Drosophila_melanogaster Locus Mono:3:snoRNA:U3:9B
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:3:snoRNA:U3:9B
Drosophila_melanogaster
Mono:3:snoRNA:U3:9B
X
snoRNA:U3:9B
1001..1168
2168
AGCTGCGCAAGACGGCCAGTGTGCGCGATGATCCAGCTGGTCTGGCCAAGCGACGGAGT
CGCCTCCAGGAGATCCGGGCTGCCAGCAGTAGTGCGGGTGGTGGTGGTGGTGGCGGCGAG
GCAGCTGCCGCCTTCACCAAGCGGGAATCCAAGCGGGATCGTCGACGTGGAGGAGGAGGA
GGAGCAGGAGCAGCAGCAGCAGCAGCAGCAGGAAGTGGTAGCAGCGGCAGTGGATCCCAG
TCGCCCACCATGCGCAAATCGCATTCCCTGGACGCCGCCGAGAGCTACACGTTGGCCAGC
ATCCAGGCGCCGCTCTGGGTGACCCTCACCAATGCTCGCACCATCGACGAGCTGGCCCAG
CAAAAGATGTGAACTCCTCCAGTTGCAGCTGCATCTGCATCTTCATCAAATTCGTTCAGT
TATCAAAACCTCCGACAGTGTCTACAGAGCCCCGCCCACTTAGAAATCGTGTAAATGTTT
AGATGAATTTCGAATTAGTCACATTAACGACACAAACGAGCTACTTGCATCAATAACTAA
AGCTAAATCAATTTAATGAAGTTAAAGACCAAACAGAAATAGTAAAACGAAGCTAATAAT
AAAATGTAAAAAATTTAAATTCACCTAAAACACAAGTCTTTTATCTTGCTCTAATCGATG
ATTTCATCTGAGGCTTTTAAGTACTGGTTAATTTCCATTACAGTACGTTATTTTTTTTGT
TTTTTTTTTGGGGTCATAAAAAAGATAAACATGCCCCAAAAGTGGGGGCTTTGGATGCCA
CCCTCATCATTTGTTTGTCAAAAATTTGAACAATTTATGCGTTAGCTAAAAATACGCGTG
GTATGTGCGTGACTCTAAATGTCTTATCAGCACGCATATTGTGCGTGCCGCTTACAATTC
CCAATCAGTTCTGGCCGCCCATCGACCAAGTGAACGCCACTGGGCATTCGAAATTTAAGA
CTATACTTCACAGGATCATTTCTGTAGTCAGTCTTCACATACTTTCACACTAGCTGAAAG
CCAAGTGCACCCGCGTTGATGAGTTGAATCGTTCTGTCCGGCAGCGTGAGGATTTGCCCA
GCACCCTTGTGGGATGCACTGCATCCTTAGCGGGGAGCGGGGCTTCGATGATCGCTCGGT
TTGAACGGATAGAGCGAATTCTGAGTGGTGCTCCCATTTTATACAAATGAATTTGAATAT
GTTAAGCTTCTCGAAAGTGATATATAAATTATTCCGAAGTCTTGTGGTTTCAAATATCAT
ACATACAAAATATGATATATATTCAGCTGATTAAACAAATTGTGGCTTTAAAATTCGTTG
ACTATAGCGTTTTATGTGTTCCCACAATTTAGCATTTTTGCATAATTCATCCACATGAGG
CGTCTGATTACAAAAGCCAAGCTGGTTTTATTTTTTTTTTTGTTTTTATTTAAATTATCA
TGTATACGTACGAAGAACTTAAAATACAAGTTTAATTTCTTTATCAAAATACATTGTTAT
ACAATTTTCTTAGTTGTTGTCGCTTGCATGCTTGGGGTTTATTTAACGAATTGGTTTTTA
TCGATATTACATATTTAAATCTCCTCTCCTTGTTCCAATCTCCCTTACTTAGTTAATTAT
AGATTTAGTTTAGCTTTGCACACCGCGTTTAGTTATCATTTTATAATCAAGTGTATATAT
ATATAAGTTAACTAAGTTAACCGGACTGATCGTCCGCACACCAGCACCGGTCAAATTGCT
GACCAAGCATTTGGCCGGAAGCTCATGCATAGCCGGCAGAAGCTCTGCGCATTGGCAGAG
GCCGCTATGATGTTTTTCCCTTTGTTAGCTTATAGTCAGTTTGATTTTGTATTCAATAAA
GAGCGCATCGCGCCTTCAATCAACTCCAGCTACTGCTGTTATCATTGAATTGGTTGGCTA
GCCTTAAGGGCAGTCAACAACGGAGAGACGTTCTCCCACCATATCTCCCAATCTAGGAGA
AGAGGTCTGCGGCAACCGCCCTGCCTCCCAGTGACAGAGGAACCCCCTGTTACCTGCAAC
CTACGCCGGAGACCGCGGCGAGGGACCTGCACCTTATATTTAATTAATTGGCACCCAACT
CCAGGAACCCACACCACTACCCTGAATCATGTAAGTGGGATTCTCAACCTAAACACTACT
CCAAACTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved