Dasypus_novemcinctus Locus ATP5B
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ATP5B
Dasypus_novemcinctus
ATP5B
GeneScaffold_6392
SNORD59, SNORD59
1826..1899, 2946..3016
8138
TCCTCTTCCAGCCCCATTGTCTGTTCTCTGCGTCCATTCAGCTGTGTGTTCTTCTGTGT
CCTCTTGCACCACTGTCAGCTTCCCATCACTCTAGATTTTTATTTTTTTTACTCTAGATT
CTTTAAATCTTCTCCCTTTCTCCCCTCCAGCCAGACTTACAAAATTCCACCAAAGAATGT
GCATTTTCGTGCAAACATGTCCTTGGATTACAAGTTTCTCTTTCTACTTTATCCTAGTAA
TTTCCACTCATACCTCATAACAATCTTCGTGCCCTCACTTGACCTTGTACTAAGACTCAT
TACACTCAGTTGCATTGCTTGCTCATGTCTCTCCTTAAAAGGATGGTCCTGAGTTTTATC
TTTGACTCCTCAATGCCTAGCACCCCTCTGCTAAATGACTGGGTCCATTAGCTTCCTTCA
TTTATAGATTTAAGTGACAAAGAGCCTGTCTGGAACCCTGACCTTCTGAGTCGCCTAGAA
GTTTCCAATCTCATTACTGCGAAAGGGAATAGAGGGTTTCACTCCAGAGAAGGCTCCGAA
CTTCGCCAAGGTCACCCTCACCGGCGCTTCAAGACGCTACCACTTCCCTCACTCCCCTCC
CTAAGGCTGTCACCAGCTCAAGGTCCTACCTAAGGAGAGAGGCCAAGGTCAGCCAAAGCC
AACCCACGTGCTTTCCAGCAGGAACCCCGCCCCTTTACCAAACGTAGTTCCGCCAAGTAC
TCTCTCCAACTGACAACCCTACGGTCCAATTATCTTTCGAAGCTCCCAGGCTTGCGTCTA
ACCTGAGAATGCCCAATGAAAAAAGGGAATTTCAGATTGGCACCAGTTTAGTCCAATGGG
TGAAAACATAAGAGTCAATTAACCTATGGAAGCAGCGCTGAGAGTGATGAACAGCAACCT
CATCCAATGGGCGTGCCTATGGCAGAAGCGGCTTCGCCCTTACTGCGCGGGAGTTGGTAG
CGGGGGCAGCTGCGGCGCTCAGTCTCCTCCCGGACTGCGCCATGTTGGGGCTGGTAGGTC
GTGTGGCCTCAGCCTCGGCCTCCGGGGCCTTGCGGGGACTCAACCCTTCAGCATCTCTGC
CCCAAGTCCAGCTTTTAGTGCGGGCCGCCCCGGCAGCGCTCCATCCTGGTAAGTGCCTCC
CTCTAGGAGCTGAGCTCATTTCTGCCGCCCCATGACCTTGAGCTGGGGCTCAATTTGTCG
CTCGGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
CCTTTCTCTGGACACGCCTTCAGTGCAAGCGGAAGGAGGCCCGGTCTGGGCCGAGTTCAC
TACTCCTCGTGGCATAAAGTTGGACTTAAGTGACCTTTAACAGTACTGACCTCGACTCTT
TCCAATATCTCTTTGACTGTTAGCCAGAGACTATGCGGCACAAACATCTCCTTCGCCGAA
GGCAGGCGCCGCCACCGGACGCATCGTCGCGGTCATTGGTGCAGTGGTGGATGTCCAGTT
TGATGAGGGCCTTCCACCCATTTTAAATGCCCTGGAAGTGCAGGGCAGGGACACCAGGCT
GGTTTTGGAGGTGGCCCAGCATTTGGGTAAGTAGAATTTGTTAGGAATAGTAATGAGCTT
TTTTAGCCCCAAACCAGATTGTCTCTTTTCTATGATGATTTCATCAAAATGACTTTCGTT
CTTCTGAGTTTGCTGAAGCCACATGTAGGTTCTGAGAAGGAGTCTTGGTTGACTTAGGTC
TTTCATGCCAGGCGTACTTCATGAAGCCACTTGTAATCCTCCCTGCCTTCACCTGACAGG
TGAAAGCACAGTGAGGACCATTGCTATGGATGGTACTGAAGGCTTGGTTAGAGGTCAGAA
AGTTCTGGATTCTGGTGCTCCAATCAAAATTCCTGTTGGTCCTGAGACCTTAGGCAGAAT
CATGAATGTCATTGGAGAACCTATTGATGAGAGAGGTCCTATCAAAACCAAACAGTAAGT
ATGCTGCTGCTGCATCTACAAAGGGACTGCTTTTTCTTGCAGTTTTTTACATTGAAGTGA
CATTTTATAGTATAGCAGAATTTTCCTGCAGAGAATACTGACAAGGCCAAGTTCAGTTAT
TAAAATCACACAGTGCAGGTTTGTTTGTTTTTTTTCCATGAAATTAAGGATGCCCAAGTT
CTAATTTGACAGACACCTACACTGGACACCAGTTATCTCACTTAGATTATCTAAGTGAGC
TGCAGTACGGATGGCTTGGGTTGTGGGGTCTCTAAAACTTGCAGGTTTTTGTATTTCCTT
TTGATATTTAAAGAAATGCTGGTAGGTTAGAGATCAGTAAAAGGAAAAATAAGAGTTTTT
CTCAGCTTATTGGGAATGGGATAAATTTTTCCAGATAACAGGGTCCCCTTATTGCAGAAA
GTCTGTTAGCAGGTAGCTGACTACTTGTCTAAAATGTTATATGAAAAGGGAGGTGAGAGT
GTGAATAAGAAGGGCTCAGGAGTTGAGAGGGTTTGAGTTTAATATGACTCTTCAGTTGCT
TTCAACCAAGTGAAAAGACACAGCTTTCCTACCTTTACAGATTTGCTGCTATTCATGCTG
AGGCTCCTGAGTTCATGGAGATGAGCGTGGAACAAGAAATTCTGGTTACTGGCATCAAGG
TTGTGGATCTGCTGGCTCCCTATGCCAAGGGGGGAAAAATTGGTAAGTTTAGTGGTGGGT
ACATAATATTCTAAATCTAATGTGGGAGGGAAAATTATATGTGATGAGTGGGTTTTGAGA
CCTATCCCTCATTGATGAGTAGCTTCTGACTTTCGTTCTTCTGAGTTTGCTGAAGCCAGA
TGCCATTCCTGAGATGGGAAAAGATGGGGTGGGGGGAATCGTGTATTTTTTAAGTTTGCT
TATTTGGGAATATAGGATTCTTACCTATTCTTTTTTCTCAACCTCTGCCAGGACTCTTTG
GTGGTGCTGGAGTTGGTAAGACAGTACTGATCATGGAGTTAATCAACAACGTTGCCAAAG
CCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGCGAGGGCAATGATT
TGTACCATGAAATGATTGAGTCTGGTGTTATCAACTTAAAAGATGCTACCTCCAAGGTGA
GCACTGAGCTTATGCACACTTACAGTTGTGCCAGGAAACTTGCAGTTGGTGGTTATTACC
AGTTAGGAAGTGATGTTTTATGTTCTCATTTTAGTGTCCCAGAACATGGAAAGGAAATAC
CTGTCAATGTCACCTCCCCCAGCTTCTACACTAATGCACTTTTTTTTTGCTCTTTGACCT
TCGACTACATGTCTAGACTTTATAGTTGCATCATTTGAAAGCTAATGGGAGGGGAGAGTA
GACAAGGTTGGAAGTCATTCATGTGTCTCAGATAACCCTATTTTGTGCCTTTTTTTATTT
TATTTACTTCTACCACAGGAATTGTGCTTCAGTAATATAAGAAATTACGTTTTGTGTTGT
TTTGAACTGCATCTATAATAGAGAATAGAAATTTGAAGACAAAACAATTGCACTTTCTGA
GAAGGAGGGTTTGTGGTGGTTTCTTTTGATTTGGGGGTCTTGGGCATAAAGCTTCCATAT
TCCTTTGCCAGGTTTTCTGAGTTGTGTCTGACTATCGCAGGTAGCCCTGGTGTACGGTCA
AATGAATGAACCACCTGGTGCCCGTGCCCGTGTGGCTCTGACTGGACTGACTGTGGCTGA
ATACTTCAGAGACCAAGAAGGTCAAGATGTCCTGCTCTTTATCGATAACATCTTTCGCTT
CACTCAGGCTGGCTCAGAGGTAAAAGGGAGTGCTTGCAAGGACCTGGCTCATTTGACCTT
TCAGTGGAATGAGACAGACGAGGCTAAAGATATAACACATAAAGGTGTTTTTGTTTTTTG
TTTTGTTTCGTTTTTTTCAAGGTGTCTGCTTTATTGGGCAGAATCCCTTCTGCTGTGGGC
TATCAGCCTACACTGGCCACTGACATGGGTACCATGCAGGAAAGAATTACCACCACAAAG
AAGGGATCTATTACCTCTGTACAGGTAAGAAAATTGACATGGATGAAGGATTGATTTGTA
TAAAGGCATTTATACAATGCCTGATTCTGAAATGGACAAATGGGTTTTTTATACAATGCT
TGATTCTCAAATGGGTTTTTTAACATGAGGTTCATGAGCTTCTTGAATTGTATAAAATTC
TTTGTATGTATATCAAAGACTGTAAAATTAAAGCATTCTTCTGAAGCAATTAAAATATGG
TATACATGTAAATTCAGAACACAAAAGCAATAGTTCCTAGCCTGAAGGGAATCTGTCCAG
AGCTGCATGGAAACGGCGTTCAATGTATCCTGGATTAATGTACTGCAAATTTCCAAATGT
ATATAGACTGTATATATATTAAAATTATCTTTAAAATGAGACTAAAATTTTCTTGGTAAA
CTATTGTGTGAGAAGTTTTTTTCTTTGTTATTGTTTTTATTTTTTTGATAACTCTTAGAG
GGGGGTGCTATTATAATAGTTAAATACAGGGTGAACAGAAGGGAATGGCAGTGATAATTC
TTCCTGTTATAGCTTGGAGGGGACAATAATCTGTTCACTCAGGTAGTAGGAGCCTTCTTA
CGGCTCCTTTGAGGTAAATTGTTGAATGCTAGGAAGATGAACTGAGATAAAAGTCAGAAA
GAGGGGGATGACTTTAGTAGAATTATTTTAGTTCCTGCTGCTCTTCATGGGTTCTTGACT
CACTTTAGGCTATCTATGTGCCTGCTGATGACCTGACTGACCCTGCCCCTGCCACTACCT
TTGCCCATTTGGATGCTACCACTGTACTGTCCCGTGCTATTGCTGAGCTGGGCATCTATC
CAGCTGTGGATCCTCTGGATTCCACCTCTCGCATCATGGATCCCAACATTGTTGGCAGTG
AGCATTATGATGTTGCCCGTGGGGTGCAAAAAATCCTCCAGGTGAGTATTGCTTTGTGAG
AATGTGGCCAGAAAGTCATAAAGGTGTGAATTGGGGTATTATATTAGTACCAGATCTTTG
CTGGTGACTTCTGTGATTTGCTTGGGGGCAAGGAAAGATGAAATCAGCAGTTACTAGTGA
GTACTCATAAAGTCTATGTAGAATCCAGGTTTTTCTAACAGCACCAGGCATAGGAGTAGA
GAGAACAAGACATTAATTTTGACTAAGAGCCCTTCTGATCCCTAAGTATGTAACTTTCCT
TCTATTAGCTTGTACCATTTATGGTGTAATGTACTGAAATGCTTTGTACAAAGCTCAGTG
CAGATATAAAATGGCATTAACTTCCTAGTTTTTGTGCAAATTAAAAGATTCTGAATATTG
TCTCAGGCTTCTTTTATTTGCTTTCCCATAGGATTACAAATCCCTTCAGGACATCATTGC
AATCTTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACTGTGTCCCGTGCACGGAA
AATACAGCGTTTCTTGTCCCAGCCATTCCAGGTTGCCGAGGTCTTCACAGGTCACATGGG
GAAGTTGGTACCCCTGAAAGAGACCATTAAAGGATTCCAGCAGATTTTGGCAGGTGAGAT
TTTGAGTAGAAAGCTGTGCTTTATGGAAGGGACGCTAAACTCTCTTGAATGCTCTCTGCT
GTCCTCACATTCTAACAACCATTAAGCAATATATATAACTATACTGTGCCCAGTTAACAC
AGTTTTTTAATTTAAAAAAAACCAAAAAACTATTTCCAATCACTTTGTTTGAACATACTC
TACATTGATTTCTGAGTGTTATATATTATTTGATCCCCTAGGTCCCTTTAATATATCATC
TGACACTTAATGAGTGCTTTCAGTGCTAGTTACACTAAGTGAATTGCAACAATCTTCTAG
GGAAGGCACTATTCTCTTTTACACATGAGGAACTGAAGCACAGAGAAGTTGTTTTTGTTT
TTTTTTTTTAAACATTTCACCCACTGGGGAGGTGAGAGGGGTGGGGATGAAAGGGGATAG
TTGACAAAAGCTAGGACTTTACCTCATTACCGTTCAGAAAGTGTCCATCAGTAGACAGTC
CTCAACCTCTCACTTTCTAATCAGCAGCTATCAAACTGATCATATGGCTTTTCTCCTTTC
ATTTGTCACTTGGTTAAATTTTAGGTTTACTTTTTTTTTCATTTTAAAAACAACCTATTA
AAGTATATCATTCATAACATGAACAGACATAAATAGTAGGTGTATAGTAAAAGTGGTAAA
CTTCAAAAATAAACATGCATAACATCATACAGGGCTCCCATATATCATCCCACCACAAAT
ACCTTGCATTATTGTGAAACATTTGTAACAAATTATGAAAGAGCATTGTCAAAGTATTAC
TAACTGGAGTCCATACCTTATATTTGGTGTATTTTTCCCCCAGCCCACCCTATTTTTTTT
TTTGTTCATAAACTGTATAATTTAAAGTATACAGTCATTGACATTTGGTAAAATCACCAA
GTTGTGCATTTATCACTTCAGTATTAGAGAATTTTCATTATTCAAAAAAAAATAAAACAA
AAAAACTATCATGCCCATATGTTAGTGTTACTGATTACAAATCCTGTGTGAAACACAGAA
GTTTAAAATAACCTATTCCATTGTCACCTGGCTAGAGTAGAGAGCAAGAATTTGGATCCA
GGTTGTCTGGCTCTAGACCATGTTCTTAATCTCATATTTCTGTAGGAATTTGATGTGTGA
AAGAAATTTAAGAAAAGATTTCTTAAGATGACATGAATTCATCTCATTTTGACTGGTGGC
CTCTAGGGGTGAGATTTATATGCTACAGAAAGCTGATAACCCTCCACCTCTCACTAGTTG
GATTTTCCCCCTTCCATTTAGGTGAATATGACCATCTTCCAGAACAGGCCTTCTATATGG
TGGGACCCATCGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATGAG
GCGTCTTTGTGGCAAATTAAAACACTTCATCATGCTGTTCCTGTCCTTGTCCCAAATCCA
GAACACTGTGTGTAGGCCACACAAGAGCCTTAATTGAAGATGTGTTCTGTCTGAAGAGTA
TTTAAGGTTTCCAATAAAAAATACATCCCTCAGAATTTGTCTGCTTTTCTGGGGAGATAC
ATAAACCTAAAAACTTACCTATTACCTTTTCTTTGGTTCTGACAACACAGCCAACACTGA
AGGGTTTTTTTTGTTTTTTTGTGTTTTTTTTTTCCGGAGTTACAAGGGATAGAACCCAGG
ACCTCCTCATACATGGGAAGCAGGTGCTCAGCCACTGAGCTGTATCTACTTCCTGAAGTT
TTTGACAATGACATTTTTAGAGTGGCCACAAAAGTTTTTTAGCAGAGTTGGCCATGTATG
TTTAACCGGTATCGCTAGAAAATAGCCATTTCCATGGATTATGGACAACTTGAATCTTGT
GAGGGGTTTCCTGTGACTGAAGTGATTTGTTGACTTTCACCCTTCAGAGCATTTGTGTTC
AAAGCAAATTAACTTTTGCCTCTTAAATATTCCATATGGCATATTACTACTTCCTGGTTA
GTAAGCAAAGGTTGATGGAAGCTACTGTTCCAAGACATGTTTGGGGTTAGGGTTAATAAG
TGGGTTAAATGAATTAAGTTTTTAGGAAATGGTGATGAGGTACATTTTGAAAAATCAGTA
CTGATTTGTTTAAAGATGAGTAAAAAGTTTCTATTTTTTCAATCTAAATCTTAAATTCTC
CAAAAAGTGTTAGTAGTACCTCTTTTTTTTTTCCTTCAGATTTTATTTCCCCTTCCCCCT
TCCCAGGTGTCTGTTCTCTAATTGCTGTGTGTTTTTCTTTGTCCGCTTCTGTTATTGTCA
GTGGCATGGGAATCTTGTTTTTGTTGCGTCATCTTGTGTTAGCTCTCCGTGTGTGCGGCG
CCATTCTTGGGCAGACTGAACTTTGTTGAGTGCTGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1583..1765, 1979..2153, 2740..2861, 3111..3295, 3820..3978, 4101..4223, 4928..5140, 5551..5752, 7041..7138
1001..1127, 1583..1765, 1979..2153, 2740..2861, 3111..3295, 3820..3978, 4101..4223, 4928..5140, 5551..5752, 7041..7135
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved