Drosophila_melanogaster Locus Mono:1:snoRNA:Me18S-A1806
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Mono:1:snoRNA:Me18S-A1806
Drosophila_melanogaster
Mono:1:snoRNA:Me18S-A1806
3L
snoRNA:Me18S-A1806
1001..1078
2078
GTAATCCGTGCCTGTCCGTGTGCTGCATGTTTTTAGATCCATGTTATATGTTGTTGGCG
CTTTGGCGCCACCTGTTCGAATCCGAAATATAATATCCAATATGTGTAAATATCCCCCCA
TTCAGAGAGCGGCATTGTCTCGGACATGTGCGTTACCCCGGATCAGGAACAATCGGCGGC
GGAGAGCAGCCGAAGCAGTTGGTCCACATCAACGACTGGAGCATCCGGAGCTTCAACGAC
GAGTGCATCCACGGTAATCCTGCGGCGATATCGATCCTACGCCCACGCAGCGGAGTCCGC
CAGTCCGGAAAGCGGCAAATAGAGGAGCTCCTGGAGCATCGCATCTAGATATAGTATAAA
TCCCCATTAATAGCTTTAGCAGAACGGTTTCATCGGATCCCATGTAGTATCATCGTATTA
CGTTCGATCGCTAATTTTATTTCATTATTTTTGTTATTTATTATTTATTACATTTTTAGT
TTTCGTTAATTTGTCATAGTCGCTGCTTTTCGTTTTGCCTTGTTTATCGGAAAAATCAGT
CGAAATTATTGAATTCAGCGTGTCAATGTCGAAGCAAGTTTCATACATATCTAGTTCTTA
GTCCACACAATCGAACGATCCGCACCACACACACACAGAAATCGATGGGAGCCATGAGCA
GCACCCGAAAAAGGGGCGTGGCCGATGCCCAACATATCTGAATCGAACTTCATTACGTAC
AGTTAGTTGATATGTAACCTAAGTGCCTATAGTTAAAATAATCGTAAACGAACATTAAAA
AAATATATCTATACTTCATAATAACTCGATAAATAATTTTAAGCGAAAATTTAAATTCAA
TAAATGTTGCTTCAATGTAAAACTAACGTGTTGTCCTTACTTCGAATTACCCGCCAAACC
GCATCTGGATTGTTCTATTTTTAACTTCCCTACAATTCCCAAGTGCTTGTTCAATGCTGT
GCTTTTATAAATAGCGAAAACCTGCTAGCTTACAATCTCTAGATGATATGATGAAAACTT
TACTACCCGAACCATCGTGTGGGCCTTTGCCTCTGGTAAAGGGACGTAATTCTGATTCAG
TCAAAAACTGTTTTTGTTTGTTTTTTGAATACAATTTAATGGGTTGTAGTATAAAAATAA
ACTTTTCTCCTATAATTTAGATTCCAGAACGTTTTTTAACCACCGTGTAAAGTTGATATA
AACAACACATTGTCGTTGGGCTGCAGCTCGTAGTCCAGTTCACCCTAGAAGTTGAGTTAA
TTATAGTTTTTAGAATTCCATATTCTGTACTCTTACTTACCAGCAATTCCCAGTCTGTAT
CATTTATGAGTACTAAAATTCCAGGTCGCCTGAAAACATACAATAGAAAGTATAGACTAT
GTATCCCTTATAGTTTAAGCCAAACTTACACAGTATCTCCTTGAAGAAAAAGTTCCGGAC
GCTCCGTTAAAATATTCGCATGCATCCACTTAAGCAGATTAGCAATAGTCCCTTTAAAAT
ATATATAATTCATAACCGATTTCACTCAAGTTTAAAACATCTTTTAGAACATACATTTTT
GTTTACCGTCCAAGTTCAATTCACGGCGTTTTATGTTACCAAATAGTAACTCCGCCCCTG
CACTACGAAATTAAATTACAAATTGTCTCATTTATTGGAAATAATAATTCGAACAAGGCT
TTATATACCTGAATTCTAATATGATTTTTAATTCCGGCGTGCCCATCATATGTTCGATGT
AAATAAATGTGTGACCGCGTCTAAGCTTTTCAAAAAAATCCACCATTCAAAAATAATACC
AAATATAGAATCCTAATTTCTAAAAAGTCTGGCAACCACATGCTCTAAACTTCCAAAAAT
TATTGCATTTTGAAAGAAATTATAATTTGTACGTAAATTTACCTTTACCATTCACCTTCG
ACGAGGGGACTCAGCATTATAATTATTCCCATTGAGAAACATAAACAGGTGGCATTCCAA
TGGAACGCTAGGTAAAGTTTTCATTAGCATATTATGATCTGTGCTCTAAGAAGACATTTT
ACATTTCGTTGTGAATTTATGAAATTAAAAAAAACACGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved