Drosophila_melanogaster Locus Mono:8:snoRNA:185
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:8:snoRNA:185
Drosophila_melanogaster
Mono:8:snoRNA:185
2R
snoRNA:185
1001..1055
2055
ATTTTTAGGACAAATTTTCCAGAAGGTGTTAATAGTTATAACTGTTAGCAGAAACTTTG
GGACTGAAACTAATATAGGAGATTGACTAAATAGGTATGTGTCCCATATGGTCTAGTGGC
TAGGATATCTGGCTTTCACCCAGAAGGCCCGGGTTCGATTCCCGGTATGGGAAGCAACCA
ACTTTTTGTTGAGGTACTTTATATAATTTATTATTTGTTACAATTTTGCAAATTTATTAT
TTGTAATATAGTATTTTAATATTTTTTTTTCACTTTTTAAGATCAAGTTATTTATATTTT
GTAATTAATTCAGGTATTTACTGATTTTTATATATATAAATATTTTCTATATTTATATAT
ATATAGTCATTTATTATTTATTACATATATTATTATAATAATTATTATTAATATAAAATA
GTATTAGTATATGGTTGGACTTTTTATTATTAGGTTAGGTTATTTTCTAATTCATTAAAT
ATATGTTAAGCACTTATAATGTTACTCATTGTTATTGCGACGATATGAGCAAACAAACAC
TTTAGTACATTATACGTTAAATACGTTCAGGTTGGTAATAATTCAATAAGAAAACCGCGT
TTTCACAACAGGTTTGTCGACGTCCCATATGGTCTAGTGGCTAGGATATCTGGCTTTCAC
CCAGAAGGCCCGGGTTCGATTCCCGGTATGGGAATAATATTGTTTTGCTTACAAAAGAAA
ACAAAGATCACTTTATATTCCTCTAAGGCGACATCTTTTGGATTATTTGTTGCTAAGTTC
TAGCGCCCTCTTTAGGCATTTTGTGTAAAACATTATCAATTGTTATTTTTCTATTGTTGT
CTCAAAAAATTCCCAAGCTGTTCTAGTTCTTCGTCGGATTACAGTTCGCTATTTTTTACG
TTAAGATTGTCATTAGTAGAGGTAGACTGACGTTCTACCCAAATACTAAAAGGCCACTTG
ATGTTACAAAATTATGACTCTTGAATGATTATAATTTGGTACCACGATTCTGACGGGGTT
GCTCCTGCCTAGAGTTGTCGGTTTAACTGATGGTCTTTCAACTAATGAACTTTTTTAATT
AATATATATAAGAAGCAACATTTATACTTAATAGATACGAATACAAGATTTCGTTACTGT
AGTTCGAGGTACGGAATGATATTGGCACTGTATGTCCGTTTTCATGATTCGAGTGGAATG
AGTTGTGGGTGTGCCAGACATTTGTTGCTGTTTGTCTGGCTGTAAAGCTGGCCGTGACCG
TGGCAACGAATATCGACAAGCTGTTGGGCGCTCTTCCCGTGTGGAAACATTTTTGGCTAT
TTTTTTCGCCAAAAATTTACATAAAAATCGCATTACACTTAACATCCACTTTGCTAAACG
AAGCGCATGAAAGCGGGCGCCACGTGGTTTCGGCTCTCGACTGTGCTTTTGTAAGCCGAA
GCGCCATGTGGGTGGGTGTTGTTCGCCTGGCTTGGTAAGTGGGCGGTAGGAGTTGAGAGT
TCGTTATTCATGTGCGAGCTTGTGCCAGCGGTTTGAAGTGCATGGCGGCCTACGAAAATT
AAATTAAAACGCACACGCCAAACGGCCAAACACTTTTCGTTGTAATAAAATGCTAAATTG
CAAATGGTCGCCGTGATCTATTTTTGGTGTGTAGATATATTTTGCGGATTTTAAGTAAAT
GTTGGATATGTGAGCTATTGCATGGTTTTCAAATAAATTTTCAACATAGTACATATCTGT
ACTGGTTAGATTTTAAGAAGGTAAATAAATTATTAATTTGTATTTTATTCGCTTTTTGCG
AGGCAGAAAAATTTAAATTTACCAATTTATTCATAGTCCTTTGAATATGGTTGTAAAAAA
ACAAGGAAGTAAATACACTTTAAAGCTGATTAATGTGCTTGCACTTAAAATACAGACGTA
AATCGGACTTCGCTACAGTATCCCATATGGTCTAGTGGCTAGGATATCTGGCTTTCACCC
AGAAGGCCCGGGTTCGATTCCCGGTATGGGAAAATTTTTCCTTTTTGTGCAGTTTTTGCA
CATATTAAACTCGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved