Drosophila_melanogaster Locus Mono:7:snoRNA:Or-aca4
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:7:snoRNA:Or-aca4
Drosophila_melanogaster
Mono:7:snoRNA:Or-aca4
2R
snoRNA:Or-aca4
1001..1162
2162
GTAGCAAAACTGCCAGTGAATATTTTTTAAATAATGTGGTTTTTTGGCGAAATATTTCG
TGTGGAGTAGGATGATAAAGTGGCGAACAGTCACCCAACTCGTAGCTTATGTTGCATGCA
TCACAATCCTGACTCTTTGACCCACTACGTCTTGCCTTATAAATAAGAAACAAGAAAAAA
TGCAGCTCAACCACGCGAAGTTAATATTTTTTTTCCACCCGTATGTCGACAGATTTTCCA
GTCGCTAATTGAAAATTAAAATATCATATGGCCGCCGTATTTCAAATGGTTTTTATCAAA
CGAATTTATGCAAGAGCCTCGAGTGCTGGGAATTTTGGAGTGGGGACAACGCCTACATCG
ATTCGAGTCGAATTTATCTGGCTCTTTTGGGCTTCACACCTTGTTTTTACCTGAAACGTT
TTTTAACTGCAAGTAATTGCCGTTTATTATCGCATCTAAGAACGCGACGAGGCGTCGCAT
GTCTCGCACATTTGGCGCGAGTTGTCGAAATGACTGACTGGAGATTAGTTTAGGGTTTGA
TTAATGGCCCAAAAGATCTGTCAGAGGAAATATACCCGAAAATTTGTGTGCCAAGGCGGC
TGCAGCAGCCCGTTGAGTGTTTAAGTTCGTTCAAAAACACGCCCACTTCCGTTGTTTTCA
TTAAGTACGTACGTGTACAAATTCTTAAAAATTAATTGGATAAATATTAAAATTATTCGA
TTTATAAGTGAAAAAATCTCTTTTCTCGTCAAGTTGATTTTAATATTTATTATTTTAATA
TGGGACTTATGAAGAATAAGAATTTTACATATACTTTACGCGTATATGCACTGCTTGCCA
TTCTGATTGGACCACTGCTTGCTGCGGTGGTTGGGTTCAATGTTAGCTCATTCCGCTTTG
AAACGGTCGATGGTGCTGCGGTCTAAGTTCCGCAGATTGTTTTGAAATAATTTCTAGTAA
GGTTCCAAGTTCAAATCCAGCGCGAGACAAAATATGACATTTTTCCTTCTGCACTGTGGC
AAGAGTAGCTACTGTATCCAGCGTAGCTCGCTCTAATCCGCTGAAGGTAGATCAAATCGT
TCATCCTCCATTGCCGTTGACACTGCACTAGTGTTCCATATATCTAAGTGGGCATTGCAG
TTCGTATGTGGGTGAATACACTTTGTTTTTCTTTTCCAACTATTTTTGTGGCATTTTCTC
GAGGAATAGCATTCATTAGCATTCTGTGCGCGCTTGACCCAAAATCGAAAAACCATCGAA
ATCGAATTCAAATATGCCGATTTGATGTCGTGACACATTTGCCTATTTCTGGACAGAATT
TTACGAGACGCCGGCAACCTTCGGGCTCCAGTCACATAAATAAGCCTATCTCTATCGATC
GCAATTGGAATTTATTGTAATTGAGTTTTGAGAATTCAATATGTGAGCAGACTATGATAA
ACAGAAGAGATGGGTACGAATATTTGAATGTGCCCATTCAATTATATTAGTTGCAAAAAT
AATAATATATTACTATTAGCCTTCGGAGGATTTTTCAATGACGACATGGTGTTTTTTCTG
ACACAAGGGAATATATTTTGGCAAGGTCGTTGCACGACTTTCCCTTTTTTTTCGCGGACG
GGGCAACGGAGTGGGGCGCCGGGCAATCTTGGGCCGTATGGTCTTCAAAGAGGGATCCAC
CACAATGACTTTACGTTTAGACTTCAGCGGCAGTGGTTTATCCTTTGCGGATGTCATAAG
TGCTAGCTTCCGCTTCTGCGTCATTTTAACTCTATTCTTTATCATGGCCTTGATTTTCAT
AGAGGGAGTCAGTTGTGACCGCGCCATAGTGGCATTCTTCGGCAGTTTCTTCTTGGTTTT
TTTGGTCACCTCATCCCTAGTCCTTTTTGGCGACTTCAAATCTTTTTGCTTGCTAATTTG
GCTACCTGTCGAGCTGTCCGCGTTGTCTTTAAAATTCATTACACTAGATATTTGTTCAAT
TCCCAATTGACTTTGCTATTTGTTGCGATATTGCTGTACTGGAAATTTTTGCTTAATAAT
CTGAGTGTTTTCTTCCAACCGATTCTACTACTGGGCCTTTGTTCAAAGGTCTCCCCAAGT
GACAGTCCCTTTGAAAGCAAAACCAAAGGAAGCTATTACATACAATGGCTTTCAAATCCG
TTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved