTTTGGCCGCAATGGAA
CCCTTTTCGCCATGGAGCACGGCAAGGTTTATGTGACCTGCGAGGCCATCGATCCCAACT
GGGACCACACCTGGATTCAGCGGAACTACGCCGGTCGCCAGGGCCAGAACATCTACAAGA
AGTTCTTCAATGTTGTGCCCGAAAATCAGCATCAGCGATTTCGTCTAGTGGAGGAAATCT
AGATTGTTAAATACAAAATTTAAACCAAATGGAAATGTGAATATTTGAATTTTTGGCAAT
TAACATCGATGTGCTTAACAGCACCTGTTATATTTACATGCCAGCACGACCGTTATACAG
CACTGTATTTAGCAATGCTCTGAACCAACTATCGAATACACGCCCCGAATTTGAAAAGAA
ATCCAGTTAATAGCCAGATATCAATGCAACATTTTCGATTATTAATTTCGCAAAACTTTT
TACATTGCGAACTTCAAAAACAAAAACTACACTTCCCCCTTTTTTAGCCAAGCCGAACGC
TATTGAACTGTAAAATGAACTTTAATAATAAGCCATAATCATCTATAAGAAATTATAAAA
TTATGCACATGACGGTATAGGCACTGCCTACAGAATTTCGCTTAAATCAAGTACACGTTT
TATCCTATGAATGTAAAAACTTATTTAGTATTGTTGTAGTGAAATTCAATTTAACGCTTA
TATATGCAGTATTATGTTTAATTATTCATGATTATATATTTTCATAATGCATATAGACTT
AAATTTATCTTAAATATAATGGTGTGTACGAGATATTTTTTCAGACTAAAATGGTAGTTA
GGGGTATATGTTTTCTGTCCGGATGGTATTTCGTATTTTTTGTTATCGCCGCCGGGCGGT
CACACTGCTACAACCGCAGCCAACTTCGCTTCTTTCTTTCCTACAATTTTAAAGATGGTG
AGTGGACGTCGGTAAATGTGGTGCACCTAAAATGTGGTTTGTGGGCAGGCGAATGATGTG
GAATAGAAATAAGAGCTCACTCAAAGTGCCGCAGCATGCCTGCCCACTGACTGCAATGGC
CAAGTGAGCATAGCGACTGGAGCAAGTAAACATAACCTCCAGCACGTGGGTGAAAATGAT
TGAGGAATGCTCAATGAAAACACGTTTCTTTTCTGCTCTCCCTTACAGTCGAATATCAAG
CGGAAGAAGACCAGGAAGCTGCGTGGTCATGTGAGCCACGGTCACGGCCGTATCGGCAAG
CACCGCAAGCATCCCGGAGGTCGCGGTAACGCTGGTGGCATGCACCATCACCGCATCAAC
TTCGACAAATACCATCCTGGTTACTTCGGCAAGGTGGGCATGAGGAACTTCCATCTGCGT
CGCCAGCACAAGTTCAGGCCCGAGATCAACCTGGACAAGCTCTGGTCCCTGGTCGGAGCC
GAGAAGTTCGCCGAGCTGGAGAAGGAGAAGAGCACCAAGGCTCCCGTCATCGACTTGGTT
AAATTCGTAAGTTTCGCCCGAATTCCCCATCCAGCTACGCGAACTCTGCTGCCGCTTTCA
ACATGAAGATACACCCAAGGCGATGGGCGGACAGAATGCTACCGTACAATTGCTCTCACC
GTGTAGAGGACAGCCTTTCAGATCAAAGCCAGCAGTTCTTGAAGAGGATGTGCACCCGTT
CTCACCCCGTTGTAACCCATTGTATTGACTCTGGTGTCCTTCTCATGTCTCCACAGGGCT
ACTACAAGCTGCTGGGCCGTGGTCACCTGCCCGCCCGCCCCGTCATCGTGAAGGCCAAGT
ACTTCTCTAAGAAGGCTGAGGACAAGATCAAGAAGGCCGGCGGTGTGTGCTTGCTGAGCG
CCTAAGTTAAGGTGAGCTTGTGTGTCTAGCTGTCTTACCTATTCGTCGGCGAAGCAATGA
AGTGCAGTATCCTAATTGCTATTGTTTCCCTTGCAGATTCCTCCTCTACAGAAGAAAAAA
GCAAGTGGACTACATTCGACCATCAAAAATGTATTTGTTTTTTAATAAATTTAAAAGAAA
AACAAGTATTTGCTATTCCGACAAAATGTGTTTACTAAAAGGTATTGGGGCTTCATTTTC
TGCTCGCTTGGCGCAAGTTGTTTAGAACTTTCTATTTCTATTCCTGCTACAACTTTCCTT
TATATTTTTATAAAGAATAATTTCTATATGGTTAGTTTGTTGTGGCAAAGGAAAACTTGT
ATTTTGAATCAAATAACAAGGGCAAATTTAAATGAGTTTGACAATATTAGAAGTATGCCT
ATTTTTGTAACTTAAGAGGAACAGTAATAATATAAAGAAAATAAATAGTAATTTAAAGAG
TATAACTGCGTCGGTGCGCATTATCAGTTAATCCCTCCATTTTTAGCACTATTCTCGACT
AGGCTTTTTGCGCCTTCGCAGCTACGGTCACACAGCGGCGGGCAGAAAGCTCGCGGAAAA
ATTCGGAAGAGGCGGAAAAGTACGAGACGCCCGATATTGCAAAAAGCGGAAGCAGATTAC
GTGTAGGTCAAGGCCGTAGGGATGAGGGCAACTTCCATCTTTGACCTTGCTGTTGGTGAT
GGGGTGCGGCGACCTTGGGTCAAGGACACGACCGAACAAGAGGCACCGAATCCAGGAAAC
GTAGTCAAAGTGGAGGGCATGCCTGTGTGGGCGGGGGATGTTCCAGTAAAAACAAAGTAA
CTTGATTATGACCTCTGTGTTGCAGTTAGGAAACGAACTTGTTGACTTTGTAACATTACA
TAATCGGAAGCCCAGAGTGAGGAGAACTGCTGCGAGATGGCCAACAAAGTGCTGCGAAAG
GTGACGCACTGCGTCTTCGACATGGACGGTCTGCTGCTGGGTGAGTGCTGCCGTGCTTGT
ATCTGCTTTCTGTGTTAACTATTTGCCGAACAGACACCGAACGCCTTTATACTGTGGCCA
CCGAAATGATCCTCGAGCCCTACGGCAAGACATATCCCTTTGAGATCAAGGAGCAGGTCA
TGGGCCTGCAGACGGAACCGCTGGCCCGGTTCATGGTCGAGCACTACGAGCTGCCGATGT
CGTGGGAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1308..1625, 1856..1990, 2076..2189
1074..1076, 1308..1625, 1856..1981
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved