Drosophila_melanogaster Locus Poly:1:snoRNA:Or-CD11
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Poly:1:snoRNA:Or-CD11
Drosophila_melanogaster
Poly:1:snoRNA:Or-CD11
3L
snoRNA:Or-CD11, snoRNA:Me18S-U1356a, snoRNA:Me18S-U1356b, snoRNA:Me18S-U1356c
1001..1089, 1275..1353, 1514..1592, 1764..1842
2842
TGGTGGATCTTCCTGACACTTGGAGTTTTTGCAGTTTCTCCTCTAGCGTCTCTACCGCG
GCAGCAACTGTAACTTTTCCCTTATTTTTGTTTAAATTGCGCCAATTCGCTCAAGGTGGC
AGCGCGCTCTGGAGATGGGAGTTCTTTTGCGATGGTATCGCTTGTTAACCGATATGGTAC
ACGCATTTAATACCGTCTAAATAGTTAGTATATGTGCAGTTAAAAGTCTATAGTTTTACT
TTAGCTCCACAACTATTTTAACTGAGGTTAGAAATTAGAATTATCCTATCAGTGCATGAT
TGCTTATAGAGATGAGCCTTCTTATGTATTCAATTAAATAGTAAGTGAATATTTTAGTAT
TATTTTATAGTATTGTTTTATTTATATCATATTATTTATTATATTATTTTCAAGAAAAAA
GCTTATTTATGTTTAATTTATGTTTAATATAAATATTTTTCTTTATGCAACCAAAAGGTC
TGGCAGCCCCAAAGCACCGGCAACTCAGTGGACATCCGGCAACCTTCTGCCTTCTTTCTA
TCCGAATTTCGTTTGGTAAAGGTCGTCAGCGCGCTTCTAATTAAAACTAAAATAAAATGA
AACCGATTGCTATAATATATAACGCATGCAAAGCTGACCGTATGGGCTCGTCTCCTTTAA
AAACTGATGCAATGATAAATGTAATAAAATGATACACATACCGCACCAGAACGGCAATTT
GAATGGATCACCATTTACACGTGGTGCAATGTGAGATACCTGGAGACACTTAGAAATATT
CTGGGGTAAGTTTACAAGAAATACTATTGTTTCAGCTTATTTAACAACCCATAATGACTT
TCTACCCAATGCATACATCATGTTGCAAAATGGATAAAAAATTAGGTTAAAGGAAAGATA
ACTGCATATTCACATTTGTCATTAACAATATAAAATTGGCATTTGGTTAAAGTTGGGTTA
AATAAGATTTTAAATTATGGTAAATTACATGGTGATACATTATAAATGTGAAGAGCATTC
CACGTAATTACTTAGTGCACAAGTTAAGTGTGCTTGACTATTCCGTATATATAGGCAAAG
AAATGAAAATCTGCTGTTTCCCAATTATAAAAACTGTGGAAAAAATATGTTTTATAAATT
TACAAGTGTAATATTTTTGTATTTTTACAGGCATTGAAAACAGCCGGGAGCCTGGGATAC
AATCTAATCATGCCTTGATCTCCCTTAAAGGGTAATGTAATCCTCCGCACCATTTGAGTA
CAAATTATTTTAATTCCCAAATTGATGACAACTTCATACCCAAATCAGAGAAATAATGTT
GAAATCTTTTTAACATGCATCACCATCTGAATAAAATATTGAAACTTAGTTTATGTATAA
TAGTATTTGTATAATTAAACAGTCTTTGTGTATTTTACAGAAATATTTCCAGATATTGGG
ATTCCTATTCAAAACTGAAATTTGACTGAACCAGTGATAAGGTAAATCCTCACTAAATTA
AATGTTTTCTTACTCCTTAATTGATGACAACTTCATACTCAAATCAGAGAAATTATGTTG
AAATCCTTTTAACATGCATCACCATCTGAATCAAGTACATTTTATCAAATTTTAAGGCAA
TAAGGGCCAATTAATAATTTATATTCTCTCTTTTATTTTGCAGGAAATATAAACTAATGA
TACTTTCACAAGATTTACAACTGATTCGGTTGGAAAAACCTAAAAGGTATTGCCAATGTA
AAATATTATTTATTTATTTAAACTGCCTTCTTGATGACAACTTCATACCCAACTCAGAAA
AACTATGTTGAAATCTTTTTAACATGCATCACCATCTGATTAAAAATATGCATATTTAGT
TATGATGAATGAAATATAGATTACTAATAAAGGTTTTCTTTTTGACTTTTCAGGTAGTCT
AGCCACGTGCTAAATCGCAATCTTTTAACAAAGTTTTTCTTTATATATAAAATAAATTCT
TTATTTATGTGTACAAAATAAAATATTTCAACTGTCTAAATTAAATAGCTTTAAAAACCG
TTCAACACGCTCTCCACAACAATAACAAGCTGATAAAGAGAATCTCCTTGTGCAATCGAT
TCCAGCTGGACGAGGCAGCTACTCCGTCGTAGAATACCTCCTTGTGGGCTGTTTTCCGCA
CAGCAGCTCCACCGTTGAAGTCTCGTTTCTTCTTAAAGCTTTCGTAGTACCAATCCATTC
CGTCCTTGCGATCCACACGATCAACCTGAAGGAGCTCCAGTTCCGTGCGTTTTTGTGCAT
TAGCCGTGAGTTGATGCTCGCTGGCCACGCCCTCGTTATCACCACTGGGCGTGGTTCTCT
GATACTCCTCTGCCGTGGGCTGAGCCACTTGCTGCTGATACGGCGTGTAGACCTTGGTAA
TGGTGGACCGTCCTCCACCTCGTAGTGGAGGAGAAGCTGGTGGCGGTGGTGGTACTGTGC
TCGTTGGACCAGCTAGAGTTACTTGATTATCACTCGGACTCTGAGGTGTTGTGGTGGTCA
CCCAGGAACGACTCTTTATCTGCGCCACATGCTCTTCAGCCGGAGGAATCAAAAGAATCG
TCTCTGCCGTGGTCGTTTGCACGAGAGGAGGAGGTCTAAGCAGGGTCACAGATTGCGCCT
CCAGATCTTCGTCATCGTACTGGGAATCCAGCTCAGTGCTGGATGAGGCATTATTTTCAG
CAGGAGTAACCTGTGTGGTACTGGTGGTTGTAGTACTCCTTGTGGTCGTTGTAGAAGCTT
TTGTTGTACTAGTGGCGATCCTCTGCATCAAAGGCGTTGTGGTGGTTATATCGGGCGTGG
TCTCCGTGACTTCGTAAGTAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
561..784, 1170..1230, 1420..1480, 1663..1725, 1913..1999
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved