Dasypus_novemcinctus Locus SAP30BP
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SAP30BP
Dasypus_novemcinctus
SAP30BP
GeneScaffold_7599
SNORA26
13773..13894
29165
GTGCTACAATGCAGCCAGCAAAAATTCAAAAGCAGGCAGCTTTTGGTAACGTTACCTTT
CACTACAGCCATGATCGCACTCTCCTGTAAAGGCGTCTTAAACGAGTCAAACCCAAAGAC
CTTCTTCAATGTGCTCCGGACTCGACGCTCAGGGTCAAAAGGAAAGGAGGAAGCGTGGGT
GGTCATCTTGACAAGAGACAGTGGCCAAAGGTTAAGGCAAAGGTGATGACCATATGGTTG
CCGGGAGAACCCTCTGCTCTGCTTTTCGAAGGACAGCTATTTTTCCTTATGAGTATAAAT
TTGCTATATTACACTCATGTAATATAGCTGCGGGCAATCGCCTGGAGCAATGCATCCCTG
GGTAGGTAATTTACAGCGCCACGTCCATGCTCAGTGGAAAGAAAAAAGCTGAACCATCCC
AGGCCACGGTACAGCACAGAGGTAGAAGAGACACAAATGTCTTCGGCACAGTTTGGAGAA
CGTGGAGTTTTTCTAAGATCCACCTTCTGCACCTTTTTCGATAAACGCAGCCAAGACGAC
CAGACCGCGATCCTTCCTCCCACCCTCCAGAAACGAAGCCGTCTCCTTTCCTCCTTGAGA
CCTAAATCCGTTCTGTTCTCCCTTCCCCAGCCCAGACCTCCCTTCCCTCAATCCAAGATA
TCAGAGCCGGCGTGGGTCACCCGGGAGTGAAGGGCACTTGCCGGGCCGCTGCTACCAGCA
GGCTGGGGACCTGCTCCAAGAAGCCCCCTACGCCACCCCCAAATGAAGTTTAAGTTCAAC
TTGAGGTAAAAGCCGCAGACGCTTATATCCGTCGCGCAGTGATGACGTACGGGACGCGGC
TATCTGAGGGGCTGGGCCAGGCGTGGAAACCGTTGTTTTGATTGGCTCCCGGTCGGGAGC
GGGCGCGGGGTCTCCTGGGATCGGGAAGAAGTCGCCTGTCCACACAGAAATCGGCTGCTT
CTCAGTCCTGAGAGGGATCCTCCTCGGGCTGTGGGAATAAGATGGCAGGGAGGAGGAATG
TTCTGTCGTCTCTGGCAGTTTACGCGGAGGATTCAGAACCCGAGTCTGACGGCGAGGCTG
GCGTCGACGCGCCGGGCAGTGCGGCGGGTGAGGCCTGAGTAGGAAACTGAAAGGGGAGAA
TCGGGGGGTCCGGCGAGAATGCGGCTCCCCTAGTGGGACGAGAGGGAACGAAATAGTTTT
TGTGCCCCCAGGTTACGGGCCCGGAGCCTCAAAGCACGGTCGGGGTCCTGGGCGGAACAG
AGCGGTAGGGCTCTGGAATATGAATGCGCTGTCCCCTTCCAGTTGATAAGATGATTCCGC
TGATAACTTATTCAATTTTCTCCGTGCCGGACATCTTGCAGAGGAGAGAATTGGGCCAAG
CTTGGAGAGGGACCCGAGGTTGCTGAATCGCCCCCACTTCCCTCTGGTCTTTTCTTTTAA
GAGGAGAAAGTTGATGAGTTTAAAAAACAAACAAACAAAAAAAAAACCTGGAGGGTGTAA
AGGTTGTGTTTTGTTAAATTGTTAGCTTTTAATTAGAAGTGTGTCCAGACCCAGCTTGGA
ACTTTTAAAAATACGTATCTGGTCTTCACTACGAGAGTCTGATTCTGTAGATCTGGGATA
GGAGCTGGGGCATTTGTGAGCCTTTGAAGTCTCCCGATGATTCCGCTGCTGTCAGTTTTT
TAAAAGCCCATCAGAGATTTTGTTGCCTTTCTCAGTTTGAAAATCACAGTGTTAAAGGGT
AGAAACGGACTTTTTTTAGGAGCAGAGAGAGGGAGCCAGTTGCCTTATATCATTGTCCCT
TGGTTTCCTCATCTAGAATGTGAGGAAGGTTAGAGAGGTTAGCTCCTCTCCTATTTTGTG
GATTTGTGTAGTCTCCTCCTGTCAGGAGGTTCTCTGGTGATTTCCCAGTAATAGGAAGTT
TTTGTTTGTTTCATTTTGTTTTTCTTTTGCCTTCCACTTAGAAAAGTGTGATTGAGAAAC
CCTTAGAGTGTTCCCTATTTAATGTTCTATTCCTGAGGGAGGACTCACAAAATTAAAGAA
CACAGGGTTTATAGGTCACCATGATACAAGGAAGAGAGGTGCATGTCAAAAGAGGTGCTT
TACAGGAGTCTGAGGTGGCTCAAGCAATTGAGTCCTTTTCTTCCACACAGGAGGTCCCAG
GTACAGTTCCTGGTGCCTCCTAAAGAGAGATGAGCAGACAGAGTAGACAGCAAATGGACA
CAGAGAACAGACAGCACAAAACAAGGGGGGCAGGCGTGAATAAAATCTTTTTTTTTAAAA
GGTGCTTTAATAGTTCAGAGAAGGGAACACTTCAACTGGCAGAATAGAAGAAATGAAAGC
ATTAGATTCAGAATTTAGTACCTGGTTTTCTTCCTTATTTATTCTTTAATGATTGTTTCC
ATTTAATTAGGGCCTGTCCAAGAGTGGAATCTGGACCTATGGTCACCTACACGAGATTTG
GGTGCCCCTTTTATCTTCAGAGTTGATGTGACCACCTAAGTCACCAGAGGATTTTCTTGC
AATTTTTTTCCCCTTTCATTTTTCTTTTTTCCTGTTTCAGAGGAGAAAGGTGGATTGGTA
TCTGAAGCCTATGGAGAGGATGACTTTTCTCGCCTCGGAGTTGATGAAGATGGTTATGAA
GAAGAAGAGGATGAAAACAGCAAACAGTCGGTAGGTAAATCTTTTCACAAGTCCAGGGCT
GTTCAAAGCACCATTTCTTTTGTCAGGAACTTTCTATACTGTATTCAACCATGTTCCATT
TCATAGCTAATTTAATCACTTTCCCTCTTCCCCACTTTTTGGGATCAGTTCAAGAAACTA
GGTTAAATGTTAGTAGTTCTCTTTGAAAATCAAGTTTGTCTTCATCTGGATCATTTTGTA
TTGTTCAGTTGAAATTTGGAGGAAAAAGTAGTTGACTAATTTATGTTGGTCTTCCCTTTG
TATTCCATATATAACAGTGCACTCATCCTAATGTATCATTTATATTTGCAGTCAACTCTT
TTATTTTTTATCTTGGCTGGGGCTCATTTAAGTCTTTCAGTTGATTAAAAAGGTGTTAGG
AAGGAGAGTTTTGTTTTTTGTTTTTTTTTTATCCATTTTGATCTATCTTGACAATTTATG
TGGCACTTTTTATCAGAGTGCCTTTGATTCTTGATCACATATCTTGCCCGAAGTAGGTCT
CGACTAACAAAGAGGGGAGAACTTGTATCTTTATTAGCAAAAAAAAAAAAAACCTTAGAT
AATACAGTCACCTTAGCAGCATGAGCCAGAATTTAAAAGTTTGGAGAAAGAGCAAGGAAA
TTCATACTGATGCTTAGCAAAAAAGCAGACACAAGACCGTTGAATCGGAGTAGAAAATTT
GGCTATTTAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTACATTTTTTAGGGAGATAACTTTCATG
CCCTTTACCCTGTCCATTAAGGCTGATAATTCAGAATTGAATTGACTGAAATTGTTTAGA
AAAGTTTTGCAAGTTTTTTCTACCTGGCTTTTCTATGGTACATACATACTGATTTAACAT
CCATAACTATTTTTAAAATAAATTTGCATAATGCGCATTTTTGCAGAGTTGTTCCATATT
TGCTTTGCTTAAAATTTCATCATATTAAGCCTTCATGTTTTAGTAAAATTGTCTCATCAA
ACCCAAATGTATGTTGTAAAATGTGATTGTATTTGGCTGAGCTCCATCTGTGGTTATATT
CGGCATGTTTGGTTTATTTTAAGGAGGCTGTAGAGATTGTATTTAACATCTTTTGCTCAC
TGGCACCTTAAAAGACAGTTACATCTTGAAGCTATTATAGTTTCTTCAGGTCTCTTCTGT
GTGTTCACATTAACATCTGGAGTGCAATTTAATGTTTGGGGAAAGTGTAGCTCGGCTGAA
AATAGCGGTTCCAAATGTTAAGCAGTTCCAAATATAAGTTTTTCCTGGTATTTAAAGACT
GGGGCATCAGGAGTGTTCTGGGTAACGGAACTGACATTCCTGCAGCCTGCAGGGTGACTG
GGCTGGCATCTGCTCCTGAGCTTGGGTACCCCTCACTTCAGCAGGGCTGCTGTGCAGAAT
GGTGGGTTAGCTCACGTGTGTCCAGGACACACCTTGGGGACTGCCTTGTCCACAGGGTGC
TTTGTATCAGGCAGGCCTCGTTTGGATAAGGAACAAGGCTGGATAGGGGGAGTCAATTGG
CAGTTCTCTGAAAGCTTGGTTGGAGGGTAGAGCCTGCTGACCTGAGACACAGGGAAAGCT
AGGAACTGCCCTTCAGTGCTTCCTTTGCCGGGTCATGCACCCTGGTCACTTGGTGGCTGC
CTTCCTGCTCTTCTTGTTTGCTTAGTACCCCTGGGTTCAGTTGCCAGGGTGTAGTTGTGT
GTGGTCCCTGGCACTTTAAGGGTGAATGGTGTTACGGGAGGACAAGGCTGATGTATTGGT
GTGTATGAAAAGGAAAGCAGGAAAAAAGGGTTCATCATCCTGGTTTAAACGGTTGAATAT
TAAATTGGAGACACTGTGCCTGTTTTATCCTGTGGGCCTGATCTTGCTCTTTTCTGAAAC
ATGTTGCAGTCTTTCTCCATTTTTATGTGTATGTTTTAATCTTGGGCATTTTCCTTAGCA
TGGACTGTGGCACCCCTAAATAACTGTTCACTTTGAGATACTGATACTCTTTTCTCAGAA
CATCTCCTTTTCCCCTTCTCTTTCTCAGTTCTGTGTCATACAGTAGGGGAGGGACCCTTG
GTGGGATGACCCCAGTGGGGTACCCGGGCTGTTTGCTCCCACCCCTAGTTATGCATGTGA
AGACCCTCAGGCCCACTCCTTTAAGCTTAATCCTGTAAATTCTTTGTCTTGTAGGAAGAT
GACGATTCAGAGACTGAAAAACCAGAGACTGATGACCCAAAGGTATTTGGTGTTTACTGT
GGTGGGTGGCTGGATGTGAACAAGGCATCTTAACATTATGGCTCAGTTCATATGTCTGGT
CAGAGTTTGTCCCACTGACACTGTGTGCAACCACACATAAATTTTCTGGGATGAAACAAG
CTTTATAAAGAAAGAACCTGGGACCACCCAGGAATGAGTAAGTCCTGGGGCAGATGGGAT
TCCCACCCTCGCAGATAGTGCCATGTCTCCAGGCCAGGAAGGCAAGCATTCTGGCCAGGT
GTAGCATTCCCCCTGCAGTTTGCATCCCTGGTGGAACTTTGTGTGGTCACTGCCCATCCA
GGTGGGTTAAATATGAGAACATTTCTAGAATCTCTCAGGGAGCCATTAAGGACTGGCTGC
CTTGCCTACTCAGGATTGTCTTTGGTTTTTTAGAAGGGCTGACAGAGTTCAGCCCAAAGG
AAGGCTTCTCCCCCAGCCACCTGGGATTCTGAGCATAATCCTTGTTTCCCAGGGTTGTGC
CCTTCCACTCTTGGATGAGCCATGCAGAATGGCATTTTTTTAAATGACATAGCCATTTCT
TCTTGAGGTTCCATCCCAGTAGCAGCTGGGAGTAATTATTAATAGCAGTGCTTCCGCTCA
TGCTCCCTGATGGTCCTCTTATGACAAATGTTAAGATCCCCCTTGTGTTGGTAAGATTGC
TGTACCATGCACTGGGAATCAGTGAAAGTGTTCGTCTTGAAGAGACATTCTTTAGGGGAC
CAACTTTTTTTTTTCCAGAGGAAAAAACTAATTCCATCTGTCTAGGCCTAGGGGAATAGG
GACTAAGTTTTGTGGTTAAAAATTGCTTTGAAACCAGTGGAAGCCTTTAAGGTGACCTAG
CAATTTAGGAAAATTTTGCCAGATTATGATCTAAAACAGAACCTATATCCTAAAATACGG
TATGAGCTGTCCTAAATATGAACTAATTCTGTTGAATAAAATGTGAAACTATTGAATTAA
CCCCACGCAGGGCTGTAGATGCAGATAAGAACACATTTTACCAAGAAAGAGTTTGGGCAC
AAAGTTTCTTTCTTCAGTATGCAGGAAAAGGAAAAAAATTGGACCCTAGAAACTACAGGT
GCAAACTCCTTTCTGTGCTGAGTTAGGAGCCCAGGTCTAAGAACTTTCCCAGCCTTTTGG
CAATAGGCTATGAGGGTGGACTGTAGGCTTGTTCAAGGACAGACAGACACTACTCCCCTG
GCTTACGGGAAAGACGACCACTAGTATATTCTTTTGTCTTAGTTTTTGGGATGCGTGGGC
CTGAGAGCCTGTGCATAAAACAAATCCAGGGGAGCCCCAGCTGTGGTACATGTACTGGTT
TTGAGTATGGGGGAAAGGAGGCATTGTGGGACCTGGAGCCTTTATGTATACAGTTGCCAG
CCTTTGCCTAACTGGATGTGTGCATCTCATCATCACCCCTCTAATTCAGCCCTCCAGACA
GTGAATCCTCTGGGGTGGCATGTTTTTATGAGAGAGTGCACCACAGGAAAAACAGCAGGT
TTTACCACTGTCTGCAGGGCGATATTGGGACTTTTCTATGCCTGTGTGCTTAGCCTGCTC
GGCTGCCTCCTTCTCGTTACCTCTCCCCCATCAAGGTTGAAAAAGCCTGTTACTTAAGCT
TGCACTTCATCCAAAGTGCTTGACTGTACTTTATTCAGTCCTTTTATGTTAAGTCTTGTT
GTGGAAGAAAAGTTCCCATGGAACAACTCCCATTCCTATTGAGGAATTCTCCAAAATCAG
AATATAGAAAATCCAGCCCCCGAAGTAATTTAATGTAGTTTGTCTGGAGGGCTCCCATGG
AGAATTTCAGGCAAAACTCGCCAGCTCCCATGCCCTCAAGTCCCCAATAGCTAACCAGAG
GCCCACGAGGGGGGTGAGTGGGATCTTCTGAGATACTGTTGCTTGTATTCTAAACCCATA
ATTGTGAATATTTTGGAACACATCTCTGTTATTTCTGCCTTAATCATTTGAAGGTTCTAA
CAGGATATGTTACTAGAGTGGATCTCTGTTGGAACTTATTAGCAAATGTATTGGTGTCAT
AACTCTCTTCCACTAGATGGCAGCCTCCTTCCTAGTTTGATTTTTTAAAGCCCGCTTTTA
ATTTTCTCAAGCATTTTGAGCATTTCCTCAATTAAAAATTGAGGATCCTGGAGAGCTTTG
GATCATTTTTATTTGAGCTATTATCTATTGATATTTACTATTTTCAAAGTTAAAACTGAG
GAAATTTCAAAATATTGATTAATTTACTTTAAAATAACAATAAACCTATAATATGTTAGC
ACAAATAACATTTTTTGTGAAAAATAACTATTTCCAAAACAAAAAATTGGGTGTGAAAAG
TGGCATTGTTGTAGCACTTTACAAATCTCCTAAATGCGTGCCTTAATAGAAGACAGCTGT
ATTCTCAGAGCTGCTTAACAAGTGGTAGGTTCCGAAAGGATAGTTGCAATATGGAACCTG
AAACTTTATCAGTGAACATTTTTTACCCTGCTTCATTAAAATCCATTGATCTATCTTATG
TTTTGAATAGATCTTCTACCCATACATGATTTTATAACATCAGACACTGGTGATTTGGAA
AATGTTGGTTCACTGTGTTATGCAGATCTAAATGTGGACACATTTCATTATTTTTTAGAA
GGTACCAGGGATCGGACCCAGGACCTAATACATGGGAAGCAGGCGTTCAACCACTGAGCT
CCATCTGCTTCCCAGTGAGAGTTGGGTTTTGTTTTGGTTTGGTTTGGTTTGGTTTTTTTT
TTTTTTTAGGAAGGACCAGGGACCAAACCTGGGACCTCGTACATGGGAAACAGGTGCTCA
ATCACTTGAGCTACATCTGCTTCCACATTTCATTCTTTTTTTTCCCAAAGATTTATTTTA
TTTATTTCTCTTCCCTCCCCCCTGTTGTCTGCTCTCTGTGTCCATTCGCTGTGTGTTCTG
CATCCGCTTGCATTATCAGGTGGCACTGGAAATCTGCATCTCTTTTTTGTTGTGTCATCT
TGCTGTGTCAGCTCTCCGTTTGTGCGGCACCACTCCTGGGCAGGCTGCGCCTTTTTTCAC
ACAGAGCAGCTCTTCTTGAAGGGTGCACACCTTGTGCATGGGGGGCACCCTTCCATGGGG
GTGCCCCTGAGTGGCATGGCACTCCTTGCACGTGGCAGCACTGCACGTGGGCCAGCTTAC
TACACCAGTCAGGAGGCCCTGGGGGTTGAACCCTGGACCCTCCATATGGTAGATGGACGC
TCTATCAGTTGAGCCACATCCACTTCCCACATTTCATTCTTTAGTGTCAGAAAAATCACA
TTTGTTTATAACATCAGAAATTTCATCAGATAAGCTATTAAGTATTGGAAAGCTGTCAAG
CTCACAGTGGGGAGTATACATAGTGCTTGGAAGCTTGATTTTGTCATTGCCACTAAGTCC
TATCAGAATATTCTTTCAATTGACAGGCTCACTTTGTTCATTTTTGGGAGAATGCCTGCC
AAATACCCACATCTGAGTAAAAATAGTTTGTTAGTAATTCTTTCAAGTAAAAATAGTGTT
CTGTGAAGAAGATGGCTACTACAGCTGTAACTCAAACAATGACATTAGGGCTTTCCCTTG
GGACAGTTGTCACACATAAGTGTGCAGAAGTGCTTATGCATGCCTCCCCTTTCATCATTC
AACATTAATCATTTTTACTGCTTCATCAAGGACATTCCTAAGTGAAAGTGAAATAGGCTA
TTTTTTAAAAAGTGAGAGTACAATAACAACTACTACGGTTTGATGTCACTGCCTTGATTT
GTACTAAAGGGACAGTAGTTCTGTCCTTTGTTCAAGTGTCAACACAGCAAAAAAGACAAA
TAAGGTCTTAGTAATTTTGTGAAAATAGTTTTGACCTTGTGGACCCTCTAGAAGGTCCAT
TCTAGAATAAACATCTTAGGTCAGCAAAACCGAATCGTTGTTTGATAACTGTTTTCATTG
CTCTGTAAGTATTTATTAAATTGTTAGCTTTATGGGGACTTGAGTTGTGTTGGGAGCAGT
AGAGTATCCAGAGTCAGATAAGTTAGCACAGCATAGTGGGGAAAAGTTTAGACTCTGAAG
TTAGAGAGACCTGGGTTTCAATTCTACCTTTGCTTGTCAGTAATAGCCTAGTGACTCGGA
GAAGTCACTTTACCTCCCTTAAGCCTCAGTTTTTCTCATTTGTAAAATACAGGTCATAAT
GGTGAAACCTACCTCACTTGTTCATAAGATTAACTAAGTAAATGTAAGTAAATCTTTACC
TTGACTCAGCATCTGGTGTCTGCTCAGGGACATGAGTTGCAAATGCCTGCTGCTACCAGT
TCTTCTTTGCTCATTTCCCAGGCTTGTCAGACCATGTCATTGGCTGGTTTGAGAATTATG
AATTTTATGTTTTTAACTGGAATGTGTTCAGAGAAACATGATCATAAAAGTCAGAGGAAT
AGAAATCATAGTTTGTATGGAAAAGTTCAAGGAGCTGGAAGAGAGAAGACTTGGGAAAAT
CTAGTCATTATGGTCAGAGGTTGGAAGGACAGGTACGGGAAAGGAGGTGGAGCCAGGTGC
AGAACTTGAAGCAACATATAGAAATTACATGGAAGAAGTCTGCCTTCACATAATGAGGAA
CTTTTTGTCATCCTTGGCCAAAAGTAGGTTGAGCTGTTTTGAGGTAGTAAGCTCCCCATT
TCTCTGTTTTTAAGGCGGGTTTTAAGAAACCATTTGTTAAGAACGTCATGAAAGAATTGT
GTGGGGTGGGGTTGGACTAAACTGCCAAGGGGTCCCTGGGGCCCTCCTGGGAAAGGACTT
GCGGATAAGGCATTTTGGATAAGCAAAATTGAGTATTCTCTAAACTGCTTTCTAGTGACA
ATACAAGTGCTGAACACCAGCACTGCAGAAATTGCCTTGATTTTCATCATTGATGTTTGG
AGTTAGGTTTCCGTGAAAGTCCCATATTTGAGAATTTGAGTAACAAATGATAATCCCAGA
CCCAGCTCTGCTGGGAGCCTTTGGTCTGTCAGCCTGAGGTGGCAGGAATCAGACCTGCAG
TCATCAGGTTTGGCCCAAACTAGAGAGGAGGAGGTTGGAGGAGGTGGCTGACGTTCCACA
CTCAGTTGCCTCAGCACTTCTCTTCTTCCATTGTTTCTGTAACTTCACTTCTCTGGTCAT
ACCACCGGCGTCAACAGCCCAACTCTTACTGCTTTGATTACTCAGGAGCAGGTGGCCCTG
CTGTTCTAGAAGAAGTCAGAGACTAGAAGAGGCAGTCCTCCTTCTAGCTCCTCACTAAAG
AGAAAGGGGCGCCTGGTGGCTTAAGCATTTCCTCCATCTTTTTACCCTTGGCATGCCTTT
TGCCACTTTCCTTTGTCCATGTTTTGCCTTCCTTGCCCTGGAACATTTTCCCTTGTTTAT
GTTTTTCTCCACTCCTGCATTCCTGTGGATGAAGGATTTTCCACTCAGTTATTATCCCTG
ACACACCCTTCCTTTGAAAGCAAACATGGGGGTTGATGGCCTAGAGCAAGAAAGATGGAG
CAGCCTGTTGCCAGCTCATGGGGAGGGCTGCTTCACTGTGGGACTGGGGTTGCCGGCCTC
CCCAAGGTGTCGTTGAGGCTCTGACCTAGGCGAAGAATCCTCCCGCCCTGCGGAGCAAAC
ATCTGTAAAAACAAAATAGCATCTCGGGGTCCGGGAGGGACCATCAAGTGGGGAGCAATT
GTTCAGGCATTTTTAAAAGGTGTGTATAACCCTAGTTAAAGTAAAAGCAAACCTTTTCAA
AGTTCATAGTGCCTGAAAGGACAGCTGAAATGCTGAATTCACGACATGGACGGGGCGGGC
TGAGCACTGGCTGGCTTCTCACTGCCTGCAGGACTACAGGCATGTACTTGAACTTCGCTT
GGCTTCCTTGTGATGTGAGGGCTGTGACGCCTTCTTTACAAGATTGTTGTGACTATGATA
TGAAAGGGTATGTGTGAAAGGGCCTTTCACGCAATTAGTAGTAGTCTTTGGCTTTTTCCA
CAAAACAGTCGGCTTGTACACCCCCATCCTGTAGGTCAGAAGTTCCATACTTTGTTCGTA
GTGCCCTGGGTATCTCAGGAACTTTTTCACAAAGCTCTTAGACCAAATAAATACTTAACA
GTTCTGTTTATTAAGTAATTAACTCCAAAAACCTTAATATCAGTAGCTGCTTGAGAAAAG
AATGCATGTAAATTTGTGCAGTATCCGATAGATGTCAAGAATTGTTGTTTCCCTTGATAA
TTTTGACTATCCTGTGGCCTTTGTGAGTGTGTGGCAGCACCCTGAGATGCTGTATATGTC
AGGGTTCTTCAGGGAAACAGAGCTGACAGAATGTCATACACATAGTAAATATTACTAGAT
TTGTTATAGGAATTTGCTCACATGACTGTGGAGATGGACAAGTCCAGATTCCACAGAGCA
GGCCATAAGCTGGGAACTCTGATGAAGATTTTCAATGAATTCCCCAGGAGAAGCTGACTA
ATGAAACTATGGATGGAAATTCTGCCTTTTAACCAATGGGATCATCATTTCTTTAACTGA
CTGGATGAGACTTTTCTCATTGTCGAAGACTTATCCTCAAATGATTGCATCTTCATAGGT
GCAGTCAACTTACGAATGACTTAAATTCACGAAATACTCTCACACTAACAGACCAACGCT
TGCATGACCAAAGAGCTGGGCACCATAACCTAACCAAGTTGACACATGAACTTCACCAAC
TTTTGCATAGTTTGGGAACTGCAGTGACAGGTCATCTTGGAGTTCCGGAGTGACAGGGCT
TGGTATAAGTCCTCACCCTCCCTTGGAGGCCTGGTTCAGTGAGTGGATCTCTGTCCCCAG
TGGCTGTACATGCATGCTCTGACTTCCCCTAAGGAGGTCAAGTCCCTCAGGCACCATGCG
TTATTGACTGACTCAGAGCCTAGATGAAGGTTTTGTATCGCACTGACCTGACTCATTAAT
TCCCTCACTTCTTCCTCTTTTTCAGCCCTTTCCCCCACGGACCCAGCATTATTATTGATC
TTTTAAAGTGTCAGAATCAAAGCCCTTGTTTCCAGGAATTTGTTGTTGACAGCTGATTTT
AAGAACTTTCAGGAGCCTGCCTGCATTGTCATGTTGACAACACCACAGGTTGAAATCTTA
TGTTCTCTAGACACATGTCTGCTTTGGCAGAGTCTCTGCAGAATAGAACATCTTCCTCTT
TGGGCTCTGGGTATGTTTGCTATCTAGAAGTTCCTGAGGTCAAAAGGAAGATGCTGATGT
TTTCCATCCCCAGGTGGTGTGGCATTCTGTGTGGTGTGGGGTGGAAGTTGTTCTGACCTC
TGGAAGCGGGTTAGTCGTATGCTGCCACCTGGCAAGCTTCCAGAGAGGTCTCTCTGTGGG
GCAGCCTCCCAAGAAGTCACTTCGCAAGATGGGGCACCAGAAGTTACCTGTCAGAGCTTA
AACTTGGACTTTTTCTTATGGGTGTTTGACCTGGAAAGGATTACATGGCACTGTTTTCTG
GTGGTTATCCTATTAGAGTTTTGTTTTATTTTTAGATTGCACAAGTTTTTATTGTGAAAT
TACTATTATAGCAAAATTGAATATTTTTAAAAGAAAAATATCACCCAATACCATGACCAT
AATTCTCCAGCTATTTCTTTCAATCTTCTATCTTTCTTCTGTATTTATCTATAAGAGAGT
ATATATTTAGTCTTCAGTTTTGTTTACATGTGTATTGTAAGCATCTTCAATGTTGCTGCA
CAGTCTGTATAATAAAGCTGCTACCAAAAAAACTAAACACTTAAAAAGCAAATCTAATTT
TTTCTAAGTATCTCCAAATGGGGAAATGATTTTTTTAAAAAGTTAGTAAGACCTTCCAAC
CTTTGTACTAGTGTTACTAATCCTTAGCAGTAAACTTTTCCCATCAGTTTCCTCATTCGT
TCTCATATTTTCTTGAGTTAAATCCAGAATTAGTACAATATAGTAGCACAGTCTGACCAT
ATATATATGTATTTTTTAAAATTTATTGAAGTATATCATTCATACATAAACATACATAAC
ATCATACAGGACTCTCATAACTCACCTTACCACCAATAACTTGCATTGTTGTTAAACCTT
TTTAACTAATGATTAAAGAGCATTGTCAAAATATTGCTACTAAACAAAGTATTTCCCCCC
AACCAATCCTATTATTATCTTTGTATCATTTGTATATGAACATACATAAACAATTAAGTG
TATAGTAAAAGTTGTGAACTTACAAAGCAAGCATACATAACATCATACTCCACCAACACT
TTTCATTGTCATGAGACATTGTTACAAATTATGAAATAATATTGTCTGACCATAATATTT
TTAAAATAATTTTCTTTTGTTAGAGAACTTGTAGGTTACAGAAATATCATGCATGAAATA
TATGAAATACAGAGTTCCCATTTACCACACTTTTATTAACTCACTGGCATTAGTGTGGTA
CATTTGCTATTATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGA
TTAATTTTTATATATAGTATGGGATAGAGGTCCTTTATCGTTCTTTTACATATGCATATC
CCATTATCCCAGCGCCATTTGCTGAAGAGACTATTCTTTCCCAGTTAAGTGGACCTGACA
GCCTTGTCTAAAATAAGTTGGCCACCCTTTCCTGTGCCCTTTTAAGGTTGATTCAGTACT
TTAAGAGGCTAACACAGAAGGGTAAATTAAGTCTCCATAAAACCCAGAGTGGAGATGATA
AGACTCCTCTTTGGATCCTGTCTGGAGTCACAGCTGAGAAGAAAATAAGTAAATAATTAG
ATAAATAAATAAATAAATAGGTAAAAAATATGAGGGTCTATTTCTGAACTCTGAATTCAA
TTTCATTGGTGTATATATTTATCCTTGTGTCAGTCTGACTGTATTTTTGTGCTTGTTATT
GGATAAAATGCTGTGTGTGTCATTTCTTTCCAGTTAGTTTCTCTGATGGACAGGAAATAT
GCCATGTTCTTTCCTTGAGTCAGAAGAAAGACTCATACTTTAAAACTCATTGGAAGGCCA
CATGGCTACATACCCAGCAGGCAAGAAGGGCTCAGTAGGGTTTTGGATTTGGTAGTGTCT
CTTTTGTGCACCCCCAGGAATTCTCTAGGCTAAGGACAGGGGTGGTGGCATCCACAAACT
GTTCTATGATTTAGCCTTTAGGACCCAGCTCCTTTCAATCAAGTCAACTCAGTCATCACT
CACAATGATCTTAGTTACAAGCTATTAAGTCTGGAGTCTTTGCTCATGTCAAGGATTCAA
TACCTGCTTTACCCTGTAACCTGCTAGAGCATCATTCCTAGAGAGGTATTTTTCCTTCTA
GGTCTCTGAGTTGGCTTCCCCAGTGGTTTAACCAAGGGCTTCATAGCTGTTTGCAGCCTC
TTGGTCCAGAGGGCAGAAGTGAAAAGGTGGGAGCTGGTATAACTGGGCTTTGAGAGTTAA
CACAGACTTGGGTCTGAATTCCAGCATTCCCATTTATTGGGCAACCTGTTTGTACTTGGC
CTTGGTTACTTGCCTATAAAATGGTACTAATAATTTCTGCTTCATGGAGTTATTGTGAGA
CTTGGATGATGTATGTTAGCACTCAAAGGGACACTGAGACCAAGGACTGTGTTTAAGATG
TGGTCTGTGGGAGGGGAAATAAAGCTTTATTATTCTACCTGCCCGCCATGTTCTGCCTCC
CATAATCCATGATCCCTTGAGTGCTGGTTGAAAACACAATTACTGTATGACTCATCTAGA
ACCAAGGAAGAGGAAGTGGCATTTGACCGTTAAGTTCTGACCCTTGAACCTTTGAGAATG
CCCAGCCCTACCTAGCATTTGACATTTATGCCCTTAACCCAAGGGATGGCCTCTTTANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCAGCAGTACAAGCC
CCAACATACTTCCTTCCCTTTGGGGCCACATGCCATGGATTGCTCCCCAAGGTGTGGCTG
GGCCCCTCCTTCCCTAGTTGGGATTCATTTTTTTGAAATTATGTGATCCAGAAAGTTGCC
TTTTCTTAGGGCTCCAACACTTACCACCTTCCTTCTGTTTTTTACTTCGTGTCCCTTGAA
ATGCTCCTATGGATTTTTAGGTTTGATAGGATTTTGTTCATTTGTATTCCTAACTTTGGA
GGCAGGTAAGTATTTCCTGAGCAGTACCTTGAAGATACTGGCATGTCTCCTGATCCAATG
GACCATTAATTCCTGTTATTACCAGTATGGTTTGCCCTCTACTCCCTTGGCTTTCTGCTC
TCCATTATTTTTGCCCCCAGGGTTAATCTGGCCTGTCAGCTTAGCTGCTGATCTTTGGGG
GGGGGGGGGCTGCTTTTGTCTTTTGGGTGGCCTTGTATCCAGTGCTCCATTAAAGCAGTT
ATGTGACTCAAAAACTTAACTTTGCTGTCCTAAGCCTGGTAAAGCTGTCTCCTTAGTCCT
TGTCTGCCTCCAACCTTCCCTCCTAAAATACCAACTTGAAGCAGAGACACTGTACTTGTG
GGAAACCTTTAAGTAAAAAGCACGGCCAGCTACCTTCCCCACCCCAGTCTAGGGATTGAC
TCAAATCCTTCGTGTGTGGGCAGCCCACCCCTGACACCCTCGAAATGGGGAAAAGAGAGG
ATTGGGATGATTCTCTCAGTCCTTAGTCAAGTGTCCTTAGTCAAACCTAAGCTTACCCTT
GGAATAGTCTGGTAACAAGTCTCCCCTTTGGACGTGACTCCTGGCCAGAGTTTTGTGTTT
ACATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAGCTTTCGGACT
GCGCACCAACCTCATGTCTGCCAAACCAGAGCAATTTTATTCTGGACCTTAGTGGTATTT
TGACAGAGGTAACCCAGAATTGCTGCTTTCTTGGTGACTTGAAGTGACTCACATCCATCT
CAGAAAAACCTCGATCTGTTTTAACTGTCACTTTGATGCCCCCCAAGAGGACTTCCTAAA
CCCAGCGTGCCAGTTGCTTCTGAAGAGGCAGTGCCTTCTGGTGGTTAAAGAGCACAACTT
CCTGGGCTCTTGTGAGAATTAAATGAGACCATTGATTGAGGTGCCTAGCACACTAGTCCT
AAAGTGTAATTTATTCATGTTATATCCTGGTGCTTGGCCCATTGCTTGATACATAATAAA
TGAGCAATAAGTTATTTGTGGAATAAATAAATGAATTGACTGTATATTAATTGTTTTTTT
GACGAAGGATTTAGGAACTGCAGGCTCAGTGGTTAAGAAAAGGATGCAGGAGGAAAGGTG
AAGGTTTGGGTTTAAAATTGTTTAAGTATTGCACCATGTTGCCACCTTCTCTCCCTCACA
GCCGTCTTTGATTGCCAGTGTAGTCCCTTCATTTTAGATCCTGGTCTGCTGCTTCCCTTT
CTGACACCAAGTCCACATGGTGAAACTAAAGCGAGCAGCTTTGGAGTTGGGGGTTAAAAC
ACTGCAGCCAGAGTCAGCTGTGTACAGAAGTAAAGCCGAAGGCTGGCAGATTAGAACAGA
GAGAGCGAGAGAGTGTGTGTATGAGTGTTTCATCAATATTTGAGGGGGACCAGGCACTGA
CTGTCCCAGGTGCTGGGAGCACAGTGGTGAATAGGGTTCAGGAGAGCATAGAGTGGCAGA
TTTGTCCTCCTTGGCCGGGAGCGGTAGGGTGAAGGAAGGCTTCTTTGAGCTGAGACCTGA
AACCTGCATGGGGCTCACCAGGCGAAAGTGGGAGAGGAGGTGTTTTGGGGAGTAGGCAGG
GCAAAAACCCTGGTGCAGGGAGGAGTGGGGCAGCTCTGGGGAGCAGAGGGATGGAAAGAT
GGAATTGGTCGCAGGGACCAGGTTTGGAAGGCATCGGTTGACTAAGCTGCCCTCCCAGCT
GCCCCCTCATGGAAGCTGCAGGGTTGCCTTGTCCTGCAGAAGATCCTGGTCTGTAGCGTT
CTTGCTGCTGGCAGCGGGAAGAAGTCACCTCATGCTCTCTGCTCAGAAGGCCCTCTCGGT
GCCTAACATTCCCAGAGTGGGGACAAAAAGGTGACATTGAAATTTGGTAGCATCCAGATG
CCTGAGGCTGCCTTTGCTGCTGGAGTTTTCGGGTGTGCTTTGTGGGGCTAGTTCCAGGAA
GGACTGATGAAGCATTGTTGGCTGTAAGTAAACCTCCATTCTCTCATCCAGGATTTTGTA
CTTCTCTGCTGAGCAAATCCTCCTGTCTCAAATAGCAGCTTATCCAGCTTCATGGATCCA
CATTGTTTTTACTTCCTTCCTCTGCTCCAGCCACAGCTTCATTGGTGGCTGGACTTTTAT
ACTCTCTGCAGGGGAACCCACATGCCAGACTCTGTAATTCCCCATCCCTGCCACTGACTT
ACAGCCAAGTCTCTGCCACCATTGATTAAGAAACCAAAATTGGCAGGTGGGGTGTGTGTC
CTCGGCTCAGTGTTCCCTGAGAACAGCCCCCCACTTGCTGTGGCCACCTAGTGCTCTGAT
GGGGGTTAGTGTCAGGTGAAGCTGGGGGTGGAGGGTGGAGGCAGTCAGAGGAGAACAGCC
TTGCCTCAGAGTTTGGTGTCTTTGACCAGGTCAGCATTTGAACATTTCTCATTCTTTCCT
CCCTTTCCCATCTTCTCCCTTGGCTTGTGTTGGGAAGCTGTGGGTTGTTTTGTTTTCTTT
TACCTTGTTTTTTTTAGTTGAACTTGAACTAGGGAGCGGAGGTGGTCTTTTCTCCTAGGA
GCTACTGCTCCTTTCCTAGGTGAGATGCCTTGTTTTCATCTACCTCAGGAACTGGGTGAA
AATCCCTCGGTCTGTACTGTCTGATGGGTATGTGCTGTAGCCTTCAGGGGAGCTCCCAAT
TACGTGTCTCTGAGCTGTGGGTTCCAGGCCTCCCCATGGACACAGACACTGTCTGGTAAA
TAGAGCCCTTGATCTGGCTGAGTTCATGACTAAACCAACTGAGAACATCTGCCTGGAGGC
CAGAGGCGTGGATTCGTAGAAGTCAAGACAGGTATCCCCTGTGCATTCCAAACACTGCTT
TGGAGAAAGGAAAGAGTGACCATGGTTTCTTGTTGCTTTTACTTGCATCCTTGTAACCCC
CTCTCCCCCAGCCCTTGTTAATGGCATAGTGAGAATCTCCCTCCCTATGGCAGCTTTTGT
AAAACTTGTTTCTTTATCTACTGGCCGTTTAATAATATGGCCCTTTCTTCTCTCTCCTTA
GCGCTGTCATTTTCAATATTTCATCTAGTGTTTTTTTTTCTGACACCATGGCTGGCTTCC
AAGATGACTATTCATGGGTATTGGGTTCATTTTCATACTGAATTCCTGATATGCAAGACT
GGTAGGAGGATGTCGCTGGGGGTCTTTGTTTTGAGTGTGACTTTTTCTCTGGCCTGGCTT
TCCTTGCCAGGTGGAGGCTCTAGGAGGTCATAATGGAATAATGTCATGATGGTGTGATTA
GAGGCTGCTTTTATTGGATGGTGCTTGACTGGCCTCACTGGACAGTTGAGGATAAATTGT
TCTGAAAAGCATCGTTGGGGCATTAGTCACCCATCCTCAGTGGTGTCTTGGCCAGACGCC
CTGCCTCACCTTCCTTGCTGAGCTTTTCTCCCAGTTGCTTGAAAGTCATGAGCCTGTGGT
TCTTGGCCCTTGGGGGTGAGGCTTAACCAAACTCTTCACCTTCGTGTGCTTACATCAGGG
TATGGTCTTTGGCTGCTTTGGCTGAGTGGACACTTCAGAATCTAAAATTTAGATCCAGAA
GAACTGCAGTTGTTGTCTGTCTCAGCAAGGAGTTCCTTCAGGGGAGCCTATCTGTTCCAG
ATTCCCACTTGGCACAGGAATACCAACACCTAGGGACTCAGCAGGCTCCCAGCCCAGCTT
GTTCACCTAAGAGGCTGAAGAATTAAATTCTAAAACATAATAAGGCATGGCCCCCATGAG
GCACAGACTTCCCTGGTTTGATTCTCCAGAGCCTTCCAAGTCCCTAGGTTGCCTGTGACA
TCAGTGGGGAATCTGAATAGATTCCAGAGTCTTTGCAGGGAACCCTATATGTGTTTCTGG
CCACTTCCCGAGACATGCTGAGTTGTATGGCTGCCATCTGAGGCAGGTCATTTATAAATT
TGGTTTGTTTCTGAAGGCAGGAGAACCTTCTCACACTTAGAGTTGGGCCCATGTTCCATT
GGTCGTTGCCTCACCCTGAGGCACTGAAAGTCAGGGGCACTGTGGAGCCAGAGTCCACTG
CTGGGGAGTTGGGTCAGCAGGACGTGCTTCTGTGGGTGTTGGGTTTGGGGTCAAGAATCT
GTAGCTCTGTGGGCTTAGGGTGCACACCCCACTCCTTTTTTTGTGCTGAGAGGATAGAAA
AGCCAAGACTAGACTAGGTAGCAAATTGAAACCATCTACTCAATTTGTCTTTCTATCTTT
TTTAGTTTGTTTAGTTTAGTTTAGAAAGATTTTGGGAGAATGGAGAACTGAGGGAAAAAA
TGGGAAGACTGAAGGAGAAGGGAAAAAAAGATACTTTCTGGCTATGATTCCAGACACACG
ACTAAACAGCCTCAGCTAAACCAGGCACGCACTTTGTGAAATGCAGGAACCCACCAACTT
CCCAGTTGCTGGGGTCTCAAAAGCTGCAGGAAGCTGACCTTTTGCTCTACCCCCAGCCCC
AGCAGCTCCTGAAGTAAACAGGCATTTTCCCCTTTGAAGCAGCTTTGCATGTCTGGTGAC
TAACTTCGTATGACTCTGAGGGAGACAACACTAGAATTCCGGTGTGCTATCTTGCCTCCT
TCCTCAGCCCGCTTTGTAGTCCAGGAGGAGGGGCCATGCTTTGGTAACGATGGCACATGG
AGGCCTTCAGGAGACCTTTAGGAGGCGTTAATGAGCCGACCCCTCCCTCTTCGTATCAGC
CAACTGGCTGGAGAGGGGGTAGTGTGGCCCCGTCTGATGTTTTCCCACAATTAGTACCCA
GAAAGTTGTCTCCTTGAGGGAAATTGAAGGGACATTTTACAGCCCTGCCTCTTGTTACGG
ACAATGGGAGACACTCATCTCTTCAGAGTCACTGCTACAAAGGGCTTGGTGTTGGTTCCC
TGAGAGACGGACACTCCCTATAAAGCAGCTGATTTGTGACTCCAACCTAAATTTGGTGCC
TTGCAGCCCTGCCCTCCCCCAGCCGCTGCACACCCTCTTTGCCCACCTGACAGTGGGAGG
GTGGCTGGCAGAGACGGGTTGCTAAGCAGCCTGGCTCGGACATCACGCCCTCCCAGGTTG
GATGAATAGTGCAGTGTTCAGAAGAATGAGGGGGTTTTGGCCTGTCACAGAGTCAGGAGG
GACTTTTGAAGGAAGGGGCTAAGAACAACTAGTCTTGGCGAGAAGCCATAGCTTGGGGGG
CGGGGCGTGGAGTTTGGTAGTCTTCCTTCACCATCCTCTCTAAAACCGATCTTGGTGTAG
TGTTTCTTCGTGTAAGCGGAAGGTCCACAGAGCTCTGGCTCCCTTCACGTGTGGGTCTTA
TTGCAGAGTTGTTACCATCTTATGAGAACTTCTTCAGTCTTACCTACTCCTTCACCACCC
AAAGGGAGAGGAGATGAAATCCACCAACTTTCTGTGGACTCAGCATTTGCCTTTTGATCA
TTAGCCTATGCTGGTATGGGGGTCTCTGATCTGTGTTCAAGGGGCTAGGTGTCAGCAGCC
CAGAAATGGGGCAGTGGAGGCAAGGCCCCATCAGTGTGCCCAGACCTTGGGGGGGGGGGG
GGAGCCTGGGGCTTGAGGGGAAGAGCCTACTCCGGAGCAGTCCAGAGCCATCTGATAAGA
GGCCTTTGCTCTTAGGGTCCTGCATGTGGCTGGCACTGAAGGACGTGTCAAGTTGGTGTT
GTGGGACAGCAGTTTGCGCTAAGGACAGGGGGAGCTTTTCTGTAGAGAACACAAAGCCAG
TGGGAAGAGCACTGTGAGGGGAGAGCCACGGAGAACCAGAGGGCAGCCATGGTGCTTCCA
GTCACCTACTGTATGCCAGGAGCTGCCTTTATCGTTATGATAAGTCTCCCTTCTTTGCTC
AAACTAAAGATCTCCTGCGAGCAGCGATCTTTTGTGTTTCTGTCGTGGGATGTAAATGGT
CTAAAGTAGTTGCAGGTAGAGGTGGTCGTGCTGGAGCAGGAGGGTGGCAGGGTCTGGAGC
GGTGTGCTCAAGGCTGGAGGTCGTGGCAGCAGGGTGGCAGTTGTGGCGGGACTGCTGGCC
TTTCCTCTCTTTGGCGTTGGTGGGTGTTGGTTACTCCTAGAGGCCGTGGAGGAGAGACTG
GGGATCCAGAGTGTCCCGGCCACTCTGGTGAGGTAGAAAGGGGGCTAGGAGGCTTTGGGG
TCCCGACAGGCCCCAGGAGCATTGGCTCACTGTTGCTGTTCTTCACTGTTCATTTACTTT
CCTTCTGTTTTAAAGTACTGTGTGGTCTCAGTGGAGAGAGTGCCTGCAGGTCAGGAGCCC
CAGTCTCACCTCCTCCTATTTCTATTTCTCTTTGCAGGATAACGCAGAAGTAGAAAAGCG
AGATCCCCAGGAATTAGTCGGTGAGTACCCCCAGAGCAAGCCGCCAGGGCCTGTCTCTGA
GCCTTGCGCTGAGCGTGCTGGTGCCTGGCCACGTGGGCCTGCTCCTCCAGGGGGCATCTC
CGGTTCAGCCAACACAGCTGCTCTGGTGTGAGTGTCAGCTCTTATCCCTCCCAGGGCCGT
TGGTATTTCCCAAGATGTCTGGGTAAGACACCCTGGGAACAGTCCTTCTTTTAAAATCGT
GTTCATGGTGCATTTATTGGGCTTTTCGTCAGTTGCCAGTGTTGTCAAGAGGAGATTGAG
GGGCCCTGTTTGGCAGAAAGCTCCTCCTCATCTTCACAGCAGTTTGTCTCCATTATGCCT
GGGGCCCAGTCCTCTGTCTTTGTGGCATTGTCATGTTGCTCAAGGAGTGAACATGTTGCC
TCAGCTGGCACTTTGCTCCGTGTTCAGGCAGGAACATGCCTCACAGCCCTGAAGTCTGGG
ACCTGTGACTTGGGAAGCGCAGGGTGGTTATGTTTCTGGAAAACAGCACCCGTTTCATCC
AAGTCTTTGTTAACCCCCCAGCCTCTTCATCCTTTCAGAAAGCCCCTTGACTCTTAGTTT
GCTTGGGCTTTCTCACAGCTCTTCCAAGCCTGGCCTGGGAGCTCCCTCAGGTCTGAATCC
AGAGGAAGGTTGCCTCTCCCTCTGTGGCAGTCATTGCCGGCTCTCCTTGCCTAGCCCTGT
GACATCCACGAAGGCATTATACTGCTTGCTGTGGCTTTGCTTTGGAAGCACCTCAGACAT
CATAGCTCACTCATTCCAGCTATGGGAATGCTACTTCCTGCAGTCCCTCCAACTTGTCCT
TTCTTGACAGGGGTGGGCGGTAGGGAGCCCATTCTCTTTTTCCCTAACTGAAGGAGCTGG
AAGTGGCTCATAGTATTTGCCTGTTGAGAAAGGATTGGGTAGGAATGTGGCCTCTGAGCT
CCAGACCCTTAGCAGGTTTCGCCTTTATTCCTATGTTTCCTGCTGAATAGGGTTCGAGTC
TTTCCAAACTTAAAGAAGCCTTAGAGCTTTTGTAGGCTTCAGGAGTTCCCTCAGATCTAG
ATTTTGCTCTCTAGAAAACGATGCTTTGGGGACACAGTAATTAGCTTTCTAGGTGGATGA
TGCAGAGCAGATGCCTGCTAGGAACCTAGCAGCCTCTCTCCCACCCATGGCCTGCTGTTT
ACCCCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGAAGTTGATTCTGTGGGTAGATGAGCAGTTTTAGTAGCAGTATTTATCCAG
GGCTCGAAGCCTGGGGTGGGGACAGCAGGGATTGGCCTGGCCCCCCACGGGCTGGAGTGT
GATCACTCCCACCCAGCCACACACCCCTAAGGTTAGGTGTGCAGGTCTAACACAAAACCC
CACCGTCAACTCAGCACCATGCCCAGCTCCACGTCAACAGCTCTGTCTCACCTGAAGCAT
CAAGGGGCCAGAAGTGATTTTTATGTCAGGCCAATGGACTTTTCCCCTCCCCTCAGGAAG
CTTGCTTAGAACACAGTTGAGCCGGGCAAGATCTTAAAGATTCATCTCAGCCCCCGAAGC
TGGATGGTTCTGGTAATCTCTTGAAATTCAGTACCATGCAGGGGCCTGACTAGTGCCTGC
TCAGTTCCTTGTGGCATTCTTCTTCCAGCATTTACGAGAAGCTGATCCAGTTCTGTGCAA
TTGATGAGCTCGGCACCAACTACCCAAAGGTGTGTCTTGCATGGGGTTAGGGGCCGGGAT
GGGGGGATGGGGTCAGGGCTCTGTGCCAGCTCAGCTGGGTTTCACCTGGAGCTACAGGAA
GGGGCCCGGCAGTAGCACTGCTGGGCAGCAAGCACATACCCCTCTCTTTTGTTTGAGTCC
CTGTGGTTCTGAAATAATCCACTAAAGCTGTTCCCATGGCAAGCCTGGTTCTCTGGGCCC
CTGGCTAGTGGGGATCTGCGTGTGGACTCGAGGTCCTGTAGACCAGTGTGAGGGCTTGCT
GAGCATACCCGTACTGCATGAGCAAACTCCGCTTCCTAAATGCTTGTTGGCCAGGGCCTG
GGCTGGAGACTAGAGATGTCAGGGGGAAAGGACCCCAGGTTGACGAGTTCCCTGGAAAAC
TCAGAAGAAAATAGACCTCGTTTTCTAAGACATTTGTCATCTGGGGCTGTTTACTGACCG
CAGCTTTAACCTTCTCTTTTTCAGGACATGTTTGACCCCCATGGCTGGTCTGAGGACTCC
TACTATGAGGCATTAGGTAGCTTTCCATCCACTCAGTCAACATGTATTTGAGAGTCTCCC
TATGGCAAACTGTGTCTGAGGGACTGGGTATAGAGTCTTGAATGAGAAAACCGTTTATCT
CTGAAATAGCAAAGGCAATGGATGGTTGAACAAGTAATTCCACCAACAGTGAGGATTATG
ATGCTTGGGGTCCAGCCAAGAGGGAGGGAGGGCCTCACTGAGGAAGCCATGTCCTAGCTG
AGGTTTGAACTGTGTAGGGACTAGCCAAGCGGATGCCGGCATGTGCTGAGGCCAGTGAGA
GCAGAGCATATTCTCGAGGAGCCCACTTGGGAGAACTGAGAGGAATTTCATAGGAACCAA
GCTCTTAACCCACAGATCTCAAGCCAGCAGCCCCTGATCAGACCTGGCCTGAAGATATGT
TGGATTTGGCCTGCAAATGTTTTGTCTTATTTTAGTTTGAATTAGTTACTCACATTTTAC
ATAAAAATCCCTGGTTCCAGCTCCATCCACACTAGGCCTGCGTTCCCACATGGCATCTGT
CAGCTGGGGCTCAGGCTGCTGATCCCTCCAGATGAATGCTCAGAGCCAGCCCCCAAACCT
TTGGGCCTGAAGCCCCTGCTTTAAACAGACCGAAAGCAGCACCTCATTTTGTTTATTGTT
CTAAGCCCTTGAGGGCTGAAGGGGACTCTAGCCCTGTGAAAGAGCAGACAGGGTGGCTCA
CTGGACTGGGTTCCTTGGCCTAGAGTGCCTCCTGACATGACAGCAGCTTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCGACCAATGCCGCAGCTACCACCACCGCCACCGCCAGCACGGCTGTTGCAG
GTACAGAGCAATTGTCCTGGCTGCCCATGGAAGGCAGGAGGCATTTCCCTGGCTTTTTGG
GGAGGATGGGTCAGGAGGATTTGAGCCCAGGAGTCTGAAGACCAGCCTTGGAGCTGTGGG
TGGGGCCCCAGCCTGCAGGGAGAGGGCTGTGGTTGGTGGTTTCAGTTGGTCTCAGTCCTG
ATTTGCCTCTTATTTTATCCCCAGATGCCCAGAAGCGGAAGAGCAAGTGGGACTCCGCCA
TCCCAGTGACGACCATCGCTCAGCCCACCATCCTCACCACCACAGCCACCCTGCCGGCTG
TCGTCACGGTGACCACCAGTGCCAGTGGTTCCAAGACTACTGTCATCTCTGCCGTGGGCA
CCATCGTGAAGAAGGCCAAGCAGTGACCTGAAGAACTGGCTTGGGGCCAATGGGACATTC
TCCTCTCCGTTGAGGGAGCAGCCGGGTGACTGATGCCCCCTGGGAGGTGCTGCATTGTAC
ATTTCAGACTGGAACCTGCCCCTAGATGCCCTCTGTCACCCTGAGAAGAACCTCTGTTGG
ACCTTCCAGCCCAAGGGCTGGGGCCTGTGGACGGTGGCCTTGTGCCAGCTGGGGTCTGCG
CCCTATTAAAGCGCTGTATTCTTAAATCTTGGCATCTCAGCTACACTCTTCTACGGTCTG
TTTCCCAGCAGATGCACAAGCTCAAGTGCTCTGTGCATCTTTTTTTTTTTTTTTTTTTTA
AGATTTATTTATTTTTTCCACTCCCCTTGTTGTTTGCACTTGCTGTCTGCTCGTCTTCGT
CTTAGGAGGCACTGGGAACTGAACCTTGGCCTCCCATGTGGGAGGGAGGTACCCAATCAC
TTGAGCCTTCTCTTCTCCCTGTTTGTTGTGTCTCTCACTGTTTCCTTGCTGTGTCTCTTC
ATTGCATCATCTCGCCGTGCCAGCCTGTCAGCTGCTGTCTTGCTGTCTTGCTCATCTACT
GGGAACTGAACCCGGGACTTCCCATGTGGTGAGCAGACACCCAGCTGCTTGAGCCACATC
CGCTTCCCTCTCTGTGTCTTCTTGGTTGGAATTATTACCTCGGGGTAAAAACTGGGGGAA
CGAAGCCTGTGGCGCTGCTAGGCAGATGGTCATTCCCAATGTTCTGCCTCTTGGTGTGGG
CAGGGGGACAAGAACCCGTGCTCCAGGAGCAGCTGCACACTCCCCAGAGCCCTGCTCGGG
CACACCCAGACCTTTGAAGTCAAGCCAGTTATCAGAAGAGACAGAGCGAGGTCCCCGACC
TACGCGGGGAGCGGGGAGCAGCGCTGGCGCCGGGACTGAGGCTGCCCAGTCCTCGTCCCT
GGTGAGCACTGCCAGCAGGACCCGAGGGTGGGAGAGATGAATCACCTCCTGCTCAGCTCA
TTGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 2560..2669, 4974..5021, 22537..22579, 23868..23956, 24057..24148, 24688..24748, 25224..25275, 26833..26891, 27695..27779, 27984..28165
1001..1106, 2560..2669, 4974..5021, 22537..22579, 23868..23956, 24057..24148, 24688..24748, 25224..25275, 26833..26891, 27695..27779, 27984..28162
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved