Dasypus_novemcinctus Locus SLC26A4
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SLC26A4
Dasypus_novemcinctus
SLC26A4
GeneScaffold_1023
SNORA26
9584..9705
41131
CTTACTGCTCGAGTTAGTAATTACGCGGTGAGGGAGAATCCGGTGGCTCTTGCGTGATC
TCCAAAAGCCTCGGTTTCCCGGGTTCGGGAAAGGGAAAGAACGAGGAACGCGTATGATTT
CTTTCTCGGTAGCGCAGGTGGGGAAAGATCGCTGCTCCTCTCTTCCTCCCTTTCGGTCAA
GGTGTCTCTATTGCTCCATAAATAAAACGTCTCACTGCCTTCTGCGAGCGCTATAAAGGC
AGCAGAACAGCTGTCCCGACGACATTCCGAGCGGGACACACGTCGAAGCAGGTGAGTTCG
CAGCTGAAGATGCAAAACCTGCCCTGGCCTAACTCTCGGGGAGGCATCGATGTTGGGACG
GGGCTAGTGAGAGGACACAGAGCGGGCGGGCAGGGACGGGACAGGTTTCTTTCTGAGAAG
CTGAGAGAAAGAGGCCCGGGGAAGAGACTTGAAAGTTCTGCCCCCAGGAGAGCTGCGCGC
AGCTCGAGTGCTGGCAGCCCGGGGATCCCGCGAGGGCGCCCGAGGCTCCCCCGTTCTGCC
CGGGACCTGCGCTTCGCTGAGAGGCGCTGCTGGGGCTGCGCCCTGGGTCCCGCGACGTGC
GGGTACAGAGTGACGCTCAGCGCCAGCTTCCCGCCTTGCGCGCGGGGGACCCCTGCCCCT
GGGCTGTTTGGGGGAGATTTCTGGAAGCGGACAGAGTCCGGGTCACCCGCCGGAGGGTAC
GCCGCAAAAGAAACTCACTGGCTACAGAGTCGGGAAGCGCGTGGCGGCAGGTGCAGCCAC
GCGGCCCGAAGGTCCTCGGGTGCCCCCCTGCTGTCTGGCCGAGCGCGTCCTAGGGGCGGC
GTGCGGGGAGCGCAGAGCGCGACTGGGGGCGACCGGGGTTCACAGGGTCTGCTGCCGCTG
GCGGGGTCCGGGTTGTCGCCTCTTCCTGCTCCTCCCCCTTCACCTCCTCTTCTCTTGCCT
CTCTCCATCTCCTCTCCGTGTTGCCCTCCGCTGCGCCAGCCATGGCCGCGCCAGGCGGCA
GATTGCAGCCGCCCCAGCTCCCCGAGTGCACCTACAGCTACGTGGTGTCGCGGCCGGTCT
ACAGCGAGCTCGCCTTCCAGCAGCAGCACGAGCGTCGCCTGCAGGAGCGCAGGACGCTGC
GGGAACGCCTGGCCCAGAGCTGCAGGTAGCCGCCTCTGCTCCGCACCGGGGGAATGCAGG
GGGCGTCCAGGGCGCCCGGCTGGGAGGACTTGCCTGAGGCGAACTCTGGGAGGCAGCGCG
CTGGGGGCCCGGCCCACCCGCTTGCTTCTCGCGAAGGGTTTCCCAAAGGGTTTCCCGTCC
GAAATTAGTTCTTTAGGGTGAGACAGATTCCTTCATTCTCCAGCCTAAAGTTGACTCTCA
GAAACTCGCCTTTGGGGAGAGTATATACTGGACGCCCCGTCCTCTATTTCCTTTCTTAAG
GAACTCTGAAGTGTGTCTTGGGACACAGCAGATTCCTACAGCCTTCTTGTGAAGGCCAAA
CTGAGCATAGAATGGAGGAAGAGGACTTCTTTGAAGAGATGATGGGTAAACCCATCCGCG
ACCAGGAGTCCTTGAAACCCGGAACTAACCTAGCAAGATAACATTCAGTTAGAGAAATGG
AATGAAGGCTAGAAAACAGCAAAGAGTTCTTCTGAGGCAGTGGGGCCCCTAGGGGAACCA
CTATCAGTCCCTAAATCCAAATGTGCCACCCGTAATTAGAGATCACAAACATAAGGAACT
TGGAGTACTAGTCAACGGCTGCCAGATTTTCATTCTTTCTTATAAAAAAAAATCTTTGTG
TCATGGAACATTGCAAACATTTATGAAGGTAGACATAGTAATAAAATGAACCCCACCCCA
TGACTTTGCCCATCACCTAGTTTTAACAAAGATCATCTCAAAGTTAATCTTGTCTCATTT
ATCCCCACCCATTTGCCCTCTTCCCCTATTATTTTGATGCAGATCCCACATATTGTATCT
TTTCCACCAGTACATATTTCAGTATGTGTTTATAAGGATTCTATTTTTTACAAAATGAAA
CCACAATCTTTTTTTGCATCTGAAAAAAAGAAGTCCTTACTATCACCAGATATTCAGTCA
TCATTCAAATGTCCAATTGTCATCATTTAAAAAAATAGTTTATTTGAATCAGGAGCCAAA
TAAGTTTCAGCCACTGTTGATGTGTTTTCTTTGTCTCTTTTGTCTACGGGTTGCTGAATT
TAAAAAAAACAACAATTAAGTAGCAAGGTACAAGGTATACATTCATCATGTTCAGATTTT
TGTAGAAACTGGCTCCAAGCATTGATGCCAAAATATACAGAGCTTGTTTATTTTTTCATA
TGAAGAAGAAGAAGAAGAAGGCGCCTGAGTTAGAAGTCTGAAAATTAATCTCCATTCACA
GACCCAACATTGATTAGTCAGTGGCTGGACCAGAAAATAAGTTCTTGTGTAGGGATATTT
GTTCAGAGGATTAAAAATGTGGGAGTGGGTAGTGGACACTTAATCCTGTGTTTTCTAGTA
CGGTACGTTTTAAAGCACAGTTGCAGTTCTCGGCAAAGGTGTCTTAAGCACCTCAGTGTT
AGTGTTTTCCATGTAATTTTTCTATCTTGTTATAAACATCAGAAGAATTCAGTTCATAAC
TTTATTATTTGCAATTGGTTGTGATGCGGATTGCACTGGAAACCCACTTTTCTTGCTTTT
TGACAGTTGTTCAAGAAAGAGAGCCCTCCCGTGTAGTGAAAAACTCTCCTGCCAGTCCTG
GAGTGGCTCCCCAAAATACCGAGTCAAAGGAATGGCTGCTTAGTGACATCATTTCAGGAG
TTAGTACTGGCCTAGTGGGTACGCTGCAAGGTAAGATGATGGTGAGTTGGCTCCCTAGTG
ATTGAGAGTCCCAGTTTCCAGCAGCAGTTCATATCCCCCAGCTACTACAGCTCTGCCCCA
AATGCTTCCTTATCCTCCAAGGCCATCATCTTTCCTCTAGAGCACCTTAGCGGAGATGTT
CACCTCTTTTCTCCTCTTCCTTAGAGTTCCCTTCTTAGGAAACCCTGATGCTCCTCTAGC
TGCTTGGCTCCAGCTAGAGGCAAATCATGTCAACTGTGGTTTCCCAACTTTTATTGACCA
CATCTCACAGTAAAATGTGACGTGTTACATCATGACTCATACACACTTAATCCTCACTAC
AAGTGATGCACTGTGATAGTCTATTCTATTGTTTTTTTAAAATGTTGAATGTAGCCCATT
AAGGTATTTTACATCACACATGTGGGTCTTTTTTCAAGTACAAGTTTTAGGTAACATATC
TACATCATAAATTTTCCCATTTTCATACATGGGTCTTGTCCTGCAGTTTGAAACTGGCTT
AAAGGAAAGTAAAGAAACTATCTTGGCCTAGATTACCCTTGAGTGTCTTTCCTGCCTTCC
TATATCTTTTAAAAAATTTAGTTACATCCCTCCCCTTTCTTAATATCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTTCAATAGTCTTATTTGCATGTAATCTTGAAGAA
GTACCCATTTGTGCAAACCGTTGAACAGTATGTGTATAGATAAAGTTTAAGCCATTTATT
TAAAAACAGGACCCAATGCTCTCTCTTCTTTTCCATTTTCTTAAAACATGGCAGTGCATG
TACAATTAACAACAGACTCCTGATTTAAACTGGTATGTATAGTAACAATGCCCCATAAAT
CCAAATTCCATTAATTGATTCAGGGAACTTATTTTTGCTGCCCTAAATTACCCTTCCTGA
CCCTATAGAGAGCTTTCCTGCCTGTTCTCCATCTCCTGGGAATGGATCCATAGCCTCGGC
CCTTGGGTTTAACCAAGGTTACTTTTCTGACAGACCCTTGCTGAGCTTGGTCACCTAATT
ACCCTGCCTGGCCCCAAGAATTACAAGTTCCTCCATGAAGGCAGTGACCCCATTTGTCTT
GTTTGGTTGTTTCCCTAGTACAGGACCTAGCCCATAATCAGAAAAAAATATTTTAAAGGA
ACAAATGCCTAAGCATATGTCATTATAAAGCCACAGAAAGGCCTTTGTTTCCTGATCTCA
CTTGGTAGCACAAACACAATTCTGATGACATTAACAAACTTGAAAAAGAGAATGGGGTGG
AGAGAAGTGGAAAGAGTAAGGAAAGTAGTGCTGAAGTGGTTGAGGTGAGTACAAGAAAAG
GAAAAGAAACAAAGAGAAAGATTGTGATATCTTACCCTTTCATCTCCTCCCCCCTACAAA
CTTTCAATAAAGGGGTAAAAGCAAAGCTACTGGTGGCAACTTCCTTTTATCCTTTCGAGG
GTCAGGACCGTATGTTAGAATTGCCGTGTCCTCAATAACAGTGTCCCACTGGACAGCCAT
AAACTGTGACTCTGCACCTTGCTCTCTCACTCCCTTTCCTGACAAAATGTTCAGTTTCCC
CCATGTCCAGACAGTATGCTGCTACGATTCCCCCAAACCAAAAAGCCCTAAGTCACTAAG
CTTTTTCTTAACCAACAGACTCTAACAGGGCCACCCACAACATGCCTTTCTTCTCAGGCA
ACTGATCTTTATCCTGCAGCCCACAACATGTCCAGTTGCTGACTCATCACAGTCTAGGTT
TTTCTTTTATCTCATCTGTCATCATTTCCACCTCATAACAAGACGGCCTACTTTCTTCTC
TAAGTTTTAGTCACTGCTATCTCTCCTGCCTCAACTCTGAGCACACCAGTGGCCAGTTCT
CTCCTTACCAGTGCTAGAGGTCTCTTTGTCATCATGTTTGTTACCACTGTTTTTAAAGTG
TTGTGTGCTTTGCAGTTGTACTTGGAAGTGTGGCACAATGGAAATAGCAGGGACAAGGCC
AACAAAACCACAGAGGGTTTTTTCTAGTTGTTTTCCAAGGGCCACATTTCCCCTTTGGCT
AGAGTGGCGGTGCATTTTCCAAACAATCAGGGCCAACCTGAAGTAAAAATGTGCAGTTCC
CATTATGTTTATCATTCTTGCCTCTCCTTTATGGGGCCTCTGATCTTTCAGGGGCTCACC
TAGCCCTGTCCTCATCTTTTCAGGTAAATGCATGTTCACATTCTTACTGCATCACAGGAT
CTTGGTAGTGTTATCTCATGATCTGGCCAGAGTGTGAAAGCTGGCTACAGCCAAACAGGG
CCACTGAGTGAGAATTTGGTAAGAGTTATGTCCACTGAAGGAGTGCAGGAGAAAGGGGAA
AGGACCACATAAAGGTCATTAGAAGATGTCCAGCCAGGACTTTAAGTTGAGAGACTTGGG
GCAGATAATTGGAGCCCTGAAGATCCAGCAAGATAGTACAAATGGGTGATAGGAGTATGG
CAGAATCAGGTTGTCCAAACGTTTACTGTAACATGTCCTAACAGGTTGTACTAACATTGT
GTAAATACTAATTAAGTACACACATCATTTAGTCCTCTCAGGAACCCTATGAGGAGAGTA
TATAGTTCCCATTTTATAGCTGAGGAAACTGGGATGCAGTAGGGTTAAAATTTTTTCCAA
ATCATAGACTAACTTATGAAGCTATGGGGCCAGAATTCAGGTCCTTTGATTTCAAGTCTT
GGCTCTTTGCACTTTGTAACCATGGGGAATCAAGGATCTAGAACCTGGCAGTGGGGTGTT
ATTAAAACTAAATTCACTGCAGGACCATAAAGTCTTCATGACAAGCCCCAGTTACTTTAC
CTAGGACTGACTGGATCTCACACTTAAGGAAGTGAGGTACAATTTCAGATCCTGACTAGC
AGGTGATGTGTTACTGAGTCACACAAGTGCTGGATCAGGTTTCCTAATATCCTGTCTGCC
TACAACTAGGAGCCATTCCAGAGCCTACCTGTGGTTTAGGATGTGAAGTGGGGTCAGTGA
ACCTCACTTGTGGGCACAGGAAGGATATAAGAGCAGAGAACAAAACAGAACTTCTTTCTA
GGAAATCATCTAATATCTAGCATTCATATCTAGACCTATTAAGTAATCTTGAGCAAGTAC
TTCACTTTTCTGAGGCTCACTTCCCTTATCAAAAAATGAGCAAGGTAGAGCCAACAATAT
ATGTGATGCTTACAGCTCTAAATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGTGTGTAAAGGTATGGCATGGGGT
TGTAGGATATTAAAGAATCCTCAAAACCAGGTTTAGTTTTGTCAGAGGTATAGATGGTGC
AGCTTTGGTAGGCTCTCAAATAAGGGACAAAGAAATCAGCTGGTGAGATCATATCAACTT
CTAATTAAAAACCATAATAGCACATGCTACCTCTTAAGGTCTCTTAGGTGCTCTTTGTTC
TCTAGGATCGAATACTTTCATGTCTACCATGAGGCTGAGTTGATATAATACTTGATGAAA
TGGGAAAAGAGAACTGTGGTCAAATCTTCACAGCCTTTTTCTTTAAAAACTCACTAGGTT
TTTGCCTCCAGCACTTCCATCTGTGAACTTGTTTTCTGAGATGCTGGCTGCATCGTTTTC
CATTGCTGTGGTGGCTTATGCTATTGCAGTGTCTGTAGGAAAAGTATACGCCATCAAGTA
CGATTATACCATAGATGGGAACCAGGTAAGAGCACCCTTTTTCTAAAATGGTTTTACAGG
GCTAAAAATGGGAAGAAAACATAAATGGGGAAGATTGTCTTCTTCCACTGATCCTTACTG
GGCTGCGTTCCCTCTTGTGCTTGTGAATTTGAAGTTATTTTGAAATACGGACACTGTATC
ACTTAAGTTTTATAAGAAATAAATTGAAGCAATCCTAATTTTAAGAGGTAATTCAGAGGT
ATGAATAACATTCAAATTTAATGTATTAGGGAATAATAAGAATTCTTCATGTAACCCAGT
GTCTAGTCTAGGTAGGTTTTTAAAAAAAATTCTTCTGTGATAACATATACAACTTAACAT
TTCCCATATTAATCACTTTCAAGTATACATTTCAGTGAGTACATTTTGCGTGTGTGTGTC
TGTGTGTGTTTTAAGGTTTGTCTCTATAAGACACTCCTATAATAGAGCCAGCACTTATTA
TATTTGCATCCAGACATTTTTTAACAAACATAAACTCCTTCGCTGCTCCTCTGTAAACTC
TAAACTTTCTGTCTCTGCGAATTTTCTATTTCTAGTCACCTGTTATAAGTGATATTATAC
AATCTTTGTGTTTACATGCCTTGCTTATTTCACTAAGCATGTTTTTAAGGTTTCCCATGT
TGCAGCATGTTTCATAACTTCATTCTTTTTTTTCAGATTTTTAAAAATTATCTTTCTCAT
TTTAAAGACACATCGATCATTCTTATGCCAAATAATAACCCATTTTGTGTATTTTGTTTA
CCCAATCTTTTGTTGATGGACACTTTGGTTGTTTCCACCTTTTGACTATTTTGAATACTG
CTTATATACACATTGGCTTACAACTATCTCCTCAAGACCCTGTTTTCAGTTTCTTCAGGT
ATATACCTAGAAGTGAAACTGCTGTTTTGTTTGGTAATTCTCTTTTCAACTTTTTGAGGA
ATTGCAATGCTACTTTCCACAGTGGTTGCACCATTTTACATTCCCATCAACAATGCACCA
GAGTTCCAATTTCTCTGTATCCTCTCCAACACTGTTCTTTCCATTAAAAACAAAATAGCC
AATCTCATGGGTGTGATGAAATATATCCTATTGTGGTTTTTATTTAAATGGCTAATGATG
TTGAGCTTCTTTTCATATGCTCATTGGCCATTTGTATACCTTCTTTGGAGAAATGTCTAT
TTAAGTCCTTTGCTCACTAAAAAAAATTTTTTTTGCCCTTTCCTGTGGCCTTTTAAGATT
GATTCAGTGCTTTAAGAGACTAACGCAGAAGGGTAAAGTAAGTCTCCATAAAACTCAGAG
AAGAGATGATAAAAATCCTCTTTAAATCCTGTCTGGAGTCACAGCTGAGAAGAAAACAAA
CAAACAAACAAACAAATAAATAAATAAATAAATAGTTCATAAATATGAGGGTCTATTTCT
GAACTCTCAATTAAAAAAAAAAATTGACAATTACGATTACTGAAATACTTTTCTTACTTT
TCCAGTATATTACAAATAGTCAAAAGTTAATACCTGAAATTACTAAAACTCCCTCAACTG
ACTTTAACTTTATTACAGAACTAGGCTCACCCTTGTGTATACCTGCCCTTGTGATGGTAA
CCACTCTACTCTCCTTGGTCTGAATCCATAAAAACTTTTGTTCCCGTGGTTTGGGAAAGG
CAGACTTGAGGTACTCCCATCTCCTGCCCTTCCTTTGGTGTTAATAAACCTGCTTTCTCT
CAAGACCAAAAAAAGATTTTTTTTTGTTCTTTTTGTTGTTGGGTTGTAAGCCATAGCCTG
TTTTTGTAAATAAAGTTTTTTTAAATAAAATTTTTAGGTTGAATTTCATCGATTTATCTA
TTCTTTCTTTATGGAGGTACTGGGGATTGAACCCAGGACCTCGTACATGGGAATGAGGTG
CTCAACCACCGAGGTATACCCGTTCCCCATATGGTTTTTAATAGAACACAGCCCTGCTCA
CTAATTTACATATTGTCGATGGCTGCTTTCACTTTACAAGAGATATGCCACTTATCAGGC
AGTGAAATAAACATTTTAGCAAAGGATCCCTCATCAATGTGAAATTCAATTGGGAGCAGT
GAGGCCTCTCTTAGATTCTATTAGATCAAGCTCCTGATGTCTTACAAGGATCCCATGTAC
TTTTTTTTTTTTTAAAGATTTATTTTTTATTTATTTCTCTCCCCTTCCCCCTCCCCACCC
TGGTTGTCTGTTCTCTGTGTCTTTTTGCTGTGTCTTTGTCCGCTTCTGTTGTTGTCAGCA
GCACGGGACTCTGTGTATTTTTGTTGCATAATCTTGTGTCAGCTCTCTGTGTGTGCGGCA
CCATTCCTGGGCAGGCAGCACTTTCTTTGGCGCTGGGTGGCTCTCCTTATGGGGTGCACT
CCTTGCACGTGGGGCTTCCCTACACGGGGAACACCCCTTCGTGGCAGGGCACTCTGCGCG
CATCAGTGCTGCACGTGGGCCAGCTGCACATGGGTCAAGGAGGCCTGGGGTTTGAACCGT
GGACCTCCTAAGTGATAGATGACGCCCTAACCGCTGGGCCAAGTCTGCTGCACCCATGTA
CTTTTAACTATAAAAATTAAGTTGGGGCTAACTAGGCAGGAAGGGTTTGGAAATTTACTT
CCTTAATGTGCTTCCTTTAACACTCCGCAAGGGTCTTGCAAAGAGTTTATTTGTAGCATC
ACCGTCATCAGTCTTTCCCTTAGGAATTCATTGCCTTTGGGATCAGCAATATCTTCTCCG
GATTCTTCTCCTGTTTTGTGGCCACCACTGCCCTGTCTCGCACTGCTGTCCAGGAAAGCA
CTGGAGGAAAGACACAGGTATGAAACAACAGTTTAGTAATGTGACAACTTGCATTTACTA
TCATGAGAAACAAATCAGGGGAGGGACAGCTTGGAGAGGTCTGCACAAGAATTGAGCAGG
ACAATTAGCCTTTGAAAAAGAGGGACTTGGCTTCCTGATGTGATTCAGCCCGGGGCTAAC
CATCCCCTTGGTTCACCCCCTAACCTAAAACCTCTTATAAAAACATGTGTGATCTTCTGA
TAAAGCAATCCCCAAATCTCTTTGTGTTAGTGCTCACCTGGCAGAGAGCTATATTTACCT
GTTTTTCCAGGAACAATAATGACTGACAAGGTTTCAATTAAAAAGAATGCTGATTTTTAT
CAATTTGTTATCTGGGGATAGAGAGAGCTTAGTAAAAGCATTTCATGGCTTAGTAAATTA
TTATATTTATCAAGAAAATGAAATGCATCTATTCACATTTCCTTTATAAGGATCAAGAAC
TTCCTCCAAAGGCCTTTGGCTCCCACAGAACAGCAGTTTGTTAGCCAAGAATGTTTTTGT
TGTAATTTTCTGGCATTTCTTCCTGAGTAAGGTGTTTCCTCTTGAAGGTCTGAACGTGGA
TTTAATTTTGCCTTTTAATTCTAGTTTTAAGTTGTTACTTTCACAACATGACAAAAACAA
AAAACAAAAAACAAACCAAAACAGAAAACAACCAACCCAGCATTACAGTTCATCTCTAAA
TAACTCCTCCCTCAATCGTTCAGAAAGCTCAGGAACCCTTCTCAAAGGGCACACTTTCCA
GCTAAACATGGCATCAGACGTGCCAAACCAAGAGGATGAGGCAGACTGCAAGGGGCAACC
TTGGGAATTGTGTTCATGTTATGTTGTGAGGGTTTTATCCTCCTGAAGCAGAAAGAGTTT
TTATTTAAGAGCAGAAAGTGTATGAGACGAAGGGGAGGCACAACAAGCGAGGCAAAGTAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTTGATGTTCTCCACCAGTGCACAGATGCTCCTTTCCTGTTTGTAATGGACTTTTAAAAA
AAAAGATTTGTTTGTTTGTTTGTTTATTTATTTATTTATCCCCCACCCTCTTGTTGTTTG
CACTTGCTGTGTGCTGTGTCTTTAGGAGGCACTAGGAACTGAACCCAGGACCTCTGATGT
GGGTGGGAAGTGCCTAATCACTTGAGCCACCTCCGTTCCCTACTTTTTGTCTCTCTCATT
ATGTTTTTTCTTCTTGTATGTCTTGTTGCATCATCTTGTTGCATCAGCTTGCATGCCTGC
CTGTCGTGTTAGCTCATTGTCTTCCTTAGGAGGCACCAGGAACTGAACCATGGACCTCCC
ATGTGGTAGGTGGGAGCTCAGTCGCCTGAATCACATCAGCTTCCCTGTAATGGATTTTTT
TTTTTTCTGTAATGGGCTTTTAATGACAGAGTTGGAGGAACTGGCCCCTTCCACTTTCTT
GGCTTCTCTTGAACAAAATTTTAATTCCAATTTCAGACATTTCCTTTTTATAATTGAGTT
TACTTTTTTCTTTTGGCAAACATTTCTAGCCATAAGGGAGCAGGAGAAAAGGTAAAATAA
TACATTCTACCCTGAGAGGCATAACTAAAGATCGATGGTCAAGGGGGAAAAGTCAGAGGT
TATCACTTAAGCTGTGCCCTGGTTCAGGCTGCAGCTATCAGCAGAGGGAGTTTCTACTGC
TTTCATTTCAGACGGAGCATTGACAAGTTCTCCCACCACGTGGCTTTGAAGTAGGTGGAG
GCAAATCCCAGGCTGCTGGTGTCCACTCTCTTGCTGTTACTTCCAGGCTCTAATGAGGCC
TGCTAGGCTATGACAGGAAGGAATGCCCATGTAAAGTGACCTCCTTGGCAAAGGGTTTGG
GGGATAATGGTGTTCTAGTAAGCTAATATCCCTTGCCACACACTGGAGGGTATTATTTAG
GAATGAAGCATGCCAGGATTTCAGCACTGAAGAATGAAGCTCAGTCATGGCTTGATATTT
AATTACTGAAATATATACTAAGTTCTAGGGTTTAAAGTCTAAGTGCCTGGACTGAAATCC
AGAGGTCCATGACCAAATAAATTGGCAAGTTTTCCCTGCGAGTGTTGCTTCTCATGTTTT
CTGATATGTTAGAGACTCAGTTTCTGCATCTATACAGTGGGGTTAATTATAGCCACTTCA
CAGGTATGTTTTAAGGATTAAATGAAAAAATGTTTGTTAAATTTTGACACAAATTTGTGA
ATGCTCATTGTTCTAGTATTAGCTCTTCAAGATAGGAGCATCTTAGTGCCTATGGTACAT
ATTGTGCCTGGCACATAAGAAGTATCCATTTATTTACTGAATGAAGTAATAAAAGAAAGA
ATATTGGTGAGCATGAACTATTTTAGTACATCTACATATTGTAGAAGAGTTAAACTTTGT
CTCCCACCCCCATCTAACTCTTATGGACTGATGACAAAGTAATTCTAAACTACTCTTTAA
CTCTGATTATGCTTCACTAACAGAATAGGTAATTTCCTAGTAATTGAGTCTGCTCATAAA
TATAAAATCTGCAGTATTTCCATCAAACCAGCCTTATGGAGTAAGTACAAAAATTGATTT
CATTTTAGATGGGGCATTGACAAGCTTAATATAGTGATGACGATTAGCCTTTGGTCTCCA
TAATTGGGGGCTTATTATTACATAAACTTAGCAAGTGGCCACTCCCCTGGCCTGAGCTAG
GCAGCTGGCTGTGGTCTCTACCCCAAATCGCCATATCCCTCACCAGTTCACAGAGCCCTA
TATCCACAGTGTGATATAAGTGGCACATGGAACTCATGGCACAATAAAACTGGTCAAGCA
ATTGCATGGAAGGAAAAAAGTAGGAAAAGGAAGAAGGATATTAGCTTCCTCACTTAGACA
GAGAGGGGAAAGCTCACCAACCTATTGAGAACCTGGAGGTGTGCTGCTAGGAGGTGCTGA
GGAGCCTAGAAAAGGGGAACTAGGTGTATAAAGCAAATTGTTTAGTACATTGTACATAAT
TTAGCCTCAGGCTGGCCTAACTACAATCTGAACATAAATGACAGTATTAGTCAGCCGAAG
AGGTGCTGATGTAAAATACCAGAAATAGGTTGTTTGTTGTTGTTGTTGTTGTTATTTTTC
TCTCCCCTACCCACCCCCCCACCTCCAGTTGTCTGTATTCGTGTGTCTATTTGCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCGTCAATT
GGTTTTTAGTGGGAAGGCCAATTTCCTTGTATGTAAATATAAAATAAATGAAGTCAGAAT
ATTAAAAAGTGCTGTAATTTGTTCATGGATAATTGATGATTTTTATGTTTTACAGTTAGT
TATCTCCCTTTACGATATCTGTGAATTAATGCAATTCTTTTCATTTCAACTTTTGTCTAG
CTTATCTGGGTATTTACATGCATAGCATCCATCATTCTGGGGCTGGACTTCGGTTTACTA
GCTGGCCTGCTGTTTGGATTACTGACTGTGGTCCTGAGAGTTCAGTTGTGAGTATTTTAA
GACCCAGGATTCCTATGAACAAGACAGCACACCTTGAGCTTTCTCATGCCATTTTGACAA
ATACAGTGAAACTACTTCCTTTCATAATAGTTACAGTATACTGAGTACTTCTTTAAAGTA
AGCATACAATGTTTTATAGATGTTATCGTATTTAAGCTTTAAAAACAAACAAACCGTGAA
TAGGTTTTATTATTCTTCTTTTATAGGGAAGAAAAGTGAGTTCGGAAAGGTTAAGACTCT
TCCCTAAGATCACATGGCAGAGCTAGTATTTGAATTCAATTGTATCTCGCTCCAAAGTCC
ACACACTCAGCCACGTGCTCTACTGCTGTGCTCTCCTTTTGGTCATGGTGAGACAAAATG
ACACATGGTCCGGCAAAAGACTGAGGTTGTTGCATAGCTTCTTCTGCAAATGAGATGAAG
CATGTGAAGCACTGGGTCTGGTTCCAACGCTTGCAATATATTTTAGCTCCTTTTTCCTTT
TGGTATGAGGAGGTTACCAGTTATATAACCCAGAGCCGGAAAACTTTAAAAGAGTTGACC
ATAGCCAAAAGTCATTCAAATCTGCCAAATAAGGCATATACTGAATAAGCAATTAGATAA
AGATAATGATGTGAAGTAGACATGATTAGATCATATGCAGAGGAAAGCAGCAAAGACAGA
TTTAAAGTAATAGAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATTTCTCTAGCATCAGATGATAA
GAATCACTGTTCCTCGCTTCCCCAGTTTCACACAAACAGCAGCTGTTCATTTCAGAGTTA
GCTACAGGCAAATGTCATCTGCAATAAAGACTCGTGCCAGAACCCAGAACCGCAGAAAGC
TGGGCTCTTTAGTTTATCTGTTACTTCTTTTAACTTCGTATTCCAAAATACGCATGTATC
AAAAAAAATCCTGACCTTAATTTTTCTTCTCTTAGTCCCTCATGGAATGGCCTTGGAAGC
ATCCCTACCACAGACATCTACAAAAATACCAAGAATTACAAAAACGTAAGTGCCTTTGTA
AGACTTTTTGCTAGACTTGGGTTTCCTAGCCTAGAATTTCAGATAGTTGCATATTCTCTT
TTAGAATACTAGATACAAGGTAACCAAAGAGGGAGACTCAAAAAGGAAAAGTCCCTCAGT
CCACTGGGGGGTATCATGAAAACTTCTGAGCCAACATGGCCTCTGATAGACATGATTTAT
ATGAATTTCGTCCATGCTAATTGAATGTCACCAATATTTTTGGAGCATATCATTTTAATG
TAAAACCATTTGAAGAGGGATTTTTAAAACAGGCAATTAGATTATTTCCTGACATTGAAC
CAGAGTTCTATTTCTCTGCTATGTGATCTTATGTTTGTCTGAAATCCCTATAAGATTTTC
TTCATTCAATTCTAATAGGAGACTTTCAAGTTCTCTGTCACTAAGAACCTTATTTGATAT
TTTGCTTTAGCTTTGAAATAGTAGAATATAATATATATACAGGGAATGGAAAACAAACTA
AGCATCCACTGATGGGCTAGCAGTCCTGCAGATAAATTGCTTTATGGCCAAGGGGAGAAT
ACACACTGGAAAAACAAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGTGAGAACTTTCCCAAGTCACCCTGTCTCTCAAGGCCTCAGTTTTCT
TCTCTAAAGGACTTGAATTCAAATTGCTATGATTCCAACAGACTAGAAAAGTCTATGATT
CTATGATTCCATGGGTTCTATTTTTGGTCTGGCCATTGTGTGTCAGAGCGGGAACAAACA
GATAACATCACAGGCTTCAGTTTTTACAAATCCCCTTGTTTATGCTACGTTTTGCCAGTT
AATATTTTAAAAGAATTTTAGCAAAATCAAGAGTGCCAGTGGTAGGAACTCAAGGCAAAT
CATATCAGTGTTCTAAGCATCAGTCTCTGGAAATGAGAAGGCTGAATAAATTACTTTTCT
AAGACCCTAACTTTGACCTATGAAACTATGGTTTGCAGGGGTCTAGGAGCTTCGACAGCC
TGTTGCCTCCCAACTGGGATAAAGCCCCTAGTCAAGGAAAGTGAAATCCTGCCAGCAGCA
CAGCTCCTCTAAGCAACTGTGAGCCAGCTCCTAGCTGAGTTGACAGAAATTTGAGTATTT
GAGGCCTGAACCTGTTTAAACTCAGCTAATAATTTTTTTAAATTACAGATTGAAGAACCT
GAAGGAGTGAAGATTCTTAGATTTTCCAGTCCTATTTTTTATGGCAATGTCGATAGCTTT
AAAAAATGTATCAAGTCCACAGTAAGTATTTTATATCTAGAAATTTAGTTTTTTAGCCTC
CATTGAAACAAGTATTTATTGGGATCCAACTGAGAATAAAGCCCTGTGCACTATTCCCTT
TGGGTAGGGCATCAAGTATTATAATGTAACATCCTTGCTCTTAAATAATTTACAATCTAT
TTGGGATAGAAGAAAATTCCCACATTCACTAAAATCTAGGTGCAATAACTATGGCGGTCA
ACAATGCTAGAGATGTCCCTAGGCAGAAGGTAAATTCCAAATAGGTAATACAATGTGAAA
AGTTCACAAAAGGGAGAGATCCATATTAGTTGGAGTGAGTGATCAGGCTTTAGGCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTAACCACTGGGCCAAAGTCTGTTTTCCC
AGTTTTCCTTTTTTTGATGTAAGCAGTTAGAAAGGCTAAAATTAAATCTATCCTCTTTGG
TACCCAGATGTGTATGTGAACAGCTGGACTGTTTCTGTAGGCAAGAGGGAATGGAAGGGA
ATAAAATGAAATCATCATGGACAACATCCACGTTATTTCTTCAACTTTATTTTTATTGAA
AGGAACAAAATAAGTATTAATTCAATGCTAGAAAATTATCCACACGAGAAGGCAATAAGT
TCACACACTTTTAAAGCCATTCCCTTTTATTCAGACTCTTCTTCCAATGTATTTCTTGGC
AAAGTTCCACAATCTTCCCCAAATCAAATGTTCAGGCTCCTCTCTTCTGCTATATTTCTT
CCTAGCAAACACCAAAGTCTGGATTGAGGTGAGTGTCATTCCATGAGAGTTCATCCCATT
TTTCTTAGCAAGGAACAGAATAGGGTATAAAACTTTTAAGTTACCTGAAGCGAATTGTTG
AAAAGACAGTCCAAATATCATTGGTAATTAAGTTGGCAGTGTTTCCTTTTTTAGAACGGC
ATCATAAGTGATGCTGGTTTGTCTAACAAGGCATTTGAGCCTGACGAGGATATTGAAGAC
CCAGAAGAACTTGACATCCCAACCAAGGAAATAGAGATTCAAGTGGATTGGAACTCTGAG
CTTCCAGTCAAAGTGAATGTTCCAAAAGTGCCAATCAATAGCCTTGTGCTTGATTGTGGG
GCTGTGTCTTTCTTGGATATTGTTGGAGTGAAATCATTGCGAGTGGTAAGGTTCTGTTTT
TTTTTGTTTTTTAATTCTAATTCTGTAACTTTGGCAATAGTAATATGGGTTCTACAGCCT
TGCTAAAAAGGGCAAATGCGTGGGCTCTGTAATTTTTCTAGGTGAATGTTTTTGCAGTAA
AATAAAATATTTTAGAGACCAGACTCTGGAGCCAGACTACTTGGGTTTGAATCCTGACTC
TGCCACTTGCTAGCAGTGTGAACATGGACAAGTTGCTTAATCTGTCTGTACAGATGTCAT
CATCTGTAAAACAGGAGTAATTATGGTACTTCATAGCATTGTTATGATGATTAAATAAAC
TAATAGATATAAGGAACTGAGAAGACTGTCTGGCACATAGTTACTTCCTAGCAATATTAA
TATTAATTACGTTTTTTAAAAGTGAGAATATGTAGGAAAGGGAATATGAAAAAAGGAAAA
TACTTGCAGAAGTATGTTTTGAGTACTATGTTTTTATTTATGTGAACAGCAGCAAGGTAA
GGAGCATGGAGGTAGGGCTGGAAGAGCCAGGCTTTAGTAAGAGGTTAGAGCAGGAAGCAG
GTCAGGCATCTAGGAAGTCAGAGTAAGGGTCGAACATTCATAATAAATCCAATTATGCAA
GCTTCAGTTCATTAATGTTTTCAACAAATAGATGTGAAATTGTCTAATGTATTTCGAGCA
TTCTGCCAGCCACAGGACTCTTAGCAATAAAGCAGCCATAGTCCCTATTCTCATGAGATT
AAGCAGTCTATAGGGGAAGGCAGGTTTCAGGTAATCTTATTAATAATAACTATATCAAAT
GCTCCAAAACATATTAAATAGGGTGTACCCAGACATTTCAAGTTTAAGTGAAAGTTCAGG
TAGCTATCAAGAGGACTGGCAGCAAAGTAAGCAGGTTTAAGGCACCAACAATCAGATGTC
ATAATATGGAAGTGACCCTTAACTAAGGTTTAGCTCAGCTGGGGGCTTCCCGGATAAAAT
CTACAAGGGTTGGAAATAATTCAGAGTGTAGGTACTGGGGCAGGCAAAGTACAGAAGTGA
ATGCATTTGGCAAAAGAGTATGAGAATAAGCTCGGCAGGTTCTGTTTCAGTTCCCTTAGC
AGATCTACCTGGTTATTGTCTTATTTGAGAATACCCTCTTGTTCTTTGTTGGACATTTCA
CTCTAGGCCTTGGCTCAGTTCCATTGCAGACAGTAATAACCGAAGGGTTTAACAAATTAC
TTTTGGGAGAGACTTGGCAAATTTAATGCTATTTTCCACATTTAACAACAAATAGTTGCT
ATCGAGTGCTATAATGACAATTACGAAAACTAAAGAAAATTCCAAATTTTATACTTGAAT
AGAGTCTTTGATTTTTGTCCTCAGAAGTTTCAAGTTCAGTCATTATTGTCTTCTGTCTTG
ATTTTTAAAAATTAAATTTCTGGATAATTATAGATTCCCAGGCAGTTGTAAGAAATTAAT
AGAGAGCCCACGTATCCATTACCCAGTTTCTCCTAGTGGTAATATCTTGCAAAACTTTAA
TACAAAATTGCAATTAGAATATTGTACATTCAAAATTTAGAAGCCTCGATTTTAAGGCCA
GTTTTTACATTCTGAACCTGGTGGCCACATATAACTGTATCTCTTCTACTCAAAGTTATA
AACTTATGCTCTTTTCTTGAATCACCAGGAGCTATATTAGGAAGCCTCCTGTCCTTTCCC
TTTGCCCACAATATTTTTAAAAATAATTTTATCCAATTATAAATCATATACCATATAATT
TGTCCATTTAAAGTTTAAAATTCAATTTTTTTATAGTGTATTTACAGATATGGGCAACCA
TCACCACAGTCATTTTTCAAGTATTTTAGCTCTTATCTCTCCTACCTACCCAGCCCCATG
CAAGTATTAATCTACTCTCTGAATCTATGGATGTCCCTATTCTATAATTAAATGTGAATA
GAATCATATAGTATATGTTCTTTTGTGTTTCCTTTACTGAACATAATATTTTCAAGTTTC
ATACACACTGTAGCATGTGCTCTCAGAAAATATTTCTTGAGCACCTCCACATTATAGAGT
GCTGTGCTGTTGAGCACTGGATGAAGTCACCTCTTTCATCTTTAGTTATACTCCACTAAA
GGTTGAAAATCTCTACACATGTTCCAATAATGAACTTACCTCAAAGCTTGAAGTTTCTCT
GAGCAAATAATTGAATACTACTGATTTATGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTATTTTTC
TCTTTGGAAGATTTTGAAGATCTTCTTTTTATCCTTTGTGTATTTAGAAATCTCAAAGAT
CTAATTGGATCTCATTTTATTCTTTGTTTTTTTTTTTAAAGATTTATTTTATTTTATTTA
ATTCCGCCCCCTCCCCAGTTGTCTGTTCTCTGTGTCTATTTGCTGCATCTTGTTTCTTTT
GTCCGCTTCTGTTGTCAGCGGCACGGGAAGTGTGGGCGGCGCCATTCCTGGGCAGGCTGC
ACTTTCTTTCGCGCTGGGCGGCTCTCCTTATGGGTGCACTCCTTGCGTGTGGGGCTCCCC
TATGCGGGGGACACCCCTGCGTGGCAGGGCACTCCTTGCGCGCATCAGCACTGCACATGG
GCCAGCTCCACACGGGTCAAGGAGGCCCGGGGTTTGAACCGCGGACCTGCCATGTGGTAG
ACGGACGCCCTAACCACTGGGCCAAGTCCGTTTCCTTCATTTCATTCTTTGTGTATGGTG
TTTCTTGGTAATCCTTTCAATTTGAAGACTCATGTCTCCCTTCAGTCCTTGGTAATTTTC
TCTCTTTTCCCAAGAATTCTTTTTTAGTCAGATGTTGGCTGTTCTGAGTTATTCACTCAT
AAGTCATATATTTTTAAAATTGCTTTGACTTTATGTTCTACTTTTTGGGAGGCTGCATAG
ATATTAATTTCTTTTTCTTTTAAAGATTTATTTATTTATTCCCACCTCCCCTCCCCACTC
CTGCTCTGTTGTTTGCACTCACTGTCTGTTCTCTGTGTCCGTTTGCTGTGTGCTTTCTGT
GTCTGCTCATCTTCTCTTTAGGAGGCACTGGGAAACTGAACCTGGGACCGCCCTATGTGG
AAGAGAAGTGCTCAATTGCTTGAGCCACCTATACTCCCTGCTTTGTTGTGTCTCTCATTG
TGTTTCCTCTTTGTTTCTTTTGTTGCATCATCTTGTTGAGTTAGCTTGCTGCGCCTGCCT
GTCACGTCTTGCTGTCTTGCTTCTCTTCTGTAGGAGGGAACGGGAACTGAACTTGGGATC
TCCTCTTCGGTAGGCAGGAACCTTATTGCTTGAGCCACATCTGCTCCCCGAGATGGGGAT
TCTTACACAAGTGATTTATTGAAAGTGTGCTTTGTGGAGAAATTTATAAGGAGTGAGGGC
ATCAGAATAGGACTAAGCAAAGATGTGGCTTCAGAAGTCTGGCCTCAGCCTGATTCTACA
GGGCACCCCACAGCAGGAAGAACACTGGAGATTTATCCCTCCCTGAGGCAAGGGGACCCG
CCCTTGTACCTCCAGATTAGTCAGTAATTGGCTACAGGCCTCCCCTGGGTGGCAGTGCAA
CTTCCCAGGCCTTTTCAGGTGAGACAGTTCCCACTGGTTGAGGAAGTTCTTCAGAGAAGG
GCACAGCTGTGAGCTGTTAGCAGCCAGGCACACAGCAGCTGGAGGCCGGCAAAGGCCACA
CAGTAGGGTACCAAGATCATCTACCACAACCAGTTATGGTAAAATTATTCTATGTGCTTC
TGGAAAAGAAACTCTTAGGTTAGAGCAAGGCCATATTTTGGAAATGAGGAGAAATTAAAT
GAGGAGTTACAAAAACTTTGCATTAGTTGAAGTTAGGAAAACATCTTCTCCTAATATGGG
AAATATATCAAGCATAGACTTAGAGTCTATATTATTTCTCTTGATTCACAAACTAAACAT
TATTTATCTCTTTCTTTTGAAGACCAGGTGATGGAAAAGCTGGAGCAATGTGGTTTCTTT
GACGATAACGTTAGAAAAGACATGTTCTTTTTGACTGTCCATGATGCTATACTCCATCTA
CAGAACCAGGTTAAATCCCGAGAGAGTCAAGATTCCATTTTAGAAACGGTAAACATTCAA
CCTTTCTACATATGTATCCTTTTTAAACTATCTTGATTTCTGTAAAATGGCAAAAATCAC
CCAAATCTAGGTTTTAGTCGCAGCCTTGCAGGAGAACATTTAGGCCATCTACCTAACTTC
TTGGAGCTTTAGTTTACTAGTCAGTAAAATGGGAGTGAAGGCATTTATCTTGCTGGATAG
ATGTGGGGACCAAAAAAGCTAGTTTATAATAAAATACCTGGCAGTACCTAGTTTATGATT
GTCTAATGTGTGGGTTTACTAATAAAATAGGGCATTAGCCTTAAGGCCTTTTCAGAATAC
AGCACTGAGTCTTAATCTTCTGTGATTTGTGTGCACAAATAGCTTAAATTTGCAGCAATC
TGGAAACCCGTGAAATATACATATCTTTAAATAGGATCCATCAGGCCATAAGTAAGCTTT
GAAAAAGAAAAATTCAAACCATGCATAAACCCAGAGTTAATTCCCCATCTCTCCACCCCC
ACCACTAAACCCTGATTTCTGATAGGCCTCCTTATTTTGTGAAACTTCTTTTGAATACCC
AGGAGAGGTGAACATTCTGGTCTAGTTTATTAGGCTGGGCCTACTGGTGGGCCTGGTACA
AGAACCTCATTACTCATAGAACCCTCCAGCAGAAAATTTGGGAGACTAAAATAAATACTT
ACAAAACTAATAATGACTCCAGTGACATAATGCAGTACACTTTAAGTTGTGTGTCTTTTT
TCCTAAGATTAGGATAAGTCGATCTGTATTGTAGATTAGAAGATAATGTTTTGAAGTAAA
ATTAATTTAGAAAACAATGGTACATTCTTGTCAGCTATTTATATTGGAGAGATTGTTTTG
CTTAATTCTCCTGGAGAACATACCAGTCCTGAACACCAAGGCGTGGACCTTAAATGTGAA
AAAGGAAAAAAACAAAGAAAAAACAAGAAACCTACATGCATGCTGCTCAAATCTGATATT
AGATTCCTCTTGGAAAACTCATAAACCCTTTTCTATTTAACTTAAAATTCTTTAACCCAT
AGTAATACGAATAAAGCAGGATCATATAAAGTAGATGAAAAAGACCCCATATTAAAAGCA
AAACAAGGATACAGATTTCTGGGAGGATGGCAGACTAGACAGACATGAGACTCTCTTCTC
TCCTAAAAAATATAGCTAGAGGACAAGCAGAAATGGCCTGGAAAAATATCTTACAGGGTT
TAGGACACCAGGGGAAGGCTGCACACTGCCCAGAAGAGAGAGGGCAAAGGAATAGAATCG
TGATGGCAAAACTGGGAGTGAAAAGCTGCAGCAGCAATTGACAGCACCCTCCCCCACACT
ACAGGCACTTTTGAATTCTCAGGTCTTGGACTTGGCGGCTACAGACAAAGGGGCCTGCAG
GGATCCATCTCCCCAGAAAAGGCAGAGAGAGGGACACAGTCTAAGGCTGACTCAGCTTTG
ACCCACAAATTTGGCTGGGTGGGGCTGCACCACTATTTGCCTTGGGAGCCAGTGAAGAAC
TAAAGAGATCCAACCCTCCCAATCACCCTCTCTACAGACTGGGACTGGATATTTGAGGAT
GCAAAAAAGGAGTGGAATTATTTCTGACATGGGGAAAAGGGAGGGACCTGCCAGTAAAAG
ACTGGAAGAACTTTGAGGTAGTTTTGAATTATGAGGCTCTTAACTTACAGGGCAGGACCC
TCTACCACCATGGATCCCAGTCCTATGTTGGCAGCAATACCAACTTCTTATCAGGCTTTG
GAACTGAGAAGGTGTGATTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCCATTACTGGTCCAGTGCCCAGATTTGAGCAACTAACAGGGACAATCCTAAAGACC
CAGAACAGGTTCAACCAAGAATCAAAGAATAGTAGTAACACACAGCCTCCCTCCACTAAA
TTCCTACAAAAAGAAATTGAGCATCTGAGTAAGCTTACCATCCTAATTAGATGCCTAGAC
ATCAGCAAAAAATTATTAGCCATACTAAGAAAATGGAAGAAATGGCCCAACCAAAGCCCC
AGAAGAGACAAGATTTGAGACAAATAATCAACGAGATGCATGCAAATTTCCAAAATCAAA
TTAATGAGCTGAAAGACAATATGGCTAAAGAGATAAAGGACATCAAGAAGACACTGTGTG
AGCACAAAGAAGAATTTGAAAACCTGAATAGAAAAGTAACAGAGTTCATGGGAATGAAAG
ATTCTAAATGAAAGACTAATAAGGTGAGATAAAACTACAACAGCAGATTCTAAATGACAG
AAAAGAATAAGTGATACAGAAGACAGAACACCTGAAATTGAAGAGAGAAAGAAAAGAGAA
AAAAAAATTAGGAAAAATTGAGCAGGAAATCAGGGATTTGAATTATAACATAAAAGATAA
TATATGTGTCATGGGCGTTCCAGAAGGAAAAGAGAATGGAAGAGGGGCAGAAAGAGTATT
TGAGGAAATAATGGCTGAAAAATTCCCAACTCTCATGAAAGAAATGAACTTACATGTCCA
AGAAGTGCAGTGTACCCCAGTCAGAATAAACCCGAATTGAACCAGTCCAAGCAAATACTA
CTCAGAATGTCAAATGTCAAAGCTAAAGAGAAAATTCTGAGAGCAGCAAAAGAGAAGCAA
ATGATTACATACAAGGGCTTGGAGAAAAGTATAGTAAGCAAGAATATCAGAAAGAATAAC
CAAAAAGAGTAAAAAGACAGATGAAAATAAGATATGGCATATGAAAACCAAAGAATTAAA
TGGTGGAAGTAAATAACGCATTGACAGTAATATCATTTAATGTGAATGGATTAAACTCCC
TAGTCGAGATACAGGATAACAGAATGGATAAAAAATATATACATATGAGCCATCCATATG
CTGCCTACAAGAGACTCACTTTAGACCTAGGGATATAAGTGATATAAGATATAAGGGATA
TAAGTGGCTGAAAGTGAAAGGCTGGAAAAATATACTCATGCAAACAGTATCCAAAAAAGA
GCAGAGGTAGCTAAACTAATATTAGACAAAACAGATTTTAAATGCAAAAAAGTTATAAGA
GATATAGAAGACCGTTATATATTAATAAAAGGGACAACCCTCCAGGAAGTAATAATAGTC
ATAAATATCTATGCATCTAACCAGGGTGCCCCAAAATACATGAGACAAACTGGCAAAACT
GAAAGGAGAAATAGACATCTCTACAATAATAGTTGGAGATTTCAACACACAACTCACATA
ATTAGATAGAATAACTAGACAGAAGATGAACAAGGAAACGAAGAACTTAAACAATATGAT
CAATGAGGTAGACCTAACAGACATATACTGAACATCGCACCTAAACTCAGCGGGTTATAC
ATTTTTCTCAAAGTGCTCGTGGGTATTTCTCCAGGATAGGCCATATTTTAGGTCACAAGG
CAGTTCTCAATAAATATAAAAAGACCAAAGTTATACAAAGTACCTTCTCTGATCATAATG
GAATGAAACTGGAAATCTGTACAAGATGGTAAGAGGTAAAATCACAAATGGGTGGAAGCT
GAACAACACATTCCTAAATAATCAGTGGGTCAAAGAAGAAATTGTAAATGAAATTAGTAA
ATATATTGAGATGAATGAAAATGAGAACATAACACATCAAAACTTATGGGATACAGCAAA
AGCAGTGCTGAGAGGGAAATTTATAGCCCTTAAAGCCTATATTAACAAAGAAAGACATAA
ACTCAAAGATCTAACTGAACAACTGGAGAACTAGAAAAAGATCAGCAAACCATTCCCAAA
GCAAGAGGAAGAAAAGAAAGAATAAAGATTAAAGCAGAAATAAATGAAGTTGAGAACAAA
ACAATAGAGAAAATCAATAAAACCAAAAGCTGGTTCTTGAGAAGATCAATAAAATTGACA
AACCCTTAGCTAGATTAACAAAGAAAAAAAGAGAGAAGGTGCAAATAAATAAAATCAGAA
ATGAAAAGGCACAAGTTATGACAGACCCCACAGAAATGAAAAGGATCATAAGAGGATATT
ATGGGAATCTGTATACCAACAAACTAGATAACTAGACAAAATTCCTAGAAATGCACAAAC
AACCTACACTGATGCTACAAGAAGTACAAGAACTTAACAAACCAATCACATTTAAAGAGA
TTGACTCAGTCCTTAAAAATCTCCCAGAACCAGATGGCTTCACAGGTGAATTCTACCAAG
CATTTTGAGAAGAACATCAATGCTGTTTAAACTCTTCCAAAATATTGATGAGGAAGGGAA
ATTTCCTAATACATTTTATGAAGACAACATCATCCTAATACCAAAGCCAGATAAAGATAC
TACAAGAAAAGAAAATTACAGACCGATCTCTCTAACGAACATAGATGCAAAATTTCTCAA
CAAAATATTTGCAAATAGAATCCAACAGCATATCAAAAGACTTATACATCATAATCAACT
AGGATTTATTCCCTTTATGCAAGGGTGATTAAACATAAGAAAATCAATCAACATAATATA
CCACATTAACAAATCGAAAGGAAAAAAACACATGTGATCATCTCAATTCATGCAGAAAAG
ACATTTGACAACATCCCAGCATCTTTCTTGATAAAAACACTTCAAAACGTAGCAATAGAA
GGAAAATTCCTCAATATGATAAAATCAATGTAGAAAAACCCACAGCCAACATTGTACTCA
ATGGGGGTAGGTTGGAAGCTTCCCCTTTAATATTGGGCACAAGAAAAGGATGCCCACTGT
CATCACTGTTATTAAATATTGTGCTAGAAGTTCTAGCTGGAGCAATTAGACAAGAAAAAA
AGAAATCCAAATAGGAAAAGAGGAAGTAAAATTCTCACTATGTGCAAATGACATGATCCT
ATATTTAGAAAACTCTGAAATATCTATGACAAAGCTACTTGAACTACTGAATGAATGTAA
CAAAGTGGCAGTATACAAGATCAACATAAAAAAATCAGTAATGTTTTTTAATTTAGCATT
GCACAATCTGAGGAGGAAACCAGGGAAAATTTTTCATTTGCAAAGCAACAAAAGACTCAA
ATACCTAGGAATAAACTTAATCAAAGAAGTACAGGGCCTATACGCAGAAAACTACAAAAC
AATGCTAAAAGAAATCCCTGAAGACCTAAACAAGTTGATGGACATTCCATATTCATGGAT
TGGAAAACTAAATATTGTGAAGATGTCATTCCTACCCACACTGATTTATTGATTCAATTC
AATACTAATCAAAATTCTACCAGCATACATTACAGAAATAGAAAAGGAAAATACCAAATA
TATCTGGAAGGGAAAGTGCACCTGAATAGCCAAAAACATTCTAAAAAAGAAAAATGATGT
GGGAGGAATTTCACTGCCTGACCTTGAAGCATATTACAAAACTACAATATTAAAAACAGC
ATGGTAAAGGCAAGACAGACACATCAATCAGTGAAATAATTGAGAGTCCAGAAATAAACC
CTTACCACAACAGCCAACTGTTTTTTGACAAATCTACCAAGTCGATGTTGATGGGACAAA
ACAGTTTCTTCAACAAAAGGTGTTGGGAGAACTGGATATCTGTGGGAGGAAGGGCGCCCG
GCTTTGCCACAGATCAAATTTTGCGGCAAGAAGTGATACCGCCTCTGCCCACTGGGCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACTTTCCAGAAATAGAAAAG
GCATTTACCAAATTCATTTGGAAGGGAAAGTGTACCTGAATAGTCAAAAGTATTCTAAAA
AAGATGACACAGGAGGGATTTCACTGCCTGACCTGAAACAGATTATAAAGCTACAGTGGT
CAAAACAGCATGGTACTGGCATAAAGACAGACACATCAATGAGTGGAATAGAATTGAGAG
TCCAGAAGTAAGCCCTCACCTGTATGGTCAACTGGTTTTTGACAAACCTATCAAGTTCAT
GTCAATGGGACAAAACAATCTCTTCAATAAATGGTGCCAAGAGACCTGGATATCCATAAC
TGAAAGAATGAAAGAGGACCCCTTACTCACTGCCTATACAGGAATAAATTCAAAATGGAT
CGAAGACCTAAATACAAAAGCCAGGACCATAAAACTCTAGAAGAGGGGAGTGGATGTCCT
CAAGTGGTTGAGCACCTCCTTCCCATGTACAGGGTTCTGGATTCAATCCCTGGTACCTCC
CAAAAACAAAACAAACAAGCAAATGAAAAAAACCAATGCTCATTGGGGAGCAGATGTAGC
TCAGTGGTAGAACACCTGTTTCCCATGTACAAGGTCCTGGGTTCAATCCCCAGTACTTCC
TTCCTTCCTTCCTTCCAACCAACCAACCAACAAAAAACACACCAAAAAAACAAAATGAAA
AAAATGCTGGAAGAAAATGTAGGGAAACATCATCAAAGACCTTGTGGTAGGTGGTGGTTC
TTGGACCATACACCCAAAGAATAAGCAACAAAAGGAAAAATAGATAAATGGAACTTCTGC
CAAATTAGACAGTTTTGCACCTCAAAGGACTTTGTCAAAAGGGTGAAAAGGCAGCCAACA
CAATGGGAAAATTATTTGGATATCACATATCTGATAAGGGTTTAATACCCATGATATATA
AAGAAATGCTTCAACTCAACAGTAAAAAGACAAATGATCCAATTAAAAAACTGGGAAAAA
TACTTAAAAAGACATTTGTTCAAAGAAGAAATACAAATGGCAAAAGAAAAACAACAAAAA
ACACACAAAAAAATGTGCAACATTACTAGTGATTAGGGAAATGCAAACCAAAACTACAAT
GAGAGATCATTTCACACCTATCAGAATGACCGCTATTAATAAGAAAGAGAACTACAAGTG
TCAGAGAGCATGTGGAGAGATAGAAACACTTATTCTCTGTTGGTGGGAACGTAGAATGGT
ACAGCCACTGTGGAGGACTGTTTAGCAGTTCCTAAAGAGGTTGAATATAGATTTGCCACA
TGATCCAGCAATACCACTCCTGGGTATACACTCAGAAGAACTGAGAGCAGTGACACAAAC
AGACATCTGCGCACCTATGTTCATATTGGTGTTATCATGATTGCCAAAAGATGGAAACAA
CCGACGTGTCCATCAACCAAAGAATGGATAAACAAACTGTGATGTAGTCACACAGTGGAA
TATTATGCAGTAGTAAGAAGAAATGAAGTTGTAAAGCATATGATGACAACATGGATGAAA
CCTGGAGGATGTTATGTTGTGTGAAGCAAGCCAGACACAAAGGACAAATACTATACGATT
GATCTGTTATGAACTAAATATATTGTGTAATTTCATGGAGTTAATAACTTGAGTATGGAT
CACCAGAAAATAAAATGAGGTTAGAGAATGGAAAGCTGAGGGTTATCTTGTGCAGAATGG
TTATAAAGGATGTGTGTTAATCTTTGGAAATGAATAGAAAAGGAGAAAGCCAAAATAATC
TTTGGAACTAGCAGTACTATTATATAGGTATGGAAGTAGTTTAAAGGGAAAATCTAAGGT
CATGTATACTAATAAAAGGAAAGCTATAAAATGTAACACAGTAAAACCACATGTAAAATA
TGAATGGGGTAATATTGCATATGTAAGACCGCTTTTCTTTGAAACAACTAATATATGTTA
ATACTACAATGTGTATTAAAACATTATGCTAAGTGAAAAAAAGCAGACACAAAGTACTAC
ATATTGTATGATTCCATTTATATAAAATGTAGATATAAATCAATTTATTAAGATGAAATT
AGGTCAGTGGTTGTGTAAGGCTGGGGAAGGACAGAGGAATTGTGAGGTGACTACTAAAGG
ATATGGAGTTCAGGGGTTTTTTGAGTAATGAAATGGTTCTAAAATATTTTTGTGGTGATG
AATGCACAACATTGTGATTATACTAAAATTCATCGATTATATATTTGGATAGATGGTATG
GTATGTAAATATATCTCAATAAAACTGGCTTAAAAATTAAAAATAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCACTGTTTCTTGATAAAAGCCCTTCAAAAGATAG
GATATAGAAGGAAAATTCCCAAAATAATAAAGGACATATATGAAAAACCCATAGCCAACA
TTGTACCAATGGGGAAGTGTTGAAAGCTTTCCCTCTAAGATTGGAAACAAGATAAGGATG
TCACCTTTGTTATTCAACATTGTGCAAGAAATTCTAACTAGTGCAATTAGACAAGAAAAA
AAATTAAAAGGCATCCAAATAGGAATGGAAGAAGTAAAACTCTCACTATTTGCAGAAGAC
ATGATCCTATATTTAGAAAATTCTGAAATGTCTATGACAAATCTCCTTGAGCTAATAAAG
GAGTTCAACAAAGCTGCAGGATATAAAATCAGCATGCAAAAATCAGTTATGTTTCTGTAC
ACTAGTGCTGAACAATCTGAGGAGGAAATCAGAGAAAAAAATTCCATTTATAATAGCAAC
AAAAAGACTCAAATACCTAGGAATTAATTTAACCAAAGAAGAGCAGGACCTATATGCAAA
AAACTATAAGACAATGCTAAAAGAAATCAATGAAAACCTAAACAAATGGAAATACATCCC
ATGTTTATGGATTGAAGGACTAAATATCATGACAATGTCAATCCTACCCAAACTGGATTA
TAGAGTCAATGCAATACCAATCAAAACTCCAACAGCCTACTTTCCAGAAATAGAAAAGGC
ATTTACCAAATTCATTTGGAAGGGAAAGTGTACCTGAATAGTCAAAAGTATTCTAAAAAA
GATGACACAGGAGGGATTTCACTGCCTGACCCTGAAACAGATTATAAAGCTACAGTGGTC
AAAACAGCATGGTACTGGCATAAAGACAGACACATCAATGAGTGGAATAGAATTGAGAGT
CCAGAAGTAAGCCCTCACCTGTATGGTCAACTGGTTTTTGACAAACCTATCAAGTTCATG
TCAATGGGACAAAACAATCTCTTCAATAAATGGTGCCAAGAGACCTGGATATCCATAACT
GAAAGAATGAAAGAGGACCCCTTACTCACTGCCTATACAGGAATAAATTCAAAATGGATC
GAAGACCTAAATACAAAAGCCAGGACCATAAAACTCTAGAAGAGGGGAGTGGATGTCCTC
AAGTGGTTGAGCACCTCCTTCCCATGTACAGGGTTCTGGATTCAATCCCTGGTACCTCCC
AAAAACAAAACAAACAAGCAAATGAAAAAAACCAATGCTCATTGGGGAGCAGATGTAGCT
CAGTGGTAGAACACCTGTTTCCCATGTACAAGGTCCTGGGTTCAATCCCCAGTACTTCCT
TCCTTCCTTCCTTCCAACCAACCAACCAACAAAAAACACACCAAAAAAACAAAATGAAAA
AAATGCTGGAAGAAAATGTAGGGAAACATCATCAAAGACCTTGTGGTAGGTGGTGGTTCT
TGGACCATACACCCAAAGAATAAGCAACAAAAGGAAAAATAGATAAATGGAACTTCTGCC
AAATTAGACAGTTTTGCACCTCAAAGGACTTTGTCAAAAGGGTGAAAAGGCAGCCAACAC
AATGGGAAAATTATTTGGATATCACATATCTGATAAGGGTTTAATACCCATGATATATAA
AGAAATGCTTCAACTCAACAGTAAAAAGACAAATGATCCAATTAAAAAACTGGGAAAAAT
ACTTAAAAAAACATTTGTTCAAAGAAGAAATACAAATGGCAAAAGAAAAACAACAAAAAA
CACACAAAAAAATGTGCAACATTACTAGTGATTAGGGAAATGCAAACCAAAACTACAATG
AGAGATCATTTCACACCTATCAGAATGACCGCTATTAATAAGAAAGAGAACTACAAGTGT
CAGAGAGCATGTGGAGAGATAGAAACACTTATTCTCTGTTGGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTATCAGTAAAATGATTTGT
TAAAAAAAACAAACCAAACATAAAATAAGACCACAGTATTAAGTTCTTTCTTAATGTGAA
ATTAGTTTTATTTGTCTATACCCTTACTTTGATCCAAGATGTTAAGTCACAGATGTCACA
AAAACCAATAACCAAGAGGGCACCTACCATCATTATATTACTCATTGGGATGAGTTCTTT
GATTCTGAACAAATGTTAGAGTGACTATAATTGAGTGTGTGTATTAATATACTGGTTCAT
TGGACAGTGCGTTGAGTATTACTTGTAGCCTGTCAGGTCAGAAACTTTATACTTCTGTGT
GCTCTTGTTGTCTAGTACCAACTCTGATACATAGTAAATATGTGGTAAATTATGCTAAAA
GCTCTGCCTGTGGTTCTTTCCTTTTCTTCAGGTAGATGTGATGAAGTGGATGTGGTGATA
TGATCCTCTCCCAATCCCTTTATTTTACTATCTCAGGACAGCTCCAATTTGTAGCTTGGC
TTTAAATCTCCCATTATTTCACCCTTGAAGGTGAAAAAATGAGGAGAATTCCAAGGTGGA
AAATATTAAAAAAAACAAGAAAACAGATTTTGAAGTCTGTATATAATGGATGAGAAGTAT
CAGCAAAGCTTTTAGTCATTTTTGGTGGAGTATCAGGTGGGTTGATGCAATTCTATTTCC
ACTGAATACTCTCTTTGTTCTCTTTGTCAAGATCACCCTCATCCAGGAATGTAAAGATCC
TCTTGAGTTAATAGAAGCAGAGATGATTGAAGAACTTGATGTCCAGGATGAGGTATGATC
ATTATTTTCTTTTTAAGAAAATAAGTTGGAGTTAAATCTTGAATAAATAGAATACTACAA
ATAGTTATTATGTCTGATTAAGAACTGTTTAGGGAAAATAATTTTTAAAAATACTAAAGG
AATGACTTCCCAGAAGGGGAAAATGGTAAACAAAAATTGTCCCTTGAAGACAGTACTTGG
AGAACTGTTGCCTCAAGTTGCCCTTTTGCGGCAGCCAATACACTGCTCCTGATTTCATAC
CTAAGCCTGTGGATACTTTTCTTTCAGAGATTTAAGGCCAGCGTGATAGGGGGAAAGTGA
ATTGAGGGAAGTTCTAACCCAGGAATAACTACTCACAAGCTTCAGGAGTAGTCAGTGAGG
AATAGGAATCTTTCTTCATCTGACTGGTAATGTCTTAAGAAAGATACTCCCTCCACTCAA
GACTCATTCTATGTACTTCTGATGCTCTTCTGGTATCAGACTTTTTCCAGGAAATTTGAC
TGAAACTTGAAGTAGTTAGTATCTGTGGGAAATTTGTAGCTCCACTACTGAGTAAAACTG
GAACAACAAGGGAAGAGCATAAAATTTGAAAGTTGAAAATTTCTTAGTGATCAGGTAGTT
TCAACATCCTAGCCCATGTAAGAATTCCTTACATAACATCCCTAATGGAGAGTTTGTTCA
TTTAGTTTTTGTATGGCCATTTCCAGAAAATGGCACCTAGTGCCTTGTCAAGGCAGCTGG
TTACACAGTGGTAGTATCAAATGTTAGGTGTGCTTACAAAGCTGAAACTGACCTCTCTGT
AATAGTCATCTGATGGCCTGAGATCTGCCTTCTCTAGCAACACATACCCTCCTACTGATC
AGTCCTTCAAGTATTTGAGAATAGCTCTATTGCCTCCACATTCTCTCCTTCAGGGAAAAT
TCCTCAAGTTCCCTCTATCATCTTCATAAACACAATCTCTCAATGCTTTTCTGGCCAAGA
AGGGGACAGAGAACCCCAGGTGTGGTCAGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1164, 2706..2722, 2724..2733, 2735..2735, 2739..2771, 2773..2784, 2786..2849, 3567..3677, 3778..3962, 4063..4227, 4328..4480, 4581..4663, 8217..8364, 11063..11176, 14554..14631, 14732..14827, 15120..15226, 17375..17444, 20988..21080, 21517..21612, 23454..23684, 25993..26047, 27862..28007, 40051..40131
1001..1164, 2706..2722, 2724..2733, 2735..2735, 2739..2771, 2773..2784, 2786..2849, 3567..3677, 3778..3962, 4063..4227, 4328..4480, 4581..4663, 8217..8364, 11063..11176, 14554..14631, 14732..14827, 15120..15226, 17375..17444, 20988..21080, 21517..21612, 23454..23684, 25993..26047, 27862..28007, 40051..40131
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved