Dasypus_novemcinctus Locus ENSDNOG00000019891
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000019891
Dasypus_novemcinctus
ENSDNOG00000019891
GeneScaffold_7616
SNORA38
1309..1437
93787
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAAACCTCCCCAGGTGGAGATGAGA
CCACTGAGAATGAGCCCGGGGACGCAGGGCCCTGGGGTATGGCTAAGAGAGCTAGTGTCT
AATAAATAGGGGACGTAAGGCTCTCTCTCTTTGCAGTTGTAATCTTCTTTTTGCTTTTCT
CTTGGGTTTGGATTTGCCCCATTTTATTGTAGGTCTCTGAAATTATTTTGGTGGAGAGAA
GAGAGCCTATTACTGGTGGGGATAATGAAAAGGCAGCTACGCTTCATAGGTTGGCACAGA
GAAGAGAGTGATTCTACTGGGAAGATGCTAGATTTTTATTTGGATTTCCTTGGCAAGAGC
TGTTTGGGAGAAGAAGAAACCCGGCCTTTGGGCTGTGTGGGGGCTGAGTAGATTGTGGTG
GTTTGAAGATACTGGGGAGTTAACAGGTAGGAAGGGAAAAAAACCACTAGAGGCACCTAT
CTGGGCCCCTGATGAGGCCGAATGGGCGAGAGCTTGTAGTCTTCTATTGGAACCCATGAA
GGGGGCCGAGACTGAGGCACTTGGTGTCTGGCCCTTAGGCTCCGGCTCGTTTCGGGGGAG
GTGCCTGCGGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGCCCTGGAAAGATGTTCCTAA
TTATTGGAGGCTAGACATGAACAGGGCATACACCTTAGATAGAGCTAGGGCTCTTGGAAG
GGAGACAGAGCTACTACAGAGAGATCAAGAGACCAGGGGACCCCTGGAGGTTTCCCAGCT
TTTCCCTGGCTACCAAATGGGGAGTGTTGGGCTCTGGGCAAATGCCACTTACTCTGGCAT
TTGCCTGTCCGGCTGCCTGTCCGTGGACACGTAAGAATTGGAGGAAAGGAGATGTGAACT
TAGAGAAGTCTGGAGCCAGCTTGTTCCCTGTAGGCTCAAGATCACCCTTCCCACATGGAA
TGCAGTACATCTCAGCTTTCCCAGCAGGGATCTTGTAGATCATCAAGGGCAGGGGAAGGT
ATGGCCTCTAAGAGCAGTCTGAAGTGGGTGGATGATAAGACGCTGAGAATGTCCAAACAA
GGCTTAGGGTAGGAGGCTGTCGTCTCCCGTGTGAGGCAGTTTTGACCCTCTCCACCTTTT
CTTCAGTTGCCCCTCGCCATGGCCTGCAGAGTCTTGGGAAAGTTGCCATTGCCCGGCGTA
TGCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGAGAGGAGAGGGGTCTGCAGAAAAGCTGGGTCTGCAAAGTATTG
AGAGGCGTAATTGGGATAGGAGATGGCCAGAGCCAGAGTCCATGGACCTAGGCTGCAGAC
AATGGGAGGAAAGGGGTGGAGTGTGGGAGTGCATCTTACTGATGGCCTAGACTGCTTCTG
CGTCCTGGGAAGACTGAAATTGGAGAGCAAAAAGCTTGGATTACTGCTCTTTTCCTTTTC
CCTCAGGGGCACATGAGGAGGTCGACTACACTGAAAAGCTCAAGTTCAGCGATGAGGAAG
ACGGGCGAGACTCTGACGAGGAGGGAGCTGAGGGCCAGTGAGTTAGGACTGTGTGTGGAG
AGGCGGGGCTCACTTTTCTCTCTTGTGAGGTACTGGGCTGCAGCTGATTTTAATTGTACT
GTTGGTCTGCCTCACAGCAAGGATTCCCAGTCAGCTGCTGGTGAGGAACGGCCCCCCGAA
GCAGATGGCAAAAAGGGCAACTCCCCTGGCAGCGAACCGCCCCCTCCCAAGACGGCCTGG
GCAGAGACCTCTCGGCCTCCAGAGACAGAGCCGGGGCCTCCTGCCCCAAAGCCTCCCCCA
CCCCCACCTCACCGGGGCCCCGCCGGGAACTGGGGCCCCCCTGGGGACTACCCAGTGAGT
GTCTACAATGAGGGGGTGAGAGGGTCATTTGTGGGAGATTGGTGACAGCGAGCAGTCATA
ATAGAGGAAGCTAGAGGGAGGGCTGATAATGGGCTACACGAAGTTTAAGTGGCTGCGGAG
CGTCTCTGACAAGGTTTGGACCTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATATTATGATGCGTCTGAGGTCTC
AGTGAAAATTCCTAGGTGTTTATGAAGCCCCTCTAACTTTCGGGGCTTGATCTTAAACTG
TAATCTCTGTTTTGCCAGCATTGGGCAGCTGTTGAAGTCTGTGCTCAGTGCTTTAACTCC
TTAGCTTCTGCTTTCCACTGGGTTTCTATAATTCTCACAATGCACTTGGACATCTTAGGA
GTCAGCCAAAGAGTTGAGGGAAATTTTAATGAAAATTTTAGGGCTACCTCCTCTTGGATG
TTGCCCCTTATTTCTAGTGGCACACCTAAAGTCTGAAAGTAAAGTTGTTCTTAATACTTT
CCGTTTGGGCTCAGTAAACTGAAAATTGCTAGTAGAGGAAAAGCCAGGTAAATGTAGATG
TAGAGCTCACCTTTTTTTTTTTTTTAAAAGATTTATTTATTTATTTCTCTCCCCTCCCCC
CCCACCCTGCTTGTCTGTTCTCTGTGTCTGTTTGCTGCATTTTCTTTGTCCGCTTCTGTT
GTTGTCAGTGGCACGGCAACTGTGTTTATTTTTGTTGCGTCATCTTGTGTCAGCTCTCTG
TGTGTGCGGCACCATTCCTGGGAAGGCTGTACTTTCTTTCGCGCTGGGCAGCTCTCCTTA
CGGGGCACACTACTTGCACGTGGGGCTCCCCTATGCGGGGGCACCCCAGCGTGGCACAGC
ACTCCTTGCGCGCATCAGCACTGTGTGTGGGCCAGTTGCACACGGGTCAAGGAGGCCCGG
GGTTTGAACCGCAGACCTGCCATGTGGTAGATGGACGCCCCTAAACCACTGGGCCAAGGT
ACACCACCTCCTACTCTTCTAATCTTGAAGGGAGGAAAAAAACTCTAAGAGGAAACTAGG
GCGTAGAGAAGTTAAGGAACTTTTGGAAGGTCACACAGCAAGTGGCAGAGCCAGGCTTTG
AACCCAGGCAGTCAGGCTCCAGAATTTACAAGCAGTTTAAAAACTGAGTATTGACTTCAG
ATTTGTGCATTTTATTCTGTGTAAAGTTTACTGTCCTCAGATCCCTCAAAAAAGAAATGG
GGAAACAAACGCTGAACTCAAGTTTAATAAACATGCTAAAGGGTTTAGAGGCGAAATGCA
TGGATGGTTGCAACTTTGAAAGGCATCAAAAAATAAGGTCGATTGATAGATAAATGTGTG
CTAAAGCAAATAGAGCAAAACATCAACTGTAGAGTCTGAGTGGTAGGAATATGTTCACTG
TGCAATTCTTCCCATTTTTCTCTTTGAAATTTTCAATATTAAAATGTTTAAAAGAACACA
CAATAAAATCGAGTGCCGTCCTACTGTCCTTCAGGAGCGTGCTAAGGGCCGGGGTGGGGA
CGTAGCAGAAACGTCCTGAATTTGGAAGAGGAAATGCAAATGCATGTGGCCCAGCCCCCT
CTTAGCCCTCTCCCGCTCCAGGGCTCCCCGTCTTCACCCTCCTTGGGACTGGGCGTGCAG
TCCGCCGGCACCTGTCTCCCTCCCTTGTGTGCACCAGGAGCCTTCACCCAGGGCTCTGTG
CGGCGGCTTCCGATCCCTGCCCTTCCTTGGCTCTGAGCTCAGAAGCAGAATGCTGCCTTC
GGCAGGAGGTCGCCCTGCACTGCCCTCACCTTGCCCGAGCAAGCTCTGTGTCCGGATCTC
AGGTTGATCTAGTCTGGCTGCCCCTGACTCTCCTGTTTGTCAACCAGCCAGCCAAGAGCC
CTCTTGCCTCAGAACATCAGGCAAGTCACCCCCCACCCCGGTCCGCCAGAGCTCCCACCC
AGATGGAGAGTGATGAGCTCTCAGCAGGTGCCGCTAAGGGCGCACTGGGGAAAAGGTAAT
CAGGCAGGGCTGCTTGGAGGGGGTGAACACTCCCTGACTCCCAGGGTCAAGAGGATGGTT
AGAGGTCCCAGGAGTCTGAAAGGAAAGCTATCACAATCCTAAGCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTACACTC
TGCTCCCCGAGAGGAGCTTTTGAGAGACCAGGAAGATTCGGACACTGAGAGGAAGGCAAG
GAGGTAAGAAGGGTGGGAAGGTGGGAGCAGGACCTCGTGGGGAGGGCGGGCCCCCCAAGC
CTGCGCTCAGCACCTCTGTGCCCGCCCCATGCCTTGGGGGGGGAGCAGGAGCTCCACTAT
GCATCGCTGCAGAAGCTGCCGGCCGGTGGGGGGCCTGACGCTGGCGAGGGAGAAGAGGAG
GAGGCCCAGAAGGACCCCAGCACAGATTACGCCTGCATCGCCAAGAACAAGCCCACCTGA
GCACCCCCGGGGGGCCCCTCGCGGCGGGCGCGCGGGCAGGGCCGGCCGGGGGTCCCCCCA
TTAAAGACTGGGGTCTCCCCGCCTCTGCTTCTCAGCCTTCTCAAGCCCCCGTTTCAAAAC
CACCCGTCACACCTTGAGCGCCTTACCCCTCGCCCACCCCCGCGGGGGTCAAGGGGTGAT
TTATCGGGTCAAGAAGGACCTTTGGGGACCCAAGCTACCCGGAGGCCAGAGAGGAGTATT
TTTTGCAGGGCTGCCCACGGGTAGGAACGGTGGGATCTGATGACCCCCACTTCTCAGGAG
GCCCTGCCTCCGCTCCGGGGGGGCCTGGAGAGCTCCGGGGTGGTGGTGGGAGGGGGCTCG
AGGCCGATGGCTGGGAGCAGCCTCCTGGGGCCTGCGGGCTGGACTTGGTGACAGTCTGGG
ACGTCTGGAGAATGGAGTGAAAACCGCACAAGACCCACGAGGAGGGGCTCGTGGTGGGGC
GGAGGGGGGCTTCCTGGGGGCCCCTGAGGAGGGCCGGGGGTCCCTGGGGGCGGAACAGCT
CCCCGGAGGCCAAAGCACGGTGGGCCAGCAGCCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGCTGTCTGGAGGCATTGA
CGCCTCTCCTCCCGTTTCCTTCCTCAGGAGCAGCTCCTGAAGCAGCAGCAGCAGCAGCAG
CAGTGGCAGCAGCACCAACAGGGCTCCGCTCCACCTGCGCCTGTGCCCCCATCGCCTCCG
CAGCCTGTGACGATAGGGGCTGTGCCAGCTCCACAGGCCCCACCCCCACCCCCCAAGGCC
CTGTACCCAAGTGCTCTGGGCCGGCCCCCACCCATGCCTCCTATGAACTTTGATCCCCGC
TGGATGATGATTCCTCCCTACGTGGACCCCCGGCTTCTCCAGGGCCGGCCCCCTCTGGAC
TTCTACCCTCCTGGCGTGCATCCCTCTGGTAAGGGACCACAGGAGGGACAGTGGTGGTGG
GTCCCGGTCTCACTGGGGAGACAGGGTCACCAGGGAAGAGGGGAGGATGCGTGCTTAGCA
CTGCTGAGAATGTGCTCTGCTGGAAGAATGAGCTAACAGTTGCTAGGATGTTTTTGGAGG
ATTGGTTTTTTTATAGGGAAGCTGAGAGGATAACCCTGTTTTATGAAAGCAGTCAGGACC
CAAATTGATTGGAACAAGAGTCGGAAAACTGATTTGACAGGGAGGACTCAATGAGGAAGA
TGTGTTTTGGTGTGGGGAGCCTGTAACATGGAAAGGGTTGTCTTTCTCGTGTTCTTGTTT
CCTTTAGGCCTAGTTCTCTCGGGAGCGCTCAGACAGTGGGGGCTCAAGTTCAGAACCATT
TGAACGCTACGCACCTCTCCTCCTGCGGGAACGGGGCACCTCCACTGGTGGATACAAAGT
TGGCCTGGGTAGGAGATGTCTTTGCTTCCACACCAACTGACCCCCGCCCACTCACCTCAC
CTTTGCGCCAGGCTGCAGATGAGGATGACAAGGGGATGAGGTGAGTCTGGGTAGCGGGAA
ATGGGTGAGTTCCTGGTAGAAGGATCTAGAGGTAGGAGAAAGGACTGTTTGGGATTGTTG
GTTGAGGGGTAGGCAGCAATTTGAAAGCAGTGTCTAGGTTGTAATACTAAAGTGTTCTTT
TCCCCACCTAGCTAGTCCCAGTTTTTTTCCTCTTAAGATGCTTACTTCCTTTTCTGTCTC
CCTCTTCAGGAGCGAGACTCCTCCAGTACCTCCCCCACCACCCTACCTGGCCAGTTACCC
AGGCTTCCCTGAGAACGGAGCCCCTGGGCCCCCGATCCCTCGCTTCCCTCTGGAGGAGCC
CGCTCCCCCAGGGCCCCGGCCACTCCCCTGGCCCCCAAGCGGCGACGAGGCGGCTAAGGT
CCAAGCTCCGCCACCCAAGAAGGACCCCCCCAAGGAGGAGACTCCGCAGCTGGCAGGGCC
GGAAGCCATACGGAAGCCCGTCCGTGGAGTTGGCGGCCAAGGCCCCCCACCACGCAGAGA
GAGCCGCACGGAAACCCGCTGGGGGCCTCGTCCAGGCAGCAGTCGCCGCGCAGTCCCTCC
AGAGGAGCCTGGGGCCCCTCCCCGCCGCGCCGGGCCTATAAAGAAGCCCCCTCCACCCAC
AAAAGTCGACGAGCTGCCTCCCAAGCCCCTCGAGCAGGGGGATGAGACCCCCAAGGGTCC
AAAGCCAGACCCACTCAAGACCGCCAAGGGAAAGATGGGGAACCCCAAGGACCCCCGCCC
AGTGGACTCTTTCCCTGCCCGAGGCTTCGGCGGGACTACTCCTACGAAAGGATGGGTCCC
AACTCCTGCCGGGGTCGGGGCCGAGGCGAATACTTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCAGGCAGCGAGACCCACGAGAGTGACCTGGCCCCCTCAGACAAAGAGGCCCC
CCCACCCAAGGAGGGAGTGCTCGCCCAGGCCCCTGTTGCTCCCCCACCACCAGGAGCTCC
CCCGTCACCAGCGCCAGCCCGCTTCTCTACTGCCCGGGGTGGGCGAGTCTTCACTCCCAG
AGGGGTGCCATCGCGCCGGGGCCGAGGCGGAGGGCGGCCCCCTCCCCCTGTTTGCCCAGG
CTGGAACCCTCCAGCCAAGTCCCTGGCCCCCAAGAAACCTCCAGCAGGCCCTTTGGCACC
CAGCAAGGAGCCTTTGAAAGAGAAGCTGCTCCCAGGGTCCCTGTCCCCCACGGCCCGGGG
AGGCAGCAACGGAGGCAGCAGCATTGGTGTGGGCCTGGAAGACGGGGAGCGGCCCCGGCG
GCGGCGGCACGGGCGGGCTCAGCAGCAGGACAAACCCCCTCGCTTCCGGAGGCTGAAACA
GGAGAGGGAGAACGCCGCCAGGGGGGCCGAGGGCAAGCCCCCCTCCCTGGCCCTCCCGGC
CCCTGGCCCCGGCCCCGAGGAGGCCCTCGCCCCAGTCACCGCGCCCCCACCGCCTCGGCG
CACAGCTGCCAAGTCTCCTGATCTGTCGAACCAGAACTCGGACCAAGCCAACGAGGAGTG
GGAAACTGCGTCGGAGAGCAGCGACTTTGCCAGTGAGCGCCGGGGGGACAAGGAGGCCCC
CCCTCTGGCGCTGCTGACCCCCAAAGCAGTGGGTGCTCCTGGGGGCAGCGGAGGCGGACC
CGGACCAGGTGTTCCAGCCCTGCCTCGCGGAGACCCAAGCCAGAGAGCCAAGGATTTGAC
CAAGAGGAGTTTCTCGAGTCAGCGGCCAGGCATGGAGCGACAGAACCGGCGCCCCGGCCC
AGGGAGCAAGGCTGGCGGTGGCAGCAGCGGTGGAGGTGGCGGGGGCCCTGGGGGGCGGCC
CGGCCCTGGAAGAGGGGACAAGAGGAGCTGGCCCTCTCCCAAGAACCGGAGGTAGGTGGG
GATGGGGTTCTGTGTTTACTTCTAGGGTAAAAATAATTTGGGGAGGGGAGAAAACCCCAA
GGCACAGGTGAGGTGGGTGCTGTGGTGTTTGAGCTAAGGACAGGTGGGCTCGTTAGAAAG
GAACCAGGACTTGTGTGTCTGGGTGAAGTAGCAGGAAAGCAGTTAATAGGAATACCCGTG
TTCCTGGTCCTTTTCACCTCAAACCTGATGCAGGTAATCCAGAGGTCTTGAAAACCCTCT
GGTTTTTTAACGGAGGAAGGTAGGTTGGAAAGGGAGCATAGAGATGTCTGACCAGTAGGA
AAGGGTAACAATTCAGCGAGTGAACACTGGAGCTTACGCCCTGTTCTCTCCAGCCGTCCC
CCGGAGGAGCGCCCCCCCGGGCTGCCTCTGCCTCCGCCGCCCCCCAGCAGCTCTGCCGTC
TTCCGCCTGGACCAAGTTATCCACAGCAACCCCGCGGGCATCCAGCAGGCTCTGGCCCAG
CTCAGCAGCCGCCAGGGGAGTGCCGCTGCACCAGTGGGGCATCCAAGGCCCAAGCCTGGG
CCCCCCCAAGCCCCTCAGGGCCCCTCCCCTCGGCCCCCAACCCGTTACGACCCCCCGAGG
GCCCACAGCAACTGCCTGGGTGCTGGTAAGCTGGGAGGGGAGGGAAGGTGGGGAGTTGTG
GCCTGGGACTCCTGCTGCTGGGTGTCTACAGTGAGCAAGGGAGAATGGCTGGGAGGTGGA
ACAGGGAGGAAACGTTAGAGCGAAGGATAGAGGGGCAGATGCTGACCGTTTTCCCCTTTT
CCCCAGACCCCCACTTCGAGGAGCCAGGGCCGATGGTGAGGGGGGTGGGCGGGACTCCCC
GGGACTCTGCCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAAACCGGAGCTGCTGCAGGAGGTGAGGGATAGTGCTTCCTGCT
CTCCCTCTTCTGAAGCTCTCTTTGGTTATATTTTCTTTCTATTCCTGTCATTGTGTTGTC
ACTCTGAATCCTCAGTATTAGTCATTCTTTCCCTTCTGTGTGTGCCTCTTCCTTGCTACC
TTCATACCTCGCTGACAGTTGTTCTAGCTCCCTGCAGTTTTCTGGTCTTACCTAATTCAT
GTGCCTCTGGCCTTTCTCATCTTCAGGAGTCCTTGCCACCACCTCATAGCTCTGGATTCT
TGGGCCCTAAGCCTGAGGGCCCCAGCCCCAGGGGAGAGCCCAGGGGTGCAGGCACCGAAG
CTCTGACTCCTCACATCTGGAATCGTTTACATACTGGTGAGTGACGCTGAGGGAGAGGAG
GAAGGGCTGAGTTAGAGGGCTTGGAGAGCGAGGGGCTGTAGGCCCGTCTCACCTCCTGTG
TTCTGACGGGTGCTCCTTTCCACAGCCACTAGCCGCAAGAGTTACCGGCCTGGCTCCATG
GAGCCCTGGATGGAGCCCCTCAGCCCTTTCGAGGACGTGGCTGGCACGGAGGTGAGTGAG
GCTGGGAAGGAGCAGGAATGTGGGACTGGGCAAGGGCTTGGTGCGAGCCAGCCACGCTTC
TCCACTAACGGGGTCTCGGCTGGGGCTGCTCTCTCCTAACAGTTGTCTCCTTCCTTCAGT
TTGTCCGTGCGTGCATGTGTGTGTTGGGCACCTTTGGGGTACTCTGGGCCCTGACTGTTC
CTTCTCCTTTCAGATGAGTCAGTCTGACAGTGGGGTAGACCTGAGCGGGGATTCTCAGGT
ATCGTCAGGCCCCTGCAGCCAGCGAAGCTCCCCCGATGGGGGGCTCAAGGGGGCGGCAGA
AGGGCCTCCCAAGCGGCCCGGAGGCCCCTCGCCTCTGAGTGCTGTTCCTCCTCAAGTTCC
ATCTGGCTCCGAACCCTCGGAACCTCCGAGGAGACGGCCCCCTGCCCCCCACGATGGGGA
CCGGAAGGTAAAATACCAAGAAGGCTGAGGGGAGGAGTGCTTCCCGGCATCTGCCTTGGG
TCCTTTGTGTCACCCTTCTTCTCTCTCTTCTGCCTGTGTCTTGTGGGGGTCCCACAGCTG
GGGCTCCTCTTCGCTCCCCAAACCACGTCTGTGTTTCTCACCCAGGAGCTGCCACAGGAG
CAGCCTCTGCCGCCGGGCCCCATCGGCACTGAGCGATCGCAGCGCGCAGACCGAGGCCCA
GAGCCTGGCCCCCTCCGACCCCCCCATCGCCCTGGCCCCCCAGCCCAGTTCAGCCCTGGT
GACAAGGTGTGCATGGGCTGGGCCTTGGCGTCCTGGGTTGGAAGGAAAGAAGGGAAGGGC
TGGGGGTGGTATGTGGAGGACACACATCTGAATCACGGGACAATCTTCTCTGCCTCATGA
CAGGACTCGGATTTGCGCCTAGTGGTAGGAGACAGTTTAAAAGCAGAAAAGGAGCTGGCG
GTGCCTGTCCCCGATGGGGTGAGTGGAAGAGAGAATTGGTTGACAGACTTCAGGTTCCTA
GGGAAGATTGTTGGGAATGATCTGCCATCCAGGGTGCCCAGACATGCTTCTTCCCTTTTT
TTTTTTTTTTTAAGTTTATTTTAAATTGTAAATATACTTGAAATCACTTTAACCAACTGA
AGTAGACCATTGTTTGATATTGAATACATTGACAAAACCGTAACTTTCACTGCTATTTTC
AGACTGTTTGTCATCACAAAGCAAAACCTTACACTCATCTAGTAGTAACTCCCTGTTCCC
CACCCCACCCCACCCCTGGTAACTAGTGTTCTGTTTTCTCTCTTGGAATATGCGTATTCA
AGTATTTCATATAAGATCGTGTAAGAGAAATTATGCACTGTTGTCCTTTTGCGTCTGGTT
TATCTGAACTAGAATATGTGACTTTGTGGAGACCTCATAGGTTTGTTAATTTTGACCTAT
TGCTAAACTTTAATGTGTTCGTGTGTCTGTTAATTGCTTTCAGCATTTCAAGACATCTAA
ACACTACTACCAACATTTTCCTGTGCATTAACCTCTGCATGTGAAAATTTAACAGTTTAC
TGAGCTTGTAAATACATGAAATTTTTTTATTTAGGTGGCTGCATTTTTTTGTCTGTTTAC
TGCTCTCAGCTTTATTCAATAAACTTACATTTTGAGGGTTAAAAAAAAAAAGGTCTGCAG
AGTTCATCCACGCTGCAGTGGGTACGAGCACCTCTGCGGCTGCCTGAGAGTCATTGTGTG
GCTACACTGCGTTTGGTTTATCTGTCCATCTGTCGATGGAAACTTGGGGTTGCTGCCGTC
TTTGGCTTTGAGAATAATATTGTAGTGAACCCTGGTGTATAGGTGTCTGTCCCTGTCCCC
TTCATCTTCCTTGACGCGCCTTCTCCTTCCAGGCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGAAAGTGCAGCCTGCCCAGGAATGGCGCCGCCCACACTGTCCAT
GCCGCTGACAACAACAGAAGCGGACAAAGAAACAAGATGCAGCAAATAGACACAGAGAAC
AGACAACCGGGGGAGGGGGGGAATTAAATAAAAATAAATCTTTAAAAAAAAATAAAAATA
AAAATAAAGGGAGTCCTGCAGCCTGAAAGGAAAAAACAAGGACAAAATATTTAGAGAAGA
GTTTAGAAATGAAGATTATTAGGAAGGGTAAACTAAAGAGTAAGAAGAAAGACAATAGAA
CGATATGACAACAGAAAGCCAGAGACAAAATGGATGAAGTAATGCTTTTACAGTAATAAT
TAGAATGTTAATGGATTGGACTCCCCAATCAAAAGACATAGACTGGGGAAGGAGAAGTGG
CTCAAGCAATTGGATGCCTGCCTACCACATGGGAAGTCCTGGGTTTGGTTCCTGGTGCCT
CCTAAAAAAAAAAAAATGCAACGAGCACACAATGAAAGGAACACAGAAAGCAGACAGCAA
GCACAAACAATGGGGGGGGGGGGAACAGAAGAAATAAATAAATAAAATACATCTTTAAAA
AAAAGGACAAAGACAGAATGGATAAAAAACTACGAGCCATTTCTATACTGTCTGTAAGAC
ACACCTCAGACGTAAGGGTACAACTAGGTTAAAAGTGAAAGGTTGGAGAAAGTTATTCCA
CACAAATCGTAATAAAAACAGAGCTAGAGTAGTGATACTAATACTGGACAAAACAGATTT
CAAATGCAAACCAGTTAAAAGGGATGAAGATGGTCATTATATATTTATAATAGGGCCAAT
TCACCAAGAAGTAATAACTATACTAAATATACCTAAACTGAGGGCCCCAAGATACATGAG
GTACACACAGGCAAAACTAAAGGGAGAAACAGATGTCTCTACAATAGTAGTTGAAGATTC
AATATACCACTCTCAGTTTGGATAGAATATCTGGACAGAGGATAAAGAAAGAAACAGAGA
ACTTGAATAATATGATAAATGAACTAGACCTAACAGAAATCTATAGAGCATTGCATCCCA
AAACAGCAGGATATACTTTCTTTTCCAGTGCTCATGGATCCTTCTCCAAGATAGACTATA
TGCTGGGTCACAAGACAAGTCTCAATAAATTTAAAAAGATTGAAATTATACAAAACACTT
TCTCTGATCATTTCAGAATTAAGCTGGAAATGAATAATGATGGAAAAAGGGAAAATTCAT
AAATATATGGAGATGAAACAATACTCTCTTAAATAATCAGTGGGTCAAAGAAGAAATTGT
AAGAGAATTCAGCAAATTGTAAATCTTTGGAAATGAACAAAATGTTGAAAGCATATCATG
GTGTTTGTAACTAGCAGTGCTATCATATGGGTATGACAGTGGTTGAAAGGGAAAACCTAA
GATCATGTATATTACTAGAAGGAAAGCTAAAAACTGTAACACGGTACTGTATATGACAGC
AAAACCTCATGTAAACACAAATATGGGTGATATTGCATATATAACACTGTTTTTTACAAA
ATATAAATACAAATATACTAGAGTGAAGGAAAAAGAATAGCAGCTATGTATTGCAGGGGA
AGCACAGAGAGATTGAGAAGTGATGAGTTTTGTTTTTTTGTTTATTATTATTGGAATAAT
GAAAGTGTTCTAAGAATGACTGACATGATGAACACACAAATATGTGATTATACCAAATAC
CACTGATTGTACACTTTGGATGGATTTACTAATATGTACCAATAAAACTGATGTGTTAAA
AGGAAAAAAAGAGCATCTCTGGCCTCTACCCACTAAAGCCAGTAGCACCCCCTAGTGGTG
ACAAGCAAAAATGGCTCCAGACACTGCCAAATGTCCCCTGGGGCACCAAATTGCCCAAAC
TTGAGAACCACTGGTTTAAATGTAGCTTCCACTTGGGGAAAAGGAGCAAATATGGATACA
GACAGACAGAGGAGTAAGCCCACCACAGGCAAAGACTTTGTTGGGACAAGGAGAATCCAA
CTGAACTTTTAATGAGTCCGTAGGCTGTCATTAAAAGCTGAACTAGAATCTAGAACAATG
AGCTAGAATCCAGAAAATCCCCAAACTCAAAAATAAATCATTTAAGCAGGCAATTCTCCC
TCACAATAATTTTGCTAAGTGTTTGGGGTCTGGCAGAAAGCAGGAAAAGACCTTGCAGTT
ATTAAGTTCAAAGGCCCTGCTGGAGTTCAAACAAGAAGTGGACCAAACTAACTAAAGCTG
TAATACAACCCAGTTCAAATCTCATGGCCATGTGGAAAGTTTAAGGCAAAGAAGGATTTT
TTAAATCTAATTTGAAACCAAAAGTGAACTGAAACTAATGAAAGCTACGGCCCAGTCCTA
ACCCAGCTCCATGTTTGGTGGGATTTGAGTTAACGTTAGATGATTGACTGAGAAAGGGGC
AGATACTCTCAATATACTCGCAGGGAGGGGGTAATTACCTGCTTAATTCTTTACTGTTCT
TTTATATAATATGTATGGCACACAATAAAAAATTATGAAGCCAGGTGAGGAACATGCAAA
TGTGACCTATAATCATGAAAATGCACAGTCAAAAGAGAGCGAATAGGCGGTACAGATATT
ATAATCAGCAGACAAGAAGCAACTACATGTACAGAATCAGGAGGAAAAGAGAGAGAGAAT
GAATGAGAAAATGGAGAATTTCAGCAGAGAAATGAAAACTCTAAAATAGAACCAAATGGA
AATTCTACAATTGAAAACCCCAAACTGAAATACAAAGAGAAAAAAATACTGAAAAAATGT
AAACAGAGTGTTAGATCTGTGCAAAAATATCAAACAATACAGTGTTAAGTCATGTAGTAT
CAGAGAGGGAAGAACCAAAGATAGACTTGGGGAACGGTTAAAATTTTCACAAAATGGATG
AATGATATCAACCTATTTTCAGCAAACTGCAAGCAGAATAAATACAAAAAAAAAGAAATT
CCTGAGTACATCATAATAAAACTTTTGAAAACCATGGATAAATGAAAATACTGAAAAAGT
ACTCAGTGAAAAACCATATTATATTCAAGGAGACATCAATAACAAAGATGTCTGGCTTCA
CATCAGAAACCATACAAGCCACTAGACACAAAATGACATCATCAAGGACTGAATGAAAAA
AAGGTTCCAACCTAGAATTCTATATACAGCAAAAATATACTTCAAAATGAAGGTAAGAGA
AATCTGGTCCCAACCATGAAGGATAAGCTGGTACTGGACTTATTTTCTCGCTATAAACAA
CTATAAACCATAAAGCTGGATACCAGGCACAGGGTTAAAAACTTTTAGAGAAGAGAAATC
TATCAGCTGAACTTCATATTCACTCTACTTTCTCTATCTGGGTGCATTCTCCAAATCAAG
ATATAGGAAAATGGAGTCCAAATAGAGAACAGTGATCTAACCGGGCAAAGGAAAAAGGGA
TCTGGGATCAGGGATGTGAAAGTAGCTGGAATTTGTGGGTCAGGGTTCAGTAGAGAAAAA
GTCATGCAAAAGAGACCCAGAAATCTATGCAGGGATTCTACCTTGGGTCTGTAACCAATT
ATTAAGCTGTGCACACAGTGTGTGACTCTCGACAAGGTGGCTGGGGAATTGATGCTGATC
TGATATTCTAGAAATTATACCTTGGAGTGCCCCAGCCAGAGTGGGAATATCTCATTGAAC
ACCTCAAGCATTCAGCTGAGGCCTCAAGAAGTCTACATGTTTAAAGTAAAAACCACACTC
TGGAGTAGGAGTTCTCAAACTTTTAGGTCTCAGTACCCCTTATCCTCAACAATTATTGGT
GAATCCCTTGCTTGCTCATGATATTTGCAATACCAAAGAAACAGGTTTGGTATTTTTCAC
ATATATAACACTTTAGTTGAGCTACTAAGTGGTGGTTGAATACTATGGATGTGAGTGTGG
GAAGTAATTTTAGTCATGTATAATTAGCCATAAGGCCTAAATTGCAGCTACCATGGCTGT
TTTTTTTAACAATGCCTTGTTGCTTTGTGTGAATTAACATCTGGATGTAAAGATTATGTG
TATATCCAATGGGAAATCACAGTATTTAAATTGACCAACCTAATGTTACAACTAATTTGA
GGTGGCTAAATATAAACTAAAAGGGGTACAATTTTGTATAACTTAGCAACAGTAGTTCAA
TAAGTCTGAATTGACATGTAAGGGTTTGCATTATAATTACTTGCCACTTGAATGTTTTGT
GTGATGTTTAAGAATGTTAGTATATAAATATGAGTAATTTCTTTTTAAATATTAAAAAAA
AATTATTGAGGGCCCAAAGTGCTTCTGCTAATGTAGTTATATCAACTGATATTTACAATA
GTAGAAATTAAAAGTGAGAAATTTAAGTTATTTATTAATTCATTTAAAATAACAATAAAT
CATTAATTGTTGATAAACATTTTTATGAAAAGTAAGTATATTTTCAAAATCAAAAATAAT
GGGAAGAGAGGTATTTTTAAATTGTATGCAAATCTAACATCTAGCATAACAGAAGACAAC
TAGATTTTCATATCTGCTTCTGAATTCAATCTGTAGCAATATGTTACTTTGATTTAAGTA
TATGAAGGATATCCAGCTTTTCATAGACATGTGGTTAGAAAATGGCAGAGTATTTTACTA
GCCTGCTCAGATAATTATGGATATTATTCTTTAATACTGTAAAAAAACTTGAGAAGTAGT
AGTTTCTTAAAGGTTAGCTGCAATGAAGCATCTGAAACTATAAGAATGAATTTTTCATAC
TGTTACTGTGATGGTTAGGCTAATGTGTTGACTCGGCCAGGTAATTGTGCCTCGTTGTTT
GGGCAAGCAAGCACTGGGCTAGTTGTAATACAAGGACATTTATGGACTTTAGTCATCAGT
GACTTTACTGCATAGATAGCTGATTACAATTACATCAATCAGGGAGATTGCCATCAGCAA
TGAGTGATGTTCTATCCCATCAGTTAAATACCTTAAAAGGAGAAGTGATTTCAGCATTTA
GGGAGAATTTCCCAGCTCGCGTGTGGACAGTTAGTCTTCCAGAAACTCATCAAGAACCTT
CACTGGACTTTCATCACAGCCCCTGATTTGCAGCCTGCCTGCAGAACCTGGACTTGTGCA
TCCCCAGGGTCACATGAGAGACTTATAAAATATCTTACTATTGACAGATATCTCCTGTTG
ATTCTGTTTCTCTAGAGAATCCTGACTAATACAGTTACATTATAATTTATTGATCTATCT
TACACTTTGGATGGGCTGTTTACTCTTGCATAATTTTGTAACATTGGGCATTGGCCATCT
AAAAAATACTGGTTCACAGTTATACAGATCTTTGAAATGATGACATATTTCAGTACGTCA
TTATGCAACATCAAAAAATAATAACTTAATATTACCATCTATCTCATCAGAAATATCTTC
ATGTATTGGGAAGCTATAATACATTTTGTTTTCCAAAATCTTAATTTTTACCTGAAAGTT
TTAATTCTTATCATTGACAACAAGTACCCTTAGTTGTTCTTGAATTAACAGGCTTGCTTA
TGAGAAAATGTCTACCAACTACCCAAGTCTCAATAGTTTGTCTGTCAGCCATTCTTTCAA
GTAAAAAATGAAATCAAATGAAAAAAGCAACTAGCTTTATTCACAACTGAAATAACTGCA
TAAGAGGTTTCCCTCAAGACAACCATCAAACTTTTGTATAGCAGAAGAACTTAATACATA
TTTCCCATTTCATCACAAAGAATATTTTTAAAAATGCATACTCAAGGGTGAAGATTTAAT
AAAATGAATAGATTTCACTGCTTTCTTGAGACATTCATAAATGAAACTGGCATTTTTCTT
ACTGCAAGTTTGTGGCAGCAAAGAATACAGTAATTACTAATACAGCTTGATCCATGTACT
AATACACTGCCTTGATCCACGCTAAAGTGAAAAGATTTACTCACCATTGCTTATCAATGC
AAATATTACCACAGTGAAAATGGCAAATGACATCTTAGTATTGTTGTGAGAGTAGTTTTT
ACCTTGTAAAACCACTAAAAGGATCCTGGGGACTCCGGACCCCCAAGGGTATTCAGATCC
TACTCTGAGAACTGCTGCACAAGAGTAAGGACTATATCATATAATTAAGAACATAACCAA
AATATATTTGCCCTCAAAAAACCCAAAATTAATCCTCATAAAGATCACTGTGATCTGCCA
GTAAGAGTTAATAATGGTTAGGAAGATAATTAAATTCCCAAGTTGCTATAACATATCATC
TATAATGTCTAATATATAATTGAAAATTACTAGGCAAGTGAAGAAACAAGAAAATTTGAC
ACATGATCAGGAGAAAATATAGAAAATAGAAGCAAACCAAATGTAAAGTCTAGAACTGAA
AAATGAATTATATGGAATGAAACAGTCACTGGATGGGTTTAACAGCATTTGGATACAATG
AGGGGAAAATCAGTGACTTGAAGCCAGGTTAACAGACATTACCCAAATTGAAGTACACAG
AAAAAAAAAAAGATTGAAGGGAAAATATAAACAGCACCTGAGTGATTTTTAGGACAATGT
CAAGTGATCTACCATGCATGTAACTTGAGTGTCAGGAGAAGAGAGAAAGAAAAAGCAGCA
GAAAAAAAGTATTTGAAGATGGCTGGAATTTCTCCAAATTTGGTGAAAGATATCAACCCA
CAGATCAAAAGAAGGTAAGAGAACCTCAAGCATGATAAATATAAGGAATACCATATCCAA
GAATTTTATCATCATACTGTTACAGACCAAAAATAGAGAAAACTTAAAAACATAAAGGGA
ATAAAGAGTATATAAAATTAATAACAACAATAGCGTCATATCATCATACACAAGCGAGGT
CAGAAGACAATGGAATAACGTCTTTAAAGCCCACAGAATGAAAGAAAAAAGCTATCAACT
TGGAAGTCCATATTCAATGAAAACAACCTTCAAAAATAAAGATGAAATAAAAATGTTTTC
AGAAAAATTAAAGATGAGAGAATTTATTGTTAGCAGCCCCATAATCTAAGAAATGCTAAA
GTTTTTCAGGTTGAATGGACTCAGGTCAATGAGAAGGAAGAAAGAACATCAGAAGTGATA
AGTAGGAGGATAAATATAAAATACTATTTTGGTTTCCTTATTTAAATAGAAAATTTATTC
TTTAAACAAAAACAGTAATTTTGTGGGATTTATAACATGTAGAAGTAAAACATGACAAAA
AACACAAAGGTCAGGAGGCAATTAAATGGCATTTACAGGGTAGTAAAATTTTTACATTAT
ACAATACAATGGTATGATATTAATTTTAAGTAGGCTGTGATAACTTAAGAATGCATATTG
TAATCCTAAAAGTAACCACTAATCATAGAATGAAGCACAGCTAAAAATGGAATATTGAAA
AATACTTGATTAATCCAAAAGACGGCAGGAAAAGAGCAACAAAAGAACAAACAACTGGAG
GGAAAAATAAAAAAAAATAGCAAAACAGTGGACTTAAACCCAACCATACCTATATTTACA
TTAAATATATATGTAACCTTCCCATTAGAAAGCAGAAATTGTTACACTAGATATAAACCA
AAATCTATTTTTTATTACAAGAGATGCATTTTTAAATGTAAAGACATGGATAGGTTGAAA
GTAAAAGAATGAAAAAAGAATTATCTTGAAAACTGGTATGGCTATATTATTAAAAATATC
AAATTAAATATTCAAAGTCAAGGAGTATTACCAGGTCTAAACAGAGACATTTCATGATGA
GAGAGGGTCAATTCATCAAGAAAGCATAATGATTCTAAAGGGTACATGTATCCAACAGCA
GGCTTCTCCTAAAGGGAGAAACAGACAAATCCACTATCATAGTTTAAACTTTAACCCCCT
CTCAGCAATCACAGAATAAGACAGAACCCTTAGGAAGAAGTAGCCAAAGAATCAGTAAGA
ACATTGAACACTATCAACCAACTTGATAGAATTTACATTTATTGAATACTATATCCAACA
ACTGCAGAACACATTCTTTCCAAGTACATATGGAACATTCACCAAGTTAGACCAGATGAC
CATAAACTGGGGCATAAAACAAATCTCAATAAATTTCAAAAGAATGAAATCATGCAGAAG
ATGTTATCTGATAATAATAGAAATTAGAAATCAGATCGGGCAGAGGAAGGTAGCCATTCA
TAGCATGGCATGAGGGAGATACAGAAGCCCAGAGCAGGGTACTGAAAGTCAAGCAGGGTG
AGGAGGGTCCAAGTAAAGGGGTTGTCCCATGTGGACAGGCAGAACACAAGCAGGGTAAGG
ACAGGTGTCTGTGTGTGAGTGACCTGGCCCAGGTGTCACAGCCCAAGTGGGATGAGGAGG
GCAATCGTTCGATCAACGTGGTGGGGTTGGTCACAGGAGATTGGTTACTCATCGTGAGAC
TGAACAAATTAGTAAATACATTAGGGATAATGGACGCCAGGTTTTTCATAGTCAGAGAAG
AGAGTTAGAGATATAGAAAGTGAATAAACTAAATGTAACTTGTACTGTTGGATTAGAATT
GGAAACATCCATGTGAACTCATGGTTCAATACATACAAATATAGAATTATACATAAACAC
ACACACACACATACACACATATAAATGTGTATGTATATGAGAATATTCCTTAGCTCTGTC
CACTAAGAGGGCCTGGGAGCAGCAATCTCCACCACAGCAACAATGAGCAAACCTAGTATC
TATATCTTGGTATCTAACTACCATTCTCCATTAAAAAGAATCAGGGCACCTTGGAGAAAC
AGCTAATTTTAGGACTAGAGGAGAGAAAGTACAAGATGAGCCTGGAATATCTTGTCAGAA
AACAAGGAGGGGGAAGTGGATGTGGCTCAAGTGATAAGGCCTCCACTTACCAAATGGGAG
GACCCGGGTTTGATCCCACGTGCCCACGTGGCAAGCCAAGTGCCCACATGGTGTGCCAAG
TACTCACGCAAGTGCCCATGTGGTGAGCCAAGTGCCCAAGTGGCAAGCCAAGCGCCCGCA
TGGCGAGCTGAGTGCCCACATGAGTGCCCACGTGGTTAGCCAGTGCCTGCGCAGTGAGCC
AGTGCCCTCGTGGTGAGCTGAGTGCCTATGTGGTAAGCCAAGCGCCTGCACAGCAAGCCA
AGTGCCCATGCAGTGAGCCAGTGCCCATGCAAGTGAGTCACACAGGAAGATGATGATGCA
ACAAAAGAGAGACGAAGGGGAAAGTCAAGGTAAAGCACAGCAGAGACCAGGAACTGAGAT
GGCACAATTGACAGGGAACCTCTCTCCACATCAGAGGTCTCCAGGATCGAATTTCCTCTG
AATCCTGGAGGAGAAAGATGAGAAGACAAAAAGAGAAATAGATACAGAAGATCACACAGT
GGGGCAGGGGAGGGGAAGGGGAAAAAATAAATGAAAATATTTTAAAAAAAGAAAACAAGG
AGGTGTCCAAGAAGTTATGGGGACATGCCAGAAGGACACAAAAGTCACTATGAAGGGGAT
CTCACTGGCAAAATCTGGGACATGAAAATATTTCAAGCATCAAAATAAATAATGAGAAGA
GCTGATGACAACCCACTGAACAGAATTCCAATATATGAATAAGTTGAAAGTTTGAAGAGG
AATGTGCTACTTAATAGTCTCAAAATTCCTCCCCACAAAATACTTACTAAAGATAAAAAA
AAAAGAGTAATTTTACAGTGAAGAAGCCTGGCAGCAACTACCATAATGTAGGGATCAAAC
TGAGTATAGTCAGTAATGATATTACATCACAGAATACAAGGACACAGCATCGATTCTGTG
CTAGTCCTGCCAAAGATCCACAATCTAAATCTAATCATGAGGAAACAGCCAAAGTGAATG
ACACTGTACAAAATAACTGACCAATAATCTTCAAAAGCATCAAAGACATGAAAGTTAAGG
AAAGACTCATGAATTCTTTCAGACTGAAAGAGGCTAAACAATCCAAATTTTTTTAAAAAG
CTAATACATAACTGTATACATCTGGCCCTTGCCTATCTCCCTGACCTAATTCCTTAGTAC
ATGCTCCTTTACTTAACTCTGCCCTGGCCTCCTCACATTTCCTCCAATAGCACTCCTTTC
CAACCACAAGGCCTTTGCATTTGCTCTTCACTGTGATTCACATACTACTCCCCCAGGTAT
TCACACAGCTTGATCCCAAATTCTACATCTCTGTTCAAGAAAGCCTTCTCTGGCCATCTT
TCCTAAATTAGCCTTGTCAATCTCCATGTTTTTCTACTCCATTAAGCTGCTTATCTTTCC
TGCAAAACATGTTTCAATCATGAGATTGTTTATCCACTTACTTATTTTGTTTCTCCCCTA
TAACAACATAAACATCACAAGAATGAGCAAGTTAGCAATCTTGTTCATGATTGTATTGCT
ACTGTCCAGCACAGTGCTTCACTAAAAGTAGGCACTTGATACATATTTGCAGAATATGTC
GATGAATAATGTAGATTTGTGTGTGTGTATATGTCTGTCTTTCTGCCAAAGAAGGGCTAG
AAAGCAGATGAATCCAAAATATAGGTAAAATGGTTGCACTGGAAAAGAAAGAGGACACCA
TCTTACTGAAATGAGCGGGAAATATGAGAAGAAAAGTAAGGAGAATGTTAAATGGAATCA
AGAAGTTCCTTCAGTAGCTCAAACTGAAACCTCCATTTCCTCCCAGGTGTCAGGCCTTCA
ACTCTCTGTAACCACTCCACCCCCAGCCTTGGTCTCCAGGGGTTCCTCCTCCTCCTCTGC
CACTCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAATAAGATCAAGGAAAAAGGGAAAACAGCAACTTTAGAAAGGT
AAAAGAACATTACTATAGTTTTAAATAGGCTTTAAATATAAGAGAAAATCACGTGTACAA
ACCTGGGAAATTTTTGTTGATGAATACAGAAGGCAATACTTTTGGAATGAGAACTCTGAT
GTTCTGTACTTAACTGCTCCCTTATATGGTATTTACAGGTTATTTGTTGGCCCAGTCTTA
GTAAAAATAGTCAGTAGCCCAGCCTGCATGACATTGGGAAGGATTATCCGGAGGATTAAA
AGCCTTGCTGAGGGAAGCAGATTTGGCCCAATCAATAGGGAGTCCGCCTACCACATGGGA
GGTCCAAGGTTCAAACCCAGGGCCTCCTGACCCATGTGATGAGCTGGCCCATGCACAGTG
CTGATGTGTGCAAGGAGTGCCATGCCACGCAGGGGTGTCCCCCGCATAGGGGAGCCCCAT
GTGCAAGGAGTGTGCCCCGTATGGAGAGCCGCCTGGCGTGAAAAAAGTGTCACACACATG
GACAGCTGATGCAGCAAGATAACGCAACAAAAAGAGACAGATTTCCCATGCCATTGACAA
GAATACAAGTGGACAAGGAGGAATGCACAGCAAATGGACACAGAAAGCAGACAACTGGGG
GGTAGGGGGAAGGGGAGAGAAATAAAAAATCTTAAAAAAAAAAAAAAAGCCTTGCTGAGT
TGAGAAAATGATGAAAACTGATGTAGGACTACCAACTGTCCTCAAAAACTCATTCCTCTC
CTCTACCAAACCCTCAGGAATAGCAGATTACAGAAGAAATCTTCCCACCCATGCCTGTTT
CTTTCTTAGTTTTTAAAGTGGAATCACTGGTAAGAGTAGTTTTCCGAAGGAGTGGCAATA
AATGTAGTCATATATAGTGGTTCTATAGAACCTAAACTCTCCACCCTATAGCTCTTCCCC
TCTCCTTTCCATACATTCAACAAAAACACAAACTAGAGCCTCATTTTGATCTTTGCATAA
TATAGATCACTAGTCGGGGATGGAGAATACAAGCACACAAGCCAAAAGAGCTAGCATAAT
GATGAGCAACCACTGTAATAGAGAATGAACAGAACAGAATATTAATATTACTGGAATCTA
CAAAATTATAAGATTTTATAATTAGCAATATAAATAACCTCAAATAAGATATTGGTGAAA
TAAATTAGGAACAAGATGTAAAAGTAAAACCAGGGCTAAAACTAGGATGCTTTAATTTGC
TAAAGCTGCTGGGAGCAAAATACCAGAACAGGTTGGCTTTTATAGTGGAAATTTATTTGG
GGTAAAAGCTTACATTTCTAAAGTGAGAAAAGTCTGAATCAGGTCATCACTGGGGATGCT
TTCTCACCAAAGGTCAGCTGCTGACAGATCCTTGACTCCTGCCACATGGCAAGCAAAATG
GAGGCTAGTCTGCTGAGATTCCTGCCTTCCCCTCCAGGCTCACTTTCTCCCTGAGCTCGC
TGTGGACAGTTAGGTACGGTTCATCTTTTCCTTCTTGCTTCGGGTTGATGTACTCTGTTC
CAGTTTCTGGCCTTCTCTCAGCCTCTTAGGGTTTCTCTGTCTTTCTGCAGCTGTAGGAGA
TCCTTGGGTCCTTTCTCACGTGGCAGGGTGAAAATGGCAGCTGCCTTTCTGTGTCTTTCT
GCATATTTCTTCTTTCAGTTCTCAGTTTATGTAAGACTTCAGTGAGAGGATTAGCATCAC
CCTGAGCCCCCATGATCTAATCAAAGGTCGGTAACTAAGATGAGCTAATCAAAAGTGACT
CTTAATTGAATCTAAGCAAAAGTTCCTACATATAATAAACTTATACATACAGGAATGGGT
TAGCTTACAAACATAATTTTTTTGCGTTCCACAAAAGACTCAAACCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGATCATGATGAAAATTGTTTCAGAATTAAGTAAAGATTAAATGACCT
CTTAGTGCAACTCCATAGAAAATGTCAAATATGATGAATTAGCAAGAAAGCACATAAACA
TACTAAGGCAAAATATAAGAACACCAAAGCCAAAGTGAAAATTCAAAAATTTTCCAGGAA
AAAAAAAGTTGAGCTACAAAAGAAGAAATCACAATGAACATCATTGCTCAAGAACATTGA
TGGAAAACTACAAAACATTGCTAAAAGAAATCAAAGGGGACCTAAATAAATGGAAGGAAA
TTCCATCTTGTGGATTGGAAGATTAAATATTGTCAAGATGTCAGTTCTACCCAAAGTAAC
TTACAGAGTCAATGCAATCCCAATAAAAATTCCAACAGCCTTTTTGAAGAAATGGAAAAG
CCAATCATCAAATTTATATGGAGGGTAAGGGGTCCCAAATAGCCAAAACCATCTTCAAAA
AGAAAAATGATGACCATGTGATGCAGCAGTGCTCAGAGATGTATTCACCAAGCACAGTGA
ATGTCCCATGATGATGGAGGAGGTTGTTATTATGGGAGGAGTGGGGGTGAAGGGGTGGGG
GTATATGGGTACCTCATTTTTTTTAATGTAACATTAAAAAAAGACAAAAAATAAAAAATG
AAAGTTATAATCAATTTTAGTAAATTATATCCATACTGGTAAAATATTAAAAGCATTATT
CTGAAAGTCAAAACAAGGAAATAATATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTC
GACCCGTGTGGAGCTGGCCATGCGCAGTGCTGATGCGCGCAAGGAGAGCCGTGCCACGCA
AGGGTGTCCCCCGCGTGGGGGAGCCCCCACGCGCAAGGAGTGCGCCCATGAGGAAAGCCG
CCCAGCGTGAAAAGAAAGTGCAGCCTGCCCAGGAATGGCGCCGCCCACACTTCCCGTGCC
GCTGACGACAACAGAAGCGGACAAAGAAGCAGACAAAGAAACTAGACGCAACAAATAGAC
ACCGAGAACAGACAACCAGGGGAGGGGGGGAAATTAAATAAATAAATAAATCTTTAAAAA
AAAACAACAACAAGGAAATAACTCTCAATATTATATTAAATTTTGCCTTAAAAGTTCTAA
CTAGTGTCATGAGGGAATAAAAATAATGAAATCTGAAAATCAATTTTAGTGAGATACACT
TTACATGCAATAAAATGTATCAATTTTAAGTGTATAGTTGACAAATTTATACACCACTAC
AATCAAGGTTTAGAATATTTTCTTTACCCCAAAATATTCCTTTGTGATTTAGGCAACCAC
AGATCTGTTCTTGTCACTCTAAAATGAAGTTTGGTTTCTCTAGATTTTCAAAATAAATCA
AACAGTTAAAAAAAAAAAAAGAATGACTTGGAAGGACTCAACTTCCCAATTATAAAACTT
AATATGAAGCTGTAGTGATCAAAACAGCAAGATTCTGGCACAAGGAAAAACTTATAGATC
AATGGAATCAAATTGAGAGTTCAGAAACGATCCTTACATCTATGACCAATTGATTTTTTT
TTTTTAGATACTGGGGCCAGGGATTGAACCTGGCACCTCATAAGTGGGAAACCAGTGCTC
AACCATTGAGCCACATTCAGCTTCCCTGAGTTGGTTTTTTCATTTGCTTGTTTGGGTTTT
TTGTTGTTTTTTTGTTTTGTTTTGTTTTGTTTTTAGGAGGCACGTGGGAACCAAACCCAG
GACCCCCCATGTAGGAAGTAGGCACTCAACTGCTTGAGCCACATCCACTCCTCCCCAGTC
TATTCAATAGTGAAAGAATAGTCTTGTCAAAAATTGGTACTGATTGGGAAGCAGATGTGA
CTCAAGCAATTGAGCTCCCACCTACCACATGGGAGGTTTCAGGTTTGGTTCCCAGTGTCT
CCTGGAGAAGATGAGCAAGACAGCAAGTTGACACAATGGGCAGGCACAGCGAGCTGATGC
AACAAGATAATGCAACAAAAGACATGAGGAGGGAAGCAGACTTGGCCCAATGGATAGGGC
ATCTGCCTACCACATGGGAGGTCTGCAGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGA
GCTGGCCCATGTGCAGTGCTGATGCACGCAAGGAGTGCTGTGCCACACAGGCTTGTCCCC
TGTATAGAGGAGTCCCATGCACAAGGAGTGTGCCGCGTAGGGAGAGCCACCCAGTACGAA
AGAAAGAGCAACCTGCCCAGGAATGGCGCCACACGTGGAGAGCTGACATAAGATGACACA
ACAAAAAGAAAACACAAGATTCCCGGTGCCACTGATAAGGATAGAAGCGGTCACAGAACA
CACAGCGAATGGACACAGAGCAGACAATGGGGAGGGGGAAGGGGATGAAATAAATTTTAA
AATCTTAAAAAAAAAAGACATGAGGAAAACATATTCACAAGAAAGCAGGGAGTGGAGGTG
GCTCAGGTAGTTAAGCGCTTCCACATTGAAAGTCTTGGGTTTGGTTCCCAGTGCCTCCTG
AAAAGAAGACCAGCACAGAACAAACAGACACAGCAAATGCAAACAATTAGAGTGGGAAGA
AATAAATAAAATCTTTTTTAAAAAATTGTGCTGGTAAAACCAGATGTCCACATGCAAAAG
AATGAAACTGTACCCCTACCTTCAACTCAAAATGGATTAAAGACCTAAATAAAAGCCAGA
AATATAAAACTCCTGGAAAAAAAATGTAGGGAAGCATCTTCAGGACCTCGTGTTAGACAA
TGGTTTCTTAGACTTTACACCAAAAGCATGAGCAACAAAATAAAAAATGGATTAATGGGA
CCTCATCAACATAAAAACTTTTGTGCATTAAAAGACTTCATCCTGAAAGTAAATGACAAC
CTACACAATGGGAGAAATCATTAATATTTGGGAAGCATATCTGATAAAGGTTTAATATCT
GGAATATATAAAGAAAAACTTCAACTGAACAAAAAGCCAAAAAAAAAATTTTTTAATGGG
CAAAAGACGTGAATAGATATTTCTTGAAAGAAGATATGCAAATGACCAAAAAGCACATGA
AAAGATGCTCAGCATCATTAGCCACTAGGGAAATGCAAATCAAAATGACCATGAGATACC
ACTTTGCACCCACTAGAGTGGCTACTATTTTTAAAAAACTAAAAATAACAAGGGTTGAAG
AGGATGTGGAGAAATAGGAACACTTATTCATTGTTGGTGGGGATATATTAATAAAATGGT
GCAGCTGCTGTGGAAAATAGTTTGGTGGCTCCTCAGAAAGTTAAGTATTATATAACCTGC
CAATCCTATTTCTAGGTATATACTGAAAGAATTGAAAGCAGGGATTTGAACAGACATTTA
CATACTGATGTTCATTGCATCATTATTCACAATTGCCAAAAGATGGAAGTAACTCAAGTG
TTCATCACAGATAAATGGGAATTGTGGTATATACATATAATGGAATATTATTTAGCCATG
AAAAGAAACAAAGTTCCGATACATGTGACATAATGAATGAACCTTGATGACATTGTGAAT
GTAATAAGCTAGATAGAAAAGGACAAATATTGTATGCCCTCACTGATACAAAAAAAATTA
GAATAAGCAAATTCATAGAGTCAGAAGCTAGCATACAATGACTACCAAGGGCCGGAGAGG
GCAGGTAGGGAATGGGGAATTAATTCTTGATTGGTGTAAAGTTCCTGTTTGGAGTGATAG
AAAAGTTTTGGTAATGGTAACACAACATTGTGGATGTAATTAATACCACTGAATTATATA
TCTGAATGTGGTTGAAAGGGGAAATTTTAGGGGGTATATATTTTACTAGAACAAAAAAAA
AATTTTTCTTAATCAGGACTTGTGACAGTTTGAATTTGGTGAGTCCCAGAAAAGATTATG
TTCTGGCACTAATACATTCCTGTGGGTGTGGGGCCCTTTGATTGGACTGTGTTGGTGAGG
CATGACCCAGGTTGTGTTTCCACCCTCTTGCTGGGATCTTCTATAAACTGAGAACTGAAA
GCAGAGACACAAAGAAAGAGTCACCATTTGGCCTTGTCATGTGAGAGGAAGGGAAATCCT
GGAGGCTGAGAGAGAGAGGCCAGAGACTGGAATCAGTGGAAAGGCTGAAAGAGACAGGCC
CTGGAAGACACAAGTCATTTGCCCAATTGCCCAGAGCTGAGCTCGGACAGAAAGCAGGAC
AGTCTAAGTTAAGAGAAGAGGCTTGGAAAGGGCAAGCCCTATGCCTGAAAACCTACAGCT
GAGCTCTGGGAGATGGTGGGCCTGGAGGGGAAGGCAGGAACCTCAGCAGAGATTAGCTGC
CGTCATCTCGCCTTACCACATGACAGGAAACCAGGATCAACAGACTTTGGTGAGAAGGCA
TCTGTAGCAGTTTGATATTGTTTATGAAGGAGGATGCCCTGTGGGTTTATGGAACTGTAG
AGGACTCATGACTCATATTTCCCTCCCAGTTTCTCCTTATTTTAATGAAAATATTTTTCC
TTTGACCATTTGTGTATTGGAAGCAGATAAATTGTTCTGTAAGTTTCAGAAGTCTACAGC
CAGATGGGACTTTGCCTCAAGACAAACTGTATTTCTTTAAACTGATTGAGATATGATTCT
GTATTTAGCATTGTACTGATTTAAGGGTTTTGGTTTTTTTAAATATTTTATTGTCTTTTT
GGAATTCAGAGAGTGGAGTGTAGCAGTTTGATATCGTTTACGAATTCCAGAAATAGATAC
TGGATTATGTTTCTAAACTGGTTTGTTCCTCTAGGCATATTAGATTATATTGGATTCAGA
GGTTTCACTTCTATAATGATTGAGGCTTTGATTGGGCCACCAAGGGGGAGGGGACTCCCA
GTGAAACCACACCACAGAGAAGGGAGTTTGGATTTTTTATCTTGGAGCATGGGAAGTAAA
CACCTAGAGAAGCAGATGTATGAGGAAGAAGAGAGGGCTCGATTGGATACAGCAGAGGGC
CAGGGAAGAGAGGCACCCAGGAAGCCTGAACCCTTGCAGACATTGGCAGCCATCTTGCTC
CAACACGTAGCAACAGACTTTGCTGAGGGAAGTAACTTATGCTTTATGGCCCAGTAACTG
TGGGCTTCTACCAAAAAAAAAGAAAAAAAGCCCTTTATAAAAGCCAACAGATTTCTGATA
TTTTGCATCAGCACCCCTTTGACTGACTAATACAGTATCACTGATGATGCCTTCATTTGG
GCATTCCATGGCCTCAGAACTGTAAGATTTTTCCCAAATAAATTCCCTTTATAAAAGCTA
ACACATTTCTGGTATATTGCATTGGCAGTCCTGTGGCAAACTAAGATAGGACTGCACAGC
ACAGTGAAGCCTAATGGAAAATATGGACTATAGTTAACAGTGCAATTATAATAATATTCT
CTCATCAATTGTAAAATAAAAGAAACCACACTAGTACAAAATGTTAATAATGATAATGTT
AATAATGGGGGCAGATGCCAGCAGATGCTTCTACCCATGGTGGACTCACAGCTGCCCATG
GTGAACTTTGGCTCCCTGCCTCCAGCACCGCCTCCTGCCCCACCCCCCCCTCTCTGTTAC
CTGTGGGCCCTGCTCTGCAGCCCCCCAGCCTGGCAGTGCGACCCCCACCTGCTGCTGCTA
CTCGGGTGCTGCCTTCACCCGCCAGGCCCTTCCCCCCTAGCTTGGGGCGAGCAGAGTTGC
ACCCGGTGGAACTAAAGCCGTTCCAGGATTATCGAAAACTGAGCAGCAACCTTGGGGGGC
CTGGGTCATCGCGTACTCCCCCAGCTGGAAGGTCCTTGTCTGGCCTCAGTTCTCGTCTCA
AGGCCCCACCTTCCACCTATGGCGGAGTCTTCCATCCTCAGCGCATTGACCTCTGCCAAC
AGGTGAAGGAGAAATCCCTGTGGCCCCAAGTCTAAATCCAAGAGTTGCTGCCTGAAGTTG
TTTGCCCCGAGTCCTCCATCCCCGTTCTTCTGATATGACTTACTCTTTGGCATGTACCTG
CCACCAGGCCTCCCCACCAGATGCTCTGCGCTGTATACCGAAGCCTTGGGAGTGGGCAGG
GCCACCCTCTCGAGAAGGATCCTCTCGACGGGCAGAGGAGCCTGGATCCCGAGGGGACAA
GGAACCTGGGCTGCCCCCGCCCCGCTGAGGGAGATCCCTTGCCCCCTCCCCCGGGGCTTG
TATATAGACTATAAATATATAAGGGGGAAAGGGGTGGGTAGGGAGGGGTTGTGGGGCTGG
GGCCTTGCTTCCCCTCCTCTCCCTTCTCCTGGTCCCCTCTCCCTGGGGCCGTTTGTTAAA
AAATAATAATAAAAGGATAAAAAAAAAAAATGGGGGCAGATGGGAACTGTATTTTCTGCA
TGATCCTTCCGTAAACCTATTTCTCTAAAGTAAATGAATGAATGTATGAATGAATAAAAA
AAGAAAAACAGCAATGACACCAAAAAACCCTCAAAGGATTAATTTTTTAAAAATTAAAGA
GCAAGTGTGAAATATAGAATCTTATGTCTAAACAAAATTTTATTTTAAATAGGAGTGGAA
CATAATATATTTTTCAGGCAGGTATTTTTTCAGAGTTCACCTCACAAAATTCACTTTCAA
AATCTTGGTGAGGGAAGCAGTGATTGGGCTCCTGTCTACCATATGGGAGCCCAGGGTTTG
ATTCCCAGGGCCTCCTGGTGAAGGCAAGCTGGCCTGAATGGAGAGCTGGCCCATGTAGTG
TGCTGGCCCATGTGGAATGCTGGCCCACATGAGAGCTGGCACAGCAAGATGATGCAACAA
AAAGAGACCCAGAAGAAAGACAAGACACAGCAGACCAGGGAGCTGAGGTGGCGCAAGAGA
GTGAGCGCCTCTTTCCTACTCCAAAACGTCCCAGGATCATTTCCGAGTGCTGCCTAGAGA
AAAGACAAGCGGACACAGAAGAACATGCAGCAGATGGACACAGAGAGCAAGCAGTGCGAA
ACAATGAGGAGGAGGGAAAAATAAATCTTTAAAAAAAACCTTGGTGAAAGTATTCAATAA
TAAAAGAACAAAAAATCCAGGACATGCTTTAAGAAATACATAAATTTGGATATTAATGTA
TATTTAGAAGTAAAATACATCAAAACAATGGCATATGGAACTAGAGGGAGTAAATGGAAT
TTTGTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1626..1803, 2954..3053, 3154..3226, 3327..3470, 3571..3722, 3823..3902, 4003..4145, 5526..5616, 5717..5933, 6187..6661, 6762..6952, 48207..48507, 48847..48857, 48859..48938, 48940..49059, 49269..49788, 49791..49802, 49807..49815, 49818..50121, 50288..51290, 51653..51924, 52086..52152, 52154..52195, 52276..52297, 52526..52655, 52765..52850, 53053..53286, 53445..53585, 53703..53777, 54795..54962, 55063..55145, 55246..55456, 55557..55655, 92124..92210, 92213..92521, 92647..92787
1001..1112, 1626..1803, 2954..3053, 3154..3226, 3327..3470, 3571..3722, 3823..3902, 4003..4145, 5526..5616, 5717..5933, 6187..6661, 6762..6952, 48207..48507, 48847..48857, 48859..48938, 48940..49059, 49269..49788, 49791..49802, 49807..49815, 49818..50121, 50288..51290, 51653..51924, 52086..52152, 52154..52195, 52276..52297, 52526..52655, 52765..52850, 53053..53286, 53445..53585, 53703..53777, 54795..54962, 55063..55145, 55246..55456, 55557..55655, 92124..92210, 92213..92521, 92647..92784
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved