Drosophila_melanogaster Locus Poly:0:snoRNA:Me28S-A2634c
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Poly:0:snoRNA:Me28S-A2634c
Drosophila_melanogaster
Poly:0:snoRNA:Me28S-A2634c
3L
snoRNA:Me28S-A2634a, snoRNA:Me28S-A2634b, snoRNA:Me28S-A2634c
1001..1073, 1220..1300, 1443..1528
2528
GGCAAGAAGCCCCAGTCCGTGCTGGCCAAGCTCTCTGCCAAGGCTCGCGCGGCCGCCAA
GGCCAAGAAGGGCGTGAAGCCCGTGACCAAGCCCGCCAAGGGAACCGCCAAGGCCAAGGC
TGTGGCTCTGCTGAACGCCAAGAAGGTCCAGAAGAAGGTGTGCATCAGCTGCTTAATATT
GAGGAGATCGACTCGGACTAACCTCGTTCTTTGTTGCTCTTTTCGAACAGATCATCAAGG
GCGCCTTCGGCACCCGTGCCCGCAAGATCCGCACCAACGTGCACTTCCGTCGGCCAACCA
CCCTGAAGCTGCCCAGGAGTCCCAAGTACCCCAGGAAATCGGTGCCCACCAGGAACCGCA
TGGACGCGTACAACATCATCAAGTACCCACTGACCACCGAGGCGGCCATGAAGAAGATCG
AGGACAACAACACCCTGGTCTTCCTCACACACCTGCGCGCCAACAAGAACCACGTGCGTG
CCGCAGTGCGCAAGCTCTACGACATCAAGGTGGCCAAGGTGAACGTGCTCATCCGGCCCG
ATGGCCAGAAGAAGGCCTATGTGCGCCTGGCGCGCGACTACGACGCCCTGGACATTGCCA
ACAAGATCGGCATCATATAAGCGCTGCAATCTGCGGTAACGTGTGGAATGGGCATCGCGT
TCTACATTTTATATGTAGATTCTTTTCTATAAACAAAGTAATGCTAAGCTGACACGGTAG
AGCGAGGATGAACGTTTCAAAGTTGTCTGGGTTTAATAAAACCACTCAAAAACTAAGTGT
GGGTTTTCAATGTGGGCTCAATGGGTTCTGAGTTTCTTTCAGTTTTCTCTTTCAGATTGG
ATACTTCAGGTTTTAGCGCTCTAAATTGGTGAGTTTTTAATAACAAGCAATCTTTCAATT
TGCTAATACTACCTTCTATCGCAGGCTGTCTTTAAATGGGAAGCTTAACTTGCTAAACGA
AGAGGTAATTAAAGTTTTATTTTGTAATTTTAATGTATAACACTTAGCTGATGATATTAC
GAGTAGGAATCTCATTGAAATAACCATGAAATCAATTTTATCTCCACTGATAGCATTATG
CTCAAGGAAGCTGAACTCAACCAAACCAAGCTAATCAAGACTTTATTTCGTTTCAGTTTT
CAATCTGGCTCGTATCTGGATCCTTGGATATGAAATTCTTCAAGGTGTGTATATTTCGGA
TGGAGTAGTTTGAATTGTAATCTGCTCTGATGATATTTCGAGTAGGAATCTCATTGAGCT
ACCTGTAGCTATGAAATCAATTTTAATCTCCCACTGATCAAATCATTTCAAACAACAATG
GCTTCTCTTAAAGCGCTTTATTTAACAATTCTTTTTTAATTCATTTCAGTTGCGCCATTG
TTTCCCGATTCTCTGGACTAACTTCTTATAAGGTGTGTATCTGTTTTAGTTACTGACAAC
TTCTTTATTGTGATGATATTTTGAGTAGGAATCTCATTGAGCCTCAGTCATTCGTTGCTT
TGAAATTAATTTTGTCTCTCACTGATTGCAAGCATAAAAGCAAATATGTTCATCGTTGTG
AAGCATAACTAACCAAGTGTTTGCTTTTATTTTTACAGAAGTGGCCCGATTAATGGATTA
ATGAGTTAATTCTTAAAGTACATTTAATTGAAATATATATAGAAATAAAACAGAATCCTG
AACCTAAACAATTGTACATTTTATTGCTGGCACTCGTATCTTTAGTATCTGCGGAACTGC
TTCCTAAACTTATCATAATGGTAGTCATCTGTGGCTCGCTTGACTCCATTGGGATTCGTC
TGATGCTGTGCGGATTTGTTGCCCTCCCTTTCCTCACGCTTGCGCCTCCTTTGATCGCTG
TTGTCCTCGATGTTGACTGGAAGTAACAAAGGTTTAGTATCCGCGGAAACGTTTCACACT
TGGGAACTCACATCGATTGTGTTGCATGAAGTTCACCGCCATGTTGGTGGGCACGAATTG
CGAGGGTCCGTCCTTCTTGTTCTTGGCGTCCTGCAGCAGCTTCTGCTTGGCTTCCTCGGT
GGCCTCTATGTTGCGGATCTTGGCCACAATGCCCAGGTCCACTTCAGGAATGCCATTGAG
CATCTGGTTGGACAACATCTCCTCCGATCTGTGCGAGGAAGACTGCCTCAGGTGGTCGGG
CAGGGCGTACAGGGCGGCATCCTCGGGGGTCAGGTACTTGTTTACATCACCGTCGTCCTC
TGCTGCGTCCTCCGTGCCGCCTCCCTTGCGCTTCTGCAGCTCCTGCTCGATGTACTTCAT
CATCTCCTCGTCCTCATCCCGCTTATTCGTCTCCGCCGAGAACTGCGTGCCAATGCCCAC
GTCGTAGGCGTCGTCCGCCTCCTTCATCTTGCCCGATTTCAGCTGCTTCATGTTGACCAG
ACCACCGGTCTTCACATTAAAGGGATCCTTGATGGCCAGCTCCTCTTCTGGCGCGATCTT
CTTGCCCAGCGCCAGTCCCACAAGGCTGACGCCATTGGGTCGCTGCCTGAGGCGCTGGCG
TTCTTTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved