Drosophila_melanogaster Locus Poly:2:snoRNA:Psi28S-2949
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Poly:2:snoRNA:Psi28S-2949
Drosophila_melanogaster
Poly:2:snoRNA:Psi28S-2949
2R
snoRNA:Psi28S-2949, snoRNA:Or-aca5, snoRNA:Me28S-G3255a, snoRNA:Me28S-A982a, snoRNA:Me28S-A982b, snoRNA:Me28S-G3255b, snoRNA:Or-CD2
1001..1155, 1314..1461, 1625..1709, 1866..1942, 2135..2211, 2392..2473, 2659..2798
3798
CGAGTATCGTGGTGGTATTCTGGGTTTTGGTACTACGCATTGCTCGAAGTACTCATCTG
TCAGATAAAAAAAACGAATATTTTAAGGACGATCACAAATTGAGCAGACATTTTTACGTA
CCCAAAGACAGAATGACTCCGGATGCATTGAAATCCGTCATCGTGCACTCGCAATTAAGC
CTAAAATATAGAAACAAAAAAAGCTTGGCGCCGCGTCAGTCTGGTCCGCAAGAAAAACAG
TTAGAACCACCGCGTTTGTAGAGCTGCAAGTGCTGCAATCGAATATTACCACCCGGATAA
ATCGAAGTAAAACTTCTTTGCACTGGTCAGCTTTTGAGTTTTTACACCCGTTACTCGTAG
TGTAAAATAGTATACAAAAGCATATTCTTGATCAGGATCAATAGCCAAGTCGAGCACCTT
TGCCACACCCCTCCTTATAATTACAAAACGCTCAAAACACACTTATGAACAATTTTTAAT
TTTTTCTCATTTTATTTAGCAGTATCTATCATGATAAATTTTCGTGTTCGCATATCCACT
AGCTGAGTAAGAGTATTTTCTAGTCGGGTAGTATTTGTCTAAGATCTATTCATTTTATTT
AAAGTTTATTAAACATAAAATATTATTAGTGTTTTATTTGTGTGAATTCTTTTTCTTTGT
TTATTTTCTTCTTTATTAAATTAAATCAAGTATTGACTTAAGTTTAATATGGGGCAATAA
CTTGTATGTATTTACTTAAATCGTTCAATGCGAACTTGTTTTGGTAAATCAGTTTTTCAT
AACAGTGCGCCACCTTGAAAACAGACCACAAACGCAGGCGTTAGGCGTTTCAGTATTCTT
GAAAGTACAAGCAGCGTGCACACTGCACCACCAATCGCCGCCAACTTCACTGGCTTCTCT
TCACTTTTTTAAAGAACGTGGAGCGAACATCACCGCATTGGAAACGATTAAAAAAATATA
TATAAAAATGTAAGTATTATAGATATGATAGGCGACCGGTGAGTGCAGCGATTATAACTG
CAAATCGAGTTCTACTGGCTTGTTTGCAGAACTCAATGTTGCAAGATTAATTTGTGATGC
GCAGGGAAATGCACTTCACCGATTGCAATTCAAATTGCAGTCACGTGGTCGAGATTCCAT
TGCAGTCTCAACAAATTAAAAATTAAAAAAGAACGTTAGCTAAACGATGCGTTTGCTTAT
ATTGCAGGTGAATCTGTGATTACTAGGCGCTGCGTTAAAGCGCTGGCATTTGTGAATTGG
TAAGTTTCATCATTGTATTTATTTATATTTTTGTTAAATAATATTAATATTTTCATGCGA
GCATGAGTCGCTGGTGTAAAGAAACTACTACTTTAGCTAGTGCTTTTTACTTGCTCGCAG
AAAAACGTGCTTTGCCCAAGCATAACCCAAATTTAAAAAACCCGAGTTTGCGGTGCATAT
TATTTTCGTGAAGCTGACAGTTTAAACCCTCTTAACTAGCTAAGTTTAGTATTTGCGAAT
ATGGCTAACCCAGCATTCCATTTTCAGAAACAAAATGGCCTCTTATGCTCAACACGTGTT
TTCTGGCAGAGTTGGAGAGAGACAGACGGTAAGAATTCGTTCCAAATCCCAAATTAGCCC
TTCTCAGTTATCTGATGATTTATAATTCTATTTTCTGACATCTCTTATGAACCGTTGTGA
TTCAAATCAGTTATAACTAATTCTGACACATTCGACTCTCAACTAAATATAATTTTTACT
TGTGGCCGTGACTTATGAGAACTCATCTATTACTTGCAGATCGGTCTTTCGATTTGGATT
CGGAATATAAATGAGGTTATCAGCGTGAAATGGTAATTATTCTCTTCATTTATGAAAACT
ACTTAAAATTTCGTGATGAATGACCCTATCATCATCTTTCGACTGAAAATCATTTTGATG
CTATACTAGTTTTCACTGAATTTTAAACGCTTTAAAAAAACCTGTTAAAAAGATTGTTAC
ATTTGAATAACACAAATATATTTTAATTTCAGTTCATTGCAACGTCAATATCATGTATCA
AACGTGGCTCACTAACACAGTGAAAAAGGTAATAATTCGGTTTAAGATAATAAAAAAATT
TAGTTTAAATTTTATGTGTAAATTGGACAATTAATTGTGTTGTGATGAATGAAACTTACA
CCATCTTTCGACTGAAAAATGTTATGAAGCTATACGAGTTTTTACTGAAACCCCTTCATT
TTATTATTTTTGTGTTTTATAAGTTTTTTAGAAAATCGGTTGCTGCTCTTTATAACCATT
TAATTTTTGTCATTTTGCAGTGTTCAAGAAAACCACCTTTGATTGTCGCGTCATATGCCC
AAACAAGGATCTCTCCTTTGAAAAGGTAAATTATACTCTAGAACGAAATAATATGTAAAT
GATGCTTTTAAAATTTCTGACATCTCTAATGAACCGTTGTGATTCAAATTTTTCTAATAT
AATTAACTGATCATTTTAAAATCGCTTAAACGATTGAGTTATATTTGAATAACTACTTAT
TTGTATTGTTTTTGATTTTTTTTTTTTTTTTACAGATGTGAAACATGCGTAGCAAAATGA
ATCCGTCAATGGTTCATTTATAAATTCCAATATCTAAAAAGGTTAGTACGAAAAGAGATT
CTGTTTAGCGGAAATGAAGATTTCAATGATGATCACTTAAACCATTCACAGACACCATAT
AAAGGTCAAGCGCTGGCAATCTTCTTCAATATTCTTTTGGAGATAGAGCGTCTTGTTTGA
CTGGTTATGGGCCCTGGTTAAAAACTTGGCACTGAGCTTCATAATGCATTCTAGTATTAA
TGAAATTAGCCTGCGAAACCAAACTTATCGTTCCTGTTGTTATCTTTTCAGGTTGGCAAC
CTTGGATGAACACAATTTGTATCTTGTGGAATCACGAATAAATAAAATTCATATGTGTTC
TTAAAAATCGTTTTTTACTAAGTTTGCTCGCTCCCGCAATGCTAGTTCCTGGTTCTGCTT
GGCAATCATTCGCTCGCCCTTCGACTTCTTGCCTATGCCCAGCTTCGGCAATCCTCTATT
TAGACCCTCGAGAAGGACGCACGCCTTGCACGGCTGCTGTGAGGAAACGAAGCCACATCG
GGTGCATGTGCCACGCTCGGGCTTCTTTACCGTGTCCTTGAAGCGAAGCTGTTCGCCAGA
GTAGATGATGTCCATTATAACCGATGGTCGCACTTTCTCCAAATCCTTGAGAAACGCTCG
AGCGTGGCCGCGATACGCATTGGGGGCGAATACGCACTCCGTTGAGAAGTAGACCAGCTT
TTTGTAGTGGGCGTACATCACGATTTCTTTCTCGTAGCTGTACTTGAGGGGCTTCACTCG
GGGAATGGTATCCTCGCCCCCGCCGGTGCGGATGCTCGTGCAGCGTCGCAGGCGCGCCGT
GTCCCCACGGAGCACGTTCATCAAGACAGTCTCCGCAATGTCATCTGCATTGTGGCCTGT
GGCTATGCTATCAACGCCCAACAGCTTGGCCCCTCTATCCAAGGCCTGTCGGCGGAAGAC
GCCGCAAAATGTGCAGTTGTTAGAACGGCCGATCTGGGCAACAATGCGGTCCATGGTCCA
GCCGTAGAGCTCCTCGTAGGACAGGATCTTTAGTGGCATCTGGTAGTCGTCACGGTTCTG
TTTCACTGTCTCCAAACTGTCATCCCGATATCCAGTGATGCCTTCGTCTATGGAAAGGAG
CACCAGTTCCAGACCGTAGTTATGGCGTTCGTTTAGCAGTTTTAATCTGTAGAACACTTG
GATTAGAGAGGTGCGATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved