Drosophila_melanogaster Locus Mono:5:snoRNA:U3:54Aa
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:5:snoRNA:U3:54Aa
Drosophila_melanogaster
Mono:5:snoRNA:U3:54Aa
2R
snoRNA:U3:54Aa
1001..1173
2173
GTGAGGCAGCATTTGCGGTTTCATTAAAATGCCACCGAAAAAGGGAGCAAAAAGTCGGA
AGCCGCGTCAGCAATGGGAATATTTTGCCACACACGTGGATTTGTATATGAATTTAAAAA
GGAGCGACATGGAAATAATTATAAAATAGTTAAATTTCCACGCCAGACAACTGTTGGGAA
AATACAAAAAATCACGTACAATCCGCGTGGACAGAGGCGAGTCATCTGAATCCGGCCAGG
TAAAACGCTAATGGAGTTAATTGAGGGCATTATCAAGAATGTTGGGCAGCTGGTATGTTG
GAATCAAATTAAATTTCAAACAATTGACAAATTGAAATTCCACCGACGGAAACTGAACAA
TAGAAGCATTCCAAGCGCTTTAGAAGAGGTTAGACGGATGTCCACTTAATATGCTCGCCA
TCAAGGAGCAGTAAATGAAATGAATGACTAGACAAAATAGTTTTGTCAAGACCGCAGAGC
TGCGAAATCACTTGGGTCAGTAAGAAGTAGTTGTGGGAGAAATATCTCCAAAGAAATGCT
GGAATAGCACAATTTCAAAGTATAATTTTCGGCCAGACGTTTGAAAACAAATCAGCTATT
ACATTCTCGTTTTGTCTCTTGATGTGCGTTTGACATAGACTACAACACGGTAGCGTGGCC
GAGCGGTCTAAGGCGCTGGTTTAAGGCACCAGTCTCCTCGGAGGCGTGGGTTCGAATCCC
ACCGCTGCCAAGTTTTTTTTATTTACAATTTCTTTTATATTTTTCCGATCAGTTCCAACA
ACAGTTGTAAGACACTCAAGAAATTAACCAGAACCTATTCCCACCCTATAATATCAACGC
ACTAATACATCTTTCGCCTGTCCCCCCACGTGCTGTTCATTTTGTTCATGCGCACACTCT
TGTGATTCTCAACTAGTTCTGGCCCGCAGCGCACCAAGATCCACAGGTTGGGCAGCAAAA
ACTTAAGACTATACTTCACAGGATCATTTCTGTAGTCAGTCTTCACATACTTTCACACTA
GCTGAAAGCCAAGTGCACCCGCGTTGATGAGTTGAATCGTTCTATTCGGCAGCGTGAGGA
TTTGCCCAGTGTTCTTTGTGGTGCCTCGCATCGTTCGGGACGCAGGGCTTCGATGATCGC
TCGGTAGAAACGGATAGAGCGAATTCTGAGTGGTGCCCCCTTTTATGCGAATTAATTTAA
GTATATCTCATTATTGTGCTTATGTTCTTTATAGTATTTAAATTGTTTTCGGATTTAGTC
TCCATGTTCATGTGACATAATTTTACCTTGTGCACTCCTACTTAAAGAACGTTTTATACT
GCTATAATTGAATATGCAGCGCAGTAAACCCTTCGGTCCCCTGGCAGTAATAATATTGTT
CTTTCCGACCGCTCTAAACACTGTTGCTGCTGTTGCTCTGCAAAGCAATTAAAACAGCAC
TTGAGGGGCGACCCTTTTGCCGGTACGCTTGTTGCCAGTTTCAAGTGTTTTTGTTGCACG
TTGACAGTCCGTTAAAGGTGACACAGGCGCCACCCCACGAGAATTACATATAAAACATTT
TAGTGGGAAGCAGAGTTCCGCTTTTTGTTGCTTCAAGTGCGCTTCGTGCTTAAGACTTGG
CAGTGAGTGGTCGAAAAAACTGTAAATTTGTATTAAAATTTTCGCTAATGGTTGTGGGGG
CGTTGGAGCTCTAATTACTCAACGCTGCATATGAATGGTCCTCGAGCGAGGGCGTGATTT
TTGGCTTAATTCAGAGCTGCAACGATCTCAATTAGTGGATGATGACTACTTGCAAGTGCC
ATCAAGTAGGTCCTTGGCGAACTTTTCCGAGTTCGTGTTTTGGTTGGCAAACTGCTCCAC
TTCGCCGAGATGCCCCCAATCCTATACGTAAGACTATAGTGCATAAATATTTGAGTAGCT
TGTCTGTTGCACGCAACAACAATTATGTGTTGCCTAGTTTTTGTCAACTGTCCCATTTGG
TTCTGCTCTGGGGCCTCGTTTTTTGCCAATTCTGTTGCCAAAGACGAAACAACACGTAGT
GAAAATTTATTTAAGCAATGCAAAGCAAATACGAGTGCCAGTTTGGGTACAGTGCGTTTC
ATGACAGGCAAGTTATACATATGTGGTGACCCGGAGATCAATAGGAATTGAAGGGAAGGT
ATTTATTACTTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved