Drosophila_melanogaster Locus Poly:3:snoRNA:Me18S-C1366
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Poly:3:snoRNA:Me18S-C1366
Drosophila_melanogaster
Poly:3:snoRNA:Me18S-C1366
2R
snoRNA:Me18S-C1366, snoRNA:Me28S-C3227a, snoRNA:Me28S-C3227b, snoRNA:Me28S-U1848, snoRNA:Me18S-G1952, snoRNA:Me18S-A1061, snoRNA:Me28S-A992, snoRNA:Me28S-G2703a, snoRNA:Me28S-G2703b, snoRNA:Me28S-G2703c, snoRNA:Or-CD4
1001..1100, 1307..1386, 1549..1628, 1789..1868, 2021..2096, 2261..2336, 2495..2565, 2736..2826, 2983..3069, 3226..3310, 3472..3549
4549
CGGTGCGCCCATGCATATAACCTTGCTGATATAACTAGATTAGAAAGGGCTTAACTAAA
TTGCTGGAATTACCCACCTAGCTCCTATATGCTCACACTGATTTGCCAAGAAGTTGAGCG
CAGCTTCATCAAAAAAGTATTGGGCATTGACTTTGTCCTGGGAAAGCGCTGTAAGGCTTA
GTGTGGGATCACAAATGGCGGGATTAGCTGGTTTCCTGCATGGCAAGGGATAGTCCCTTT
TGGTGAGTGCCGTCCTGGTGGTCTGACCCTTCCACTGATCCGCTGGCAAGTGATAATTGC
AGAGTTTTGAGTCCCGATGGGCTGAACAGGCATAATAACCCTGGTCGGGAAGTTGGGATT
GTCGGTTGAACAAAACCGTCGGCCCGTGCTCGCAGCGGGGGTGCTGATCCTCGGGAGCAG
CATCGTCTTCCTCCATTTCAAGCAGCAGCTTATCGCTTTTATTATCAAACATTATGCTAA
AACGTTTATTTATCGTGAACACCACCACACTGTCAACAAGCCGGGGAAGAAGAAGAGTGA
GCTCCGGCAGTATTCAAAATGTAAACATTCAACTTTTATTTTAAAAATAAAACAATGCGA
TTTTTTAATATACCATTCCTTTTCAGTTTAAATCACATGATTTTAGTTGTTTTATTTAAA
TTATTATAAATTAATTTATATTCGATTGATTTAAGAAAGTGGCAACGCCAGGCACTATTC
GATACTTGTATAGATAAATTAATGGAAATTATGCCTTGCCTCCTCTGGTCACACTAAAAT
CACAAAAGTCTATAAAAGCAGCGTGCAACCAGAAAAATTTCTTTTAATTGAAAATTTCTT
GGCGAGCTGTGGTGTGTTTGAAAGAATTCCGTAAAATGTGTACTCTAATGCAAGGCCATG
TGGTCTTACATTTGAAAAGAAAGAAAAGCTAAAATATCAATCTCATGCAACTGCAATGAA
TGGATTAAAAGTAAGTGAACATTAAAATGCATGAATTTAATAGTTACTTGATGATTGTTC
TTTTTCTGAAGAGTCGAGTGCCAAGTCGCAAGATTTGGCATTCTTTTCCTGTAGAAAGAA
TAAGAACGGCCAACTGATAAACTAAATTTAACAACTGAATTGCTTTAAAATGCAATTGTG
GGAAGCAAATAACTAAGTTCTCATTTTTTTTTGTTCTAGAATGTGAAAAAACACGTGGCG
AGCGGTGAAAAGAGAGGGACAGCCGGCATTGCACGCGATGGTATGTAGTCTTCTCTTTCT
AACATACATTCATGAATGAGACTTCTTTGCATTCATAATTGAGAAGTGTTTTTCTGATGA
TAAGTTCAATCTGAACAAAGTGCTGTTGATTTACAACTTAAAATTAAACCAAAAGGATTC
TGATAAAATCATAAATGTATAAGTTTTGAAAACAGAAAATGAGTATACATTAACCCTAGT
TTTTCGTTTTTATTTTTAGCTCTGTGAAAAAGAAGCCGCCATTTTTTGAAGCATTTTGGA
AAAATGTGATCGAGGTGAGATAAATATGACTTAATTGTTTTAAAAAAGATTGTACCTGAT
GATAAGTTTAATCTGAACAAAGTGCTGTTGATTCACAACTTAAAATTAAACCAAAAGGAT
TCTGAAATCAATTAATTAGTATTTTCTATGAATGAAAATGAAATTGCAGACCTAACCTAA
GATTTCGTTTCTTTCAGAATAATGTGACAATTTTGTGAATCTTTCTTTGACGGCAATTCA
TTTTTTTCGAGGTAATTTAAACTTAAATTACTATATAACACTAAAATCAGTTTAATTGAT
GATAAGTAATTACCGTTTGATATCCGTGATATTAAACCCCAAGGCTGCTATTTAATAGTA
ACTGATTCGATATTCAAGTAGTATACATTTATTTTATTGGAACATATCACTAATCAAAAT
GTATATTTACAGATTACATCCATCAGATACATGGAAAATAATAAAATGGATCAGTCGTGA
CATAAGGTAAGAAAACTTGTTTATTTTGTTTGTATGTTTTTTTTTTATTGATGAAAGTAA
TTACCGTACGACTTTTGTGATTAAATTTAAATGGCTGCAAATTTTGCAACTGAAATTCAA
TATAAATAAAAATTGTAATTAGTACTTTTTGATTTGCTAACTCTGGTTTTATCTTCTTTT
GCAGATTCGAAAGGATACGTCATGCTAAAACAAGCTGAATTCATTTGTTGGAAGCGCAAT
TAAGGTAAGATTTAAATGAAATTTGGTAATATGCTGCACAAGTTTAAATGATGAATACCT
TTATCTATTAACTTTCGTTCTACTGAGTGGTAAATGCGGATATATTTTTCTGATTCATAA
AAACCAAGCAGCATTTTGTATATAAAAACCCATTAGAAGTCATTATTAACAATAACTTTT
TTTTACAGACCTGTGCCACTTTCTGTTTATCGAGGGACTCTTACGGTCAAGATCGTCCTA
AGATGGTAGGTGTTCTTCAAAGTTTCGCACTCATTGTTTATATGATGTTACTTCTAGTAT
AGTTCATTAGAAACACACATGTTACAAACTTTTCGAAGCTGATATAGCATTTCATTTTCA
TTAATTCAATGGTTTTTGATCATATTATTGACAATGAATAATTTTTTGCATTTTAGATGT
GACCCAGATGCTTAATCCAGATCATTTGATGAGATACTTAATACTTAAGGTAAGCAGATA
TAGATATTGCTTAGATACGAATTTCTTTGATAAGCGTTTCATATGATGAAATTTTCCTAT
CTCAGGATTCCCTCTTCTGAGTAGAACCCTAAAACAACCGTGCTGTTCACTTTCCCTGTC
TGAAATAAACGCTTTACAAATGAAATTGAATGTTATATGCTTTAAATATGTAGCAGCTAA
CCAAACCAATTTCTCTAAAATTACAGATACATCTTAAATCTAAAAAACTGGACTTCAGAA
GAACTATAAAGGTAAATTACCATTATTTTTTTGTAGTTATTTATTTAGAATGATGATATT
TTCCGTCCGTGGAACTTATACAAAGTAAAATCATGCTGACATTTTATGTCTTCTTTCCCC
AACTGATTATTAACTTCAAATTTACGCTTGATGGCACTTAAATATCAGGATGCTAATTGT
TATTTTATTTCTGTTGCAGGTTTCGTTTTAAAATATCGATTAAACTGATTGATGAATCAA
AACTTCTCGAATGAAAAGGTAATTAAATAAAAATTGTAATTCTGTGTTCGAAATGATGAC
AATACAGTCCGTGGTTTTACACTGAGACAAAGCCATGCTGTTTGATAAGTCATTTTTCCC
CAACTGATACATTTCAAATTTGGAATATTTTTAACATTTATATTCATATTTCTAATTTCA
ATATTTCTTATTGCAGACTTCTTCACGCACAAAGGCAAATGATCCATTGATTTGGTAGTA
ACTTACGTCTTTTTGAAAAGGTATATAAAACTAAATTTCACATTAACATTTATTTAAAAT
GAGGAAAAAAAAGTCCGATATTTTTACTGAGCAAATCCATGCTGTATAAGAGATTTCCCC
AACTGATAAAATTATTCATATATCAGACGGAGCGAACCATATTTTTGAATAAAGACTAAT
TTGTTTTTATTTTATCTTACAGGTTTATCTACAACCAATAACTATCTACAACAATAACAA
ACGGAATATATTTTTCTATAATAAAAATGCAAATAAATGACTACTGAATTCAAGTACTAA
AACTAAAATGTATATTTCTATATGGGGGTTGCATAAATGTATGAGTACGATTTCAAATAG
ATTTTTGCTCAATTTCATAAAGTTTTATCCACTGATTTAGTACAACTAAGAGCGCCATCT
GTTATCCGTAATATTTCATTCTATGAAGCGACATCTGGCGTACTAATGCGGAAGCTTTAG
GAAGTTTAGTACGAAGTGGCAGCACCGTTGTGCTTCACTGCAAATGCTGCCTGCTGCGAA
ACATTCAGTTTGAATGTTTGGTCGTTACATTTTGATATTTATTTATCTGTACACAGATAT
TAACATAAAGAGAGCATTCCAAATTGTAAGATGATTTTCCGAACTCACTATTCTCGGCAC
TTGCGCCGCCTTGCAATTTTCCCATTCCCACTAGCCTTCCCCGGTGTCTCCCATATTTCA
TTGCATTTTTAAGGGCGGCAAACATCAATTTATCATGCTGTAGTGCTGTCCACATAAGCG
GAAGTCGCCTGCCCCGCCAGCCGTGTGAGCAACAACAACAACGTGAGCAGCAAAAGGAAA
CTCCCCCACTTTATGGAGTTCGTAGGGAGGGGGTGGCGGGGTCACAACTATTTTCAACAT
TGTGCACACATTTCATTCATTGAGTGCATGTCGAGCACGAGCATATTTACAACGAGTTGC
AGCGAGAACGATGTGTGCCTGGCACTTTATGCGCTTTTATGCGATTTTATGGGGCATTTT
AAATGACAGTTAGTTGGTTTTTTATTAAGTTGATAATTATCTCGGGGGAACGAGGGTTGT
GCCATCAAAACGCAATGAATTCAATTGAATACTTCCCACTTCCCCATCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved