Drosophila_melanogaster Locus Poly:4:snoRNA:Me28S-G1083d
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Poly:4:snoRNA:Me28S-G1083d
Drosophila_melanogaster
Poly:4:snoRNA:Me28S-G1083d
2R
snoRNA:Me28S-G1083d, snoRNA:Or-CD9a, snoRNA:Or-CD9b
1001..1083, 1261..1351, 1501..1591
2591
ACTTATACTTTTTGCCTTCGAGTGGGTGATCATGTTACATCCGCCCTGGCCTAACTGCG
TGCATAAACATAAACATAAACATAGCAACAAAGTGCTGCCATAAGTTAATATGCTATTTT
ATTTAATTGTTCTTAATATTGCATAGGCACATACTACACTATCGCTAGTTTCTTAGGTCT
TAGCTTTTCCTTAGGTTTTTCAGATAGAAAGGCAGGGAATACAGACAGCAAAGGTGAGTT
AACATATTACTACGTTCCTTCAAGAGTGGCTTTCGTTTGCGTTATCTGATGAGCAATAAC
TTTCGCCCCTAGCTGAAAAATGATACTTCTCATGTTGAATGCGAGATTGGTCTTACTGAA
AATAACGGAAAATAGAAAAGCTCATTTGAGTTTCTAAAAACGTTGACCTGGCCTCTTATT
AACTTAATTTATATTTCTATTGTAGCTTGGAATACTGCTCAGAGGACAAAGCGGGAGTGA
CGGAAGATACGGTTAGTATCTATTTGATGACCATCTTTACGTTATATTAGTTCTGATGAG
CATTAACTTTCGCCCCTATCTGAAATTGAAACTTCTCTTGTTGAATGCGAGATTGGTCTT
ACTGAAAAACTAAAAAACTATAAGCACATGTGGGCTATCTATATCCAATATATTTTAAAA
CCCAATATATATTTACAGATCGGCGGAACGAAAACTAAAAACGTGCTTCGAATAAACATA
GGAATTAAGGTAAGAATGCCTTAATTTATAGTTGAATTTCTTATTATCATGATGAGCATT
AACTTTCGCCCCTATCTGAAATTGAAACTTCTCATGTTGAATGCGAGATTGGTCTTACTG
AAAAGAATTTCGATTTAAAAACACGAAAACAATTTTCTAAGCACTTTCTAACCAAATTTT
GCCCATTCTCTTTACAGATTTGTTGATTAGGTTATGCAATATATGGACTATAACTTTAAT
AAAATAGGTAAATATTGAATAACTAAAAGTTATTAAAATGTTTTTAAGTGATGAGCTTTA
ACTTTCGCCCCTATCTGAAATTGAAACTTCTCCTGTTGAATGCGAGATTGGTCTTACTGA
AATGACTCACAATTAAAAACAAGCCTCAATCTTTTCGATTGCCTTTCTAATAAAATGCTA
CTTTTTCTTTACAGATAAGTTCAAAAATTTTTTTGAAAATCATTGAATGCCACAGGAATC
TTAAAAGGTAAATGTATTCAAAATGAATTATTTCTTTGCGAGAATAACTAACTTCTTTGA
AAATTAACTGATGTAAAAAAAAAACTGAATTATGTGGCATGATTTTCACATTAACCGCAA
CAAATCCTACTCCAATAGGTCCTACTGACAATTCTCACAAAAATAATGCATTTAGGCCAA
TACAATAACAACGATGCCTAACAATTGACTCTCCTTTGCCTTTTCAGTTCGCATGACACT
TTATTGCGTTGAGTAAACAAGGTAAAAATAAATTTAAAAAAACTCGTTTGCCCAGTTTCT
AGTGAAAATGTTGAAATAAAAATACTGATTTATGTGGCATGATTTTCACATTAACCGCAA
CAAATCCTACTCCAATAGGTCCTACTGAATATATTCACAAGAAACTTAAGGTGTGTTTTA
ACCAGATGTGGTTCTAAGTGAATTTTTTCTTATATTTGCAGATGTGCTTTTGGCGACTTT
CCACTGACTGTTCCAATTGAGTTCCATTTTATGCCCTTTTTTAGGTACAACACTGCCCAA
GACATCATATAATACTTTATAAGCAAATAAAAGAAACATACACAAAAAGCACAACTTCTT
TTTAATTAGACAAGGCCATGTGTGCTCTTAACCTAAAACACAGCTGAAATCTATAGACCG
CTTGTTTTGGGCGGGCAATCGTGGGTCAGGGGTGCAAAAAAGCGCGAAAGAAGAGTGCCG
ACCTTCGGATGGATAACTTGTGCGTGTGCAAAATGAAGCTCCAATATCGATCCTCATATC
GCATGTCCAATGTTTGATTGTGGCTGGCTTGTCCAGATGTTCACATAAACACGTTTTTCG
TGACCCAAAAATATCAGCCTGAGTTTTTTCCTACCCAAGCAGCTCTGCGTTCCATTCCGA
CATCCCTTGCCGCGCTGCCTATCGAACGCCATGTTGGATTTATCGCAGTGTGTTTGTCTG
CCACTATTTGTGTATGTATTCGGCTATGCTTTTTCCGACGCGTTGTCAACGAGAGCAGCA
GGTTAATTGTGAAAATAATTTCAAACTGTGGGGAGCACTTGCGGATTTCCAAGTGCCTGC
GAACCAACAGACTCCAATTCGAGGCTCTTAGTACAGGTAAGTGGTCCCCAATAGGTGCTA
ATTTGCGATGCGAAAGGACATTTGCCGGCGTGCGAGATTTTGTGCTGAGTGTAAAGGGTG
CTTTTGAGTGACGCATGCGATCGTGTGCACTTGTATCCATTGCGACGCCATGTTGGATTT
TCTCTTTGAGGTTATTGATTAGTTTTCCACAAGGCAAAGAATTAGTCTCAAAGTAACCGT
TTAGTGTGGAGAATTACAGTTAAAGTTATTGTATTGCGGATGGTAAATAGTTGGTGTAAT
GCGTCGATTTCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved