Drosophila_melanogaster Locus aru
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster aru
Drosophila_melanogaster
aru
2L
snoRNA:Me28S-U1230
1369..1496
6013
AATTAATTATCTTCACCTGAATGGAAGCTATGCTTGGGGCATGTCTCCAGGTTTATGGT
TCTTGTCGGGGAGTTCTTAGATACCAGTGCAGTTATGTATCTTAGATTGCCTTACCGAGG
CTTATAATTTTCCCCTATTTACAGATGCATAGATACATATGTGTGGATTGCAAATATTTC
AAGATTATAGAAGTACAAAAGTAGTAATACTTATATTATAAACATATATGTATTTCATTT
AGCATAATGTTTTTGTAGATGTTTATGATGACTTAACTTAACTTCAAATCACCCAGCAGC
TTTAGTACTTTCTCTAAAGCATGATTTATGCAAGCCCAACTATTTCCATGTTACCCAAGT
GCGATAATGTTTATCGCGTTTCGTCATTGGCCTCTAAGCTGCTGTAGAGTTAGGAGCGAA
AACACAAATCTGTCAAATTCCACAAGTGTGATGCAATTTGGGGCTTGTACGAACAGTAAA
ACGCTGAAATATAACACAGCGGCGCAACTTAACGAAAACAAAACATTTCCAGGGGTGTAG
TGGGTCAGTGTTTTCTTTTTTACGTGCACTTCGCTTGTTTGTTTACTGCGATTTTGGCTT
GTACAAGATCGTAAGCAGATAGTGCCTCCAGCTGACCCCCTCTGCAGTTTCTCTTTCACC
TGTTTGCAAGTACACAAGCACCCAACACCCCCTTTCCCCTGTCCATTGACCCTGCGACAC
TGCTGGATTGATACACTGAAAACAATCGACAAACTTGGGGGTGTTTCTATCATGGAAAAT
GTTGTTAACATTTAAAAATGGTTAGAACTACATTCTAGAGACTTTCTCGCCATAGGATTA
TTATAATGATTTTCAATATCTTTATAAAAACAGTAGCGATTTTTGCTTAGTGTAGATAGG
TATGCGACACCGCTGCCCGCGTCGCAGTCGGCGTCTGAGCCCAGCCTAAAACAGCGGAAA
AGTTGTTGCTGTCACTTGAGTCGAGGGAGCGGTTTGGATAGAGTCTGCGAGGGTTAGAGC
GAGAGGGAGCGAGAAAGTGTGTTTGCAAATCTCAGTTTTACGTGTGTGTGTGTGTCTTTT
GCAGGTGTGTTCACTGGCTACACAGAAAAAATAAGAGAGATTTATCCGAGTGTTGAAAAG
AATGTTACTGTGACATAGAACCATAGTTGGCCTAATTTTTGAAGATAAGAGCTATTACTC
TACAATTACTCTCTATTACATCTACAATGCAATACAATTTGCTGCTGTTAATACAAATAA
GATGAATATAATCGGAAGTAAACTATCCAAAGATATTCTCTGTGTAGTCAAAGTGGAGAC
ACCGAGCTTAGAGGAGAACCTGGGGAAGTGGAAGTAGCGCGATTTTTGAATTCCAATGCT
GATCCAAGCCAACAACGAAATGTTAAAGTTTGAGAATAATTGCGGCCATGTGCGGATCGC
TTGGAGTGTGTATGCCAACGCTAGTGGAGGCTTGGAATCGGAATGCGGTCTGAGTCAGAG
ACGATTGGCTGCGCAATATCCAAGTGGCTTGGCGGGATTAGGGGCCTTCGGATGCAGAGG
GACTTAGTCTCAGCTGCACAAAATAAACACAGCATAATGATCTAACACATACTTTAGGAC
CAATTTTCGTATTCGACACTCATAAGATTTCAGCTCGAAGACTCGGTCAGCGGAGGCTTT
AAGGTCTTGAGAGACCAAATTGGGAACCAGACTTCCAAGGGGCTTAACCACACCCCTGCC
AATAGGAAATTTAGTTTTGGGAATACTATTCTAATCAAGTTAAACATGTTTTTCGACAGC
AGTCACGATATAATGTTTTAGTCATTGGAATAAGCGATTAAATGGGATTATTAAAAGCAT
ACACATAATTCTAAATATTATTTTCAAATGACGATAGTTCAACTCGACCTAAGAAGCAAA
AGTATAAGTTGGTAACGATCAAAACTTTTAATCAATGTTTAAGCTACTAAGTTCATCATT
TAAACGGTAACTTATATTTTAAACGAATCAAAGACCGATATACAAAATTGTTGACGATGA
TGATGATGTGAAAAAATTTTATTTTTAGACGGAGCTTCAGACGTCGATCGAAGCCTGTAC
CGGGATTGGGAGACACCATGGTGAACCACCACTCGAACGGAGGCGGCAGTGCTGGAAACA
GTAGCGGAAGCCTAAGAGGAGGCGGTGCCCATGGAGGCGGCGGCGGAGGAGGAGACTATT
CCGGAGACGATCGCAGCGGAGGCGGCGAGGAGCGGGAGCGTCTGGAGAGTGACTTGCACG
ACAAGCCCACCTACCTGCTGGAACACCTGGCCACCTTCACGGTCAACAAGGAGTCCGGCA
TTGTGTATCCGGCGGACGGAATGCGTCGCCTCCTTCAGCTGGAGAAGACCACGGGTATTT
GGTCGCAGAAGATGCAGCTCTGCCTGGACTATCAGTGGGTGCTAATTATGGACTATGAAA
CAGGGGTACGTTTCACAAACTGGGAAAGATCCTTATGGAACTCATCTTCATCCTTGCCTT
ACAGAACATAATCGAAAGATTCCCCGCCTCCTTGGTTCAGGAGCCCACCGCATTCACCTC
GAATGACGCCATGGAGCTATACAACAACATTCTGGTCTTTATCGTATCCGGAGGCGGTGG
TTCTCGCTCCGAGATGCACATATTCCAGGTGAGAATTAGTGAGGCTTCTGTCTCATGACA
GTTTCATTCAAATGATTTATCCCTGCAGTCACAAAGTGTGTCCGCCGTTCACCTGGTTGA
GGATCTGAAGCAGCTGAGAAGCGGCAAGATGATAACGCAGCAGCGCGGTGCCACACCCAC
TCAATCAGGAGGCGGAGGAGCCTCCAGCATGGCCATGATGATGAGCAAAACCTCCTCGTC
CTCGTCGCATAGTAGAGTGGAGCTGCACCAGCACAGGGAGCAGCGGGCAGAGCGCGAGAG
GGAGCGTGATCGAGACCGTGAGCGCGAAAGCCACCATCACATGCACCAAAGGAGCAGCAT
GGAACAGTATGGAATCCGTGCCGGAGTAGGAGTTTCTGGCGATGACGTTGCCCACATTAG
TGGCGAGACGGATTCGGAACACGGTGGGATTGGGGGCGGTGGCGCAACGGAGCGCGATGA
GACTAGCTCCACGTCCAGCGAGAAGTACGAGCGGGATGTGGCTGTGCTGAATCACTGTTT
CGATGACATCGAGAAGTTCATAGCTCGTCTTCAGCACGCCGCCGCCGCTTCCCGGGAGCT
CGAGCGCCGTCGTCGCAATCGGAAGTCGAAGAAAAGGGATCCGGGGGAGGGATTGCTCAC
TTTGAGGACACGGCCTCCCCACGAGAAGGAGTTCGTGGACATCTTTGCCAAGTTTAAGCT
GTCATTTAACCTGCTGGCAAAGTTGAAGGCGCACATCCACGATCCCAACGCTCCCGAACT
GGTGCATTTCCTCTTCACGCCGCTGGCTCTGATTGTGGAGGCCTCCAGCGACACGTACTA
CGAGTCACAGCTACCGGCCCGTGTGGTTAATCCCCTGCTGACCAGAGAGGCCATCAACCT
GCTCATCAACTGTGTAACCAGCAAGGAAACGGAGCTGTGGCGCTCGTTGGGCGATGCCTG
GGTGATCCCGCGAGATCAGTGGAAGGATGACGTTGGATCCTACCATCCGGTCTTCCTCGA
TGGCTGGTCACCGGACTATTTGATCAACGATGAACTGGAGCCACCACCAAATTCCCCGCC
CGCTCATGTGAGCAAGCGCAGACTCGAGGTCCAGGCTGGATCCGGACTAAATGGTCGTGG
GGGAGGCGGATACGATGACTACGACTCGGGGAACGGGATGAACATGGCCATGGGTATCGA
GAAGTACACCATCCACCACGGCAACGACGGTTTAAGGGAGCGGGAAAGGGAGCGCGACAG
AGAGCGGGCGGGCGCAATCAGTGCGTCTGACTTTAACGCCCGCAGCGAGCTGTCGTTCGA
CTCGATCGAAGGCAGGGGCGGCGGAGCAGCGGGACATGGCCATGGTCATGGCCACGGACC
AGGAGCTGGACCAACCCTTAGCGCCATCACAGCTGGTCTGCAGAATCTGCATACGAGGGA
ATCTCGCAGTGGAAACGGGTACGGAGCAGGAGCTGGTCCGGGGCCTTCGTCGGAGTTGGG
CGGTGGAGGCAGAGGCCTGCCGAATGTCAGCGACGACCAGATGCTCGAGTCCTGGCTGGA
GGATCTGCAGGCGACGGGCGCTAAGATTGTGCTGGTCACCTATCCGCGAACCGCCAACAA
CGACAAGGAGCTTAGCGTGATGCGAGGCGAATACTTGGAGGTAAGGCCAGCACCCACGTT
ACCATCCTTCGTTCTGTCCTATAACCATCTCTTCGAAACTTTAGATCCTTGATGATACCC
GAAAGTGGTGGAAGGCGCGCAACATGCGGGGTCAGGTGGCCCACGTGCCGCACACGATTG
TAACCCCCTTCAATTTCGGGGATGGAGATGGAGCCCAGTTCTACGGGCAACAGCAGCAGC
CACCGACGGGTCCCACAGGTCCGGGCAACAAATCGCGATCAGGGGTGAGTAAGGCTGGTC
ACTCAATTCATGATGGGACTTGCTAACCGCTCTACATTACCCAGGATAATCCCGGCATGG
AACAGCGATCGCCGGATCCCACCGACATGATGCGCAGCAAGCATCTGGGCAAGAAGGGCG
AGTTCCGCTACTTCTAGGATCGAGATGCGATCACCATATACATATACACATATTCCGTAG
TGAGGATCTAGCGTTATAGAGAGACAGACATCAGCAGTTCCGTCTAGGATGCTAGTCCTG
GTCACTAGCGATCGGATTGGCTCCAATACCTTGCACTCGCTCGCAGGAGTGTGCAAACCA
GAACTAACCTTAAGACTAACCTAAGTGGAGCTCCAGACGGGAGCTGTTGAGCAGCACGTG
GCTCCTGCTGAGGCGGATGCTTAAGCTGATGCTCATCCAGGCGAAAAGGGGAGGCGACGG
CAATAATTTGTTTTAATAAAATTATATCCAAAGGAACCTGCCTATTGGTTGATGATTATT
GAGGAGATTGTAGTTTGGAGAGCTGCTTTGCTTTATTTGGATGCTCACAAGAAGAAGTTA
ACTGGTGCTGTACGGTGATCAAAGCCAACGATTGAACAAAGAGCATACTACGAGAACTCG
AATCGATTAAATGATGGACAACTTCTCCACGCGGGCCAGAAGCGGAGAATCGGAGTGGTA
CTCCAGGCTCCGCACGGCGAAGTCGCCCACTTCGTTGGTGAAGCACTTCAGAGTGGATAT
GGAGAAGGGGCGTCCGGGAAAGTTGTAGTAGGTGAAGTACTGCCCGTTGACGGCGATCAG
GAAAGCCCGATCCCCGAGCCCAAAAGCGATCTTGAAGAGCTTTCCGCGCACAAATGGGAA
TTCGCCCTCGGTCTCCTCGTCGCTCAAGGCAAAACTAGAATAAGTGAGTAAAGGTGAATT
CTCTTGGAGGAACTTTGCATATTGGAGTCTCGGACTCCTTTATACCTGTTGTCTTCACGC
TGGTAGCTGCGTGACACGGTTGTCCGATCGAAGTTCACGTGGAACCGGAGCACCGTACGC
CCGGTGTCGTTGCACTGGAAGCAGATGGAGAACTCCGTGGTCGGCGGGCCCTTGGCGATG
CACTCCATGGCCACCACTGTGCCGGTTTCATACCGCCTGGGCACGTCGCTCTGGAAGGCC
ACCTTGTCCGGACACATGAGCGTTCTGGGGAAGACGAGCGGAAAGAGCATGCGGTGGTGG
AACTGGGTGATCTTCTCGAAGTCGCCGTAGGTGCGCACGTAGTTGATTTGCTTGGGGAAC
TTGACGAACTCGAAGGACCCGTACAGCTGGTCGTTCACGTAGATCTCGAAGCATCGCTGC
AGCACCGCCACCCGGAAGGTGAAGCTCTGGCCAGGCTGCAGCGGGTTCTTTGGGCCGTCG
CACTTCCAGTTCTTCGAGATCTCCTCCTGCTGCCATCCCCCGCCCGGCTGGAACATGCTG
CGGATGATTTGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 1802..1985, 2068..2464, 2524..2667, 2728..4299, 4364..4543, 4604..5013
1954..1985, 2068..2464, 2524..2667, 2728..4299, 4364..4543, 4604..4693
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved