Drosophila_melanogaster Locus Mono:9:snoRNA:Psi18S-176
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:9:snoRNA:Psi18S-176
Drosophila_melanogaster
Mono:9:snoRNA:Psi18S-176
2R
snoRNA:Psi18S-176
1001..1154
2154
CGTATCTGCCATTTTCTCGAAGAAAGCTATTTTTTTTAATTGGCCCGAAAGTTTTTGAT
CTCCTCCAAACCTGTTTAGTTAAACGACTGTCTATGGCTACCAGCTAGTTCCTAATTCAA
AGCTTGGGATTGTTCAGTGTCGCAATAGATTAAAGAACAGTTGTGCCGCCCTGATGAATG
TAAATGTGTTTTTACAAGATTGTAACTGCAAGGCAAAAGAATTCTTCCACTGCACTGCAC
AGTACATGAAAACTAATGGATTGGTTCAATTTGGTTTGAGGGACTCAACACAGGGACATA
TTTTATTTAATATTTATAAAGTTTTTAATTCACACAGACTCCATTTTTGACCACCGTGCA
CCATTTGTAGCCGTCGACTTTTTTTGCACCAGATTTGTCCAGAAGAGCAGCCAGTAAAAT
TAAAATAATAGTTTTTTTCAGCATCATTGTAGCGTTTATATTGTTCATCAAGTGGATTAT
ATTCACAAAATGAAGTTTCTGTTTGTGGTGTCTAAATATGCATGGAAAATCAATTGGAAA
ACGCATTTTCACCGTCATTATTCCGTTTATAACACGTTAAACATTGTACAAAGTATAAGC
CAAAAAGAAAATGGGCTATTCAATAATTACTTTACTGCCCCTACTCAACTTTTTAATATA
ATTCAAGGACAGAAAAGGCTTCAAAAAAGGTTATTAGTAACAAAAAAAAAAATTGTTCAG
AGGTGGTTTTGAACCCCGTCAGTTGGGATTTGTAGTCGCACGCTTTACGCTCTGCGCCAC
ACAGGGTGCGCGCCACCGCTAAAAATACGACCACTTGAACCAGGTCAAACCGGTTCCGAA
GCAGTAAAAGATTCTCGCTTGAGCTGAAATTTAGACAGCGCGTTTGCAAGTGCGTCCATA
GCACTCTGCGTTGAGAGTCGCGCCTTTACAGGCGAGAGCACGTCATCGAATCTACTCCGT
ACTTTGTAGAATGTGTAAATCTGAAATATAGAAAGTAGGAAATGCCCCTCTATTTGGCCG
GATTAATGTGTTTGTAGTTAATTCCGATTATGCATGAGGAGAAGGCAGAGTAAGGAATGG
TGGGGATTAGCCTTCGGTGCTCGAATCGGTTATAAATCCGCGAGATAACTATCATCCTTG
TTTCCCTCCACACCTTTTTTTTGTGAAATGAAATACGAGTACTCTACGCAACTGACTGAC
TGTTAAAACCCATAAATATTTATTCATGAATATTGTTTTCCTGGCTTAATGTTAAATGTT
ACCATACTTGTTATGATTACTCGTTTAGTTATTGGCATCTGTGGAATACTCGTACGTTTC
ATATTTGCTTACACTTTTAATTTGATATAACATATATTTTTTTGATTACCAGAACAGCAA
AATGTTATACATCTATTTTATTAAGTTATTGTGTGTGTAGTTAGCCCACGGATTGTGTTT
GTTTCGAATCGGAGCAGGTTGTTACTTTTGATTTTCTGTGCAGGCATTCAATTCCGCCTC
AACATAACATTTCTGATAACATAACTCTGCTTGCTTTTGATTTTGAATAACAGAACTTTT
GAAAAATAATGTGAATGCTTCTTTATCATTCTGACTTTATCTACTCTTAACTATGTTATC
GCTTAAAATGCATACATCGAATATTATTATTGTTGATCATGTATTTATGTAACTGGTGGG
TTTTCCGGTTGATGGGTCTTATTTCGGTTGCATTCGGTTTTCAGGGATATTAGTTGCAAT
TTGATTACTTGCCTAGCTCTTCGGGTTTGATTTTTAAACACGATTACTTAATCCGTTGAC
ATCTCAAAGTTTCATATAAAATTTGAAGCTCCTCTGTTCAATGTTTAAAGTAAACTCCGC
TTACTTCACTACGTCATGTGCCGATTGGGTAATTTGTTTTACTTTAAAACTATAAATACC
TTGTCTGAATTGACAGTTTGTGTTTCTGTGTATTCACTTGCGACCTAAGTTAAGTTTGAG
CAAATTGCGGCATTACATGTGCTAATACATATTTATCGTTATATCTTTCGAACAGCCGGT
ACATAATTTCTTATCTACATATAAATATTTACTTGATAATTTCGCATAGACTACGTTTCG
GTTTTCATTTTACAGGTACACATCCAGTTCAACTAACAAACATGCAACATCGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved