Drosophila_melanogaster Locus Mono:6:snoRNA:U3:54Ab
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:6:snoRNA:U3:54Ab
Drosophila_melanogaster
Mono:6:snoRNA:U3:54Ab
2R
snoRNA:U3:54Ab
1001..1173
2173
TTTCGGTGGCATTTTAATGAAACCGCAAATGCTGCCTCACAACCCCTTATTTCGGCTAT
GGGTAGCACCCTTATGGAAACCGCAGACTTTATTTTGTTTTGCTTCTCGTGCCCGTGCCG
TGCAAAGATTTTTATTGCAATTTTCTAATTTCATTGCTGAGTCTTTTGCCCAACTCCGAT
GCCGGCTTCAGTTTATGGCTGCAACAACGGGACGCCGCCAGTCAGCCCAAGACCAGAAAT
TGTTGCTGCGGTTGCATGTGTGAGCGAAGAGACCACGACCACCGCCTGTCACGCATAAAT
TCGCATTTTCATTTGAATTTTAAACGCATTTCTAAGCTGACGCTGCCAGGAAAAAACGCT
GACAGTTTTGCAAAATACATATAATAAACATTTTAATGCAGCAGAGCGGCGAAGGAGTAA
GGCTTGCGCCAGAAATTGATTTCGTTTGATTGACATTCCTTTTTTCCAAATGAGAGCATT
TATATGCGGAGCGGTGTGGGTGGGAAAATAAAGACAAGGTGTTGCGTCCATAAAAATAGT
TCAAACATGCAGACTCAGATACTTCATATGTGCGCACAACTTGTTAGAACGCCTCTGTTG
CTTCCTAGCCTCGTCTCTTGTTGAGCGTTTGACATAATCTACAACATGGTAGCGTGGCCG
AGCGGTCTAAGGCGCTGGTTTAAGGCACCAGTCTCCTCGGAGGCGTGGGTTCGAATCCCA
CCGCTGCCAAGTTTTTTTTTGTTTACAATTTACTTTGTATTTTTCCGATCAGTTCCAACA
ACAGTTGTAAGACACTCAAGAAATTAACCAGAACCTATTCCCACCCTATAATATCAACGC
ACTAATACATCTTTCGCCTGTCCCCCCACGTGCTGTTCATTTTGTTCATGCGCACACTCT
TGTGATTCTCAACTAGTTCTGGCCCGCAGCGCACCAAGATCCACAGGTTGGGCAGCAAAA
ACTTAAGACTATACTTCACAGGATCATTTCTGTAGTCAGTCTTCACATACTTTCACACTA
GCTGAAAGCCAAGTGCACCCGCGTTGATGAGTTGAATCGTTCTATTCGGCAGCGTGAGGA
TTTGCCCAGTGTTCTTTGTGGTGCCTCGCATCGTTCGGGACGCAGGGCTTCGATGATCGC
TCGGTAGAAACGGATAGAGCGAATTCTGAGTGGTGCCCCCTTTTATGCAAATAAATTTAA
ATATGTTTGTGAGTCTATAGGTGTCAAGGTCAAACCAAGTCACTCTGACAAGATATTTGC
AGAGGATGTGTAGAAAACCAACCCCACTTCCATTTCGGAATGTAGAAAGATGATCTCAGA
CGCTGCTATCTTCTGTGGAAAGCCCTCCCCCATGCCGCTAATCCATTTTCCTCCGACGTC
TGAAGAGAATACTGTGAACTCCTTATGCATCCCCACCACGGACGGTTAATTTGTATATAT
TATAATTAGGGGACAGTATCCATAATATTATCTTTAAAGCTATTATGATAAGTTCAAAAG
GAACTGAACGATTCCTAGTGACTTTAAGATTAATGGACAATAAATGTCTCTCTCTCTTCG
CTTTGGGATAAAGCGTAACATGATTTTTAGAACTTACGGAGTTTTTAGCATATCAGGTAT
GAGCTACATAAAAGCATCGTCGGAATGGACTTTTTGGATCGGTCATCTATGTTTGTTCTC
AAACGTAAATTCTAAATTCTATTGATAAATTTTACAGCCATTGTTGGGATTTTTATTTGA
CAAATGTAATAGGGAGTGGTGGCGGGGATGCTGGGCCCTTTATGAATAGAGTTCTCTAGT
TTCGTTATTCTGTTTGTGCATTAAAAGTTTGGCTGCCTGGAGAATTGCGTTTGGGGAGGT
AACTCTTCGCTAACAACGTATTATTGGCAATATTTTATAAGCTTGCCAAGACCACCCCGC
TTCCCTTGGAGTACCTATGTGTGTCGGCCCCCCTGGTCCTTTGAAAAATTGGCATGTCGT
TGTAACTTTTACCCGACTATGAGAAAAAAATAAAATCTCTTGGCACATAAGTTTTGTGCA
CGTTAAGTACTTTTTCATAACCATCGCAGTCGTTGCTGTTGTCTGGCTTTCGCCGGGGCA
GAGATGGTGGGGAAGTGTTTTCCTATGCCTCGGGGGCATAATATGCATATGCAACGACAG
AGGGGCAACAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved