Drosophila_melanogaster Locus Mono:2:snoRNA:Psi28S-3342
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:2:snoRNA:Psi28S-3342
Drosophila_melanogaster
Mono:2:snoRNA:Psi28S-3342
X
snoRNA:Psi28S-3342
1001..1164
2164
TCTTCTTCCAGTCCAGTGTTCCTTTGTTCCTTTGTTTTCACCAGCTTTGGTCAATTCGT
CCAGCGTTGGACGACGGCTGCCTTCATGTAATGATGAACTCCAATTAAGAACACAAGTCC
GTTTTAAGTTGAAGGCAGCCGTCGGGCTGACATATATTTATTCAATTTCTTCTTTTGATT
TTAGAGTAGGCAGAAATGGTTCTGTCAGCTCAACGTCTACAGAGTCTCTCTCTGATTTTA
CAGTTTTTGAATATATTTGGACTTAGGCTAATCCGCGTAGCTGCGCTGCCGGGTACGCCA
GCAGCGGAGCGGCGTTCTTATGTATATCTTATATATCTAGGCTTATCGGGAGAGCGAGAT
ATGTATGTACGTATGTAATATGTATTTGGTCGGCGTGTGAATGCTGACCATGCACTTATA
CTTTGTGGCCTTCGAGTGGGTGATCATGTTACATCCGCCCTGGCCTAACTGCGTGCATAA
ACATAAACATAAACATAGCAACAAAGTGCTGCCATAAGTTAATATGCTATTTTATTTAAT
TGTTCTTAATATTGCATAGGCACATACTACAAAGATGACAGTCGAATGTATTATACATGT
AGAGTGCAAGATACATACGTAAGTTGAATGTCGAAAACAAAAGATTCGTGTCGAATACAT
GCTGTGTAAATTGCCGTGCAAATGTAAAGTCTCTCTACATAGCTTCAAATCGACATTACA
CGATAAATGCATGTTAAAAAAAAGTACGCCATGCGGCTAAAGCGCCATCTAACGTTGGGG
CGAGTCGTCGGCAAAGCAGTGCATCGAGGAGAGTGGGACTAGCATCGGCAAGGAAGTGTC
ATTCACCTAGTTCATGTAACACAGAAGACTCTGGTGGTTCAGTGCGCTTAAATGCCCGTC
ACGAAATCATTTACCAAACAGATTTCAGTGGAGCCCAGGTTCGAGTTCACCTTGAATCTT
CAAGCGGCTCTTCATTGGATTTCTAGATTCTCTGAAAAAATATTCCCCTTCATTTTCCGC
CACGCGTTGTTGTCCAAAATAATATGACAAATCATACGTGCCCATGTTCAAGGGGAACAT
TAAACAAAATTCTCTGATAAATAGGAAACTGATAAAAGTCGATTGAATTAATTCTAGACA
TCAGTGCCAAGGACGAGAAACAATTCACTTTTCGTGAATATTATTTTTTTTTTTACACTT
TTCGCAAATATTTTACGGTAACTTACCAAAATGTCACATTTCCAAGATGGGTGCCAATCT
GTTGATTATATACGCCTGGTAGCAAAAATCCGAACATTTGAACTACCAGAAGAACTGGAA
TTCCAGAAGGTGGCCAACGATCAGTTGTTTTTTTTAGTAGAAACATGGTGCTGATTTTAA
TCTTTATTATCAATTACAGTTAAGTTATGATAAAAAAGCCGACTAAATTTTTTTAATTTT
TGCCAAAATAATTGTTTTCGATTTTCCGTCATAAAACGTAAAACAAACATAAAACGTAGG
GCTCGTATTTAAATTCCCAATCGAACTGTGTCCACAAATGGAAATTCTATTTTTTGCCAA
TTTTTTGCAAATTTTGATGATGTTACCCCTTACCAAAAATGCGAAAAATGACTCAAAAAT
TATTTTTTCTATATCGGTCAAAAAGTGATAGGGATGGTTAGTCCTTGTTGTTAGCTGCTC
AAAACAGTTATTCTTTCATTTTGATGATCAGTTTTAGTCAAGTTATGATTAAAATGGCCA
TCTGAAAATTTTAAATTTTTGCTAAAATAATTGTTTTCGATTTTCCGTCATAAAATAATC
AGTTTTTTGGCCACAACTTTAAAAATAATTGTCTGAATATGGAATGCCATATCTCGTTGA
GCTCGTTATTAAATTTCCAATCGAACTGTGTCCAAAAATGAGAATTCTATTTTTTGTCAA
TTTTTTGCAAATTTTGATGATGTTACCCCTTACAAAAAATGCGAAAAATGACTCAAAAAT
TATTTTTTCTAAATTGGTCCAAAAATGATACAGATGGTTGGCCCTTGTAATTAGCTGCTC
AAAACAGTAATTCTTTCATCTTTATGATCAGTTTTAGTCAAGTTATGATTAAATTTTTGC
TAAAATAATTGTTTTCGATTTTCTGTCATAAAATAATCAGTTTTTTGGTCACAACTTTAA
AAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved