Dasypus_novemcinctus Locus ENSDNOG00000009099
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000009099
Dasypus_novemcinctus
ENSDNOG00000009099
GeneScaffold_7175
SNORA70
3666..3781
11391
CTTGATCTGTTTATTTCACTGTGTACCACAAATACATGGCATATAGTAGACATTCAATA
AATATTTTTGAATGAACGAATAAATAAATGAGTAGAGGCAGAGAAATCTAAAGAAAGGAC
AACTGGAATTGCTGAGCGATTCTTTACCACCTAGGGCTTCCCTTCACTGCCTTCCACACG
CCGGAGCTCCTGGGTCCTTGACATACCCTCAGATAGCATATGGACGTTGCTTGGTTTTGG
AATTCTTATTCCCATGTCTGACCTTCCCAACCAGGTGTGTTGACTTCTTTCTGAGGCAGT
ATCTCTCTTCTCGTGGTGCTAAGATGGCCACCAGCAGTTCCAGACTTAAATTCTATGTAC
TTAGCAACTCCAGCTAAATACACCTCTTTCTCAATGGTGCCAGCAAAATTCCATAGCCTA
GTTCCCATTGGTGCAACTTGGGTCATGCGCCTATTCCTCAGCTCATCACTGTGATTCTGA
TTGCCCTTACCCGCCTGTGGAGTTGGATGGGGACAAGTCAATTCAGACCATGTGGGGCAA
GAGAGAAGGAGATGTAGTTCTCGAAAGAAATTTTGCATGCTGCTATCATAGGAGATGGAT
GGAATGTCTGGGAAGTCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCACAAG
AAGAAGTAGTACATGTTGCTCTCAGGTCTGTTTGACTAAACTCCTAGAGTTATGGGAACT
TTTTCCACAGCACCCTGCTCATTCATGTGACACATTCAGATTATCTGCATCGTCAAGGGG
AAGGAAAAGCAAAGGGGCAAGTTAGTATGTTTGAGGAGCAATCAAGGGAACCCTGTTTTC
AATACATTTTCCTTCCCTCGGAGATTATCTAGGGTTGACAGCTTTTATTAAAGGTACTAG
AAGTGCTGGATCCGCACAGGAAGCTGGAGGACACTGGGCTTATTGTCAGGACATCACAAA
AAGAACGAAGGAACCTGCAAAGCTTCTTAAAAAAAGCTCCACGGAAGACTACCTGGGACC
GTTAAGTATTGTTCTAATAACCCCTGGCTCCTTCCTACCACCTGGTGAAACATTCTAGGA
ATTACCATCCAAAGTTGCCCCATCTTTAAAATAATTATGGAAGCAAAAGCCATTGATTGT
ACCCTTTGGATGGATTGTATGGTATAAGTATATATCTCAATAAAACTTCTTTTTAAAAAA
GGTAACTAAGTTCCTAAAGAGGAGTAAGAAATCCCAGGTCCCACTCTGAGTAGTGCTTAT
TTCCTAAATGAATTATCCAGCAATGGAGCAGACATGGGTTGTGTCTACATGACCCCAGAA
GAGCAGTTTGACAAGAAGAAAGCTGAAGAAAACCTGAGTAATTGACATAAAATGGTTTTT
TGAATTATCTCAGGCAGAAATCCTTTTGTTCATTATTTAGGACTAGTAGTTGGTCCAATC
ACCAAAAAAAGAGGAAGAAGAAAGTTAATTCAGGGAATTGCAAAAAAGATACTTAGCACT
TTACTTGAAACATATTATTTACCCACAACTATATATTCGCTTGCTCATCTTTTAATGTAA
AACCTGTTCTTTGAGTATGGGTCTGTTCCTTGGAGTTCACAGTCATCTTTTCCAAATAAA
TTCACTGGTGATTCATGATCTATGGTTTCCAGTTTCTAGTTCATTATAGTGGAGAGACAA
GTTAGAGACACTAGGGAAGCAATCTGAGATTTTAAAGAAATCTTTTAAATGATTTTGCCC
ATACCTAATACAATGGTAATTTTTTGAAAAGAAATTCACCGTCATTGACCTTTCCAAAGC
AGTAAGCTCTGTCTTCATAGAAACAACTCTCTTTTGTGTTATCACGCTCTTGCTTACTCA
GTCCACATACTTTTAGATCAAATAATGTAATGCCTTGATATGTGTATTTGCTGTAAGTGA
CTGCATGTAGAGAATGGGTTGGGTTGGGGGTTGGGAACTGTAAGAGAAGAGTCAAAGACA
TCGGGTGAAGAGCCTGTTGTAACAATCCAAAGCAGACGAGTAAAATCTCCCAGACTTGTT
GATGGGCTAGATATTAGAGCTCTGGGACAGAGAGGTGAAGGATGCCTCCTGTTTGTCCAG
AGTGTCTGAGACTTTGGTAGACTTTAATTATTAAACACAGTAATTTCAGCTTATACCTGA
CACTTTGTTTTAATAAGTGGCACTTATAGCTTTAAAAACTGGCTTATAATTTAAAATGCT
ACATAAAATTTTAATTGCTACAATAATGATATACTCATCTTTTTTATATTGATTATGGGA
ATGCAATCTTTGAAAACTTAAAATACAGCTCATTTGAGCTTGGGAGAAGTTGTCAGAAAT
ATTTGCAGTATGTTCACCCGTCCCCACTATACTGTGAAATCCACCTGGGTTCACTGTGCC
TCGTATTGTAATTCTTTGATCATCTCATTAGCTTAAGTCCCAGGAAGACACCTGTGTCAC
ATCCAGGCCAGTGGCTTTATGAAGAGAAGAAGCCAAGCGAAACAGATTTGCTCCACGGTC
CTCTTCTTCATGAGAATGTACGCAAAGGAGTTAGTGACTTCTGCAACTGGGTTACTACTT
TTGTAAGTTGGTAGTGACACTTCAACCTAACCTACTTTTAAAAGTCAAGCTCAAAGATGC
TTTTATTTAAAAAAAAAATAGTGTTTGGATAAAACTGAAGTCAAATAATCAGAGTTAAAA
GGGAACCATCCTTCCTACCATTTATATACAGCTAGAAAATTCTGGTAGATGAAATTTCTG
GTAAATTTGCAAACTCGTGGCCAATTTGAATGTGTATGTTAATAAATCACCTCATTGCTG
TTTTTCATATTCTTATGTTCCATTTCAAGGTCAGGACCATCTTTGAATTTCACTCCTTTC
TCAACTCATTTTTCTCAGTTATCTTTACCCCATAAATTATTGGGCAACTATGACTCACTG
CAGCCCTCACAAAAAATACTTCTGAAATGAAGCAACTTTGAGTTATCAAGGTCTTCTCTT
TCGCCTTCCTTCCAAGAACCTATTCAGTTACCTAGTTTTATTCCTTATACCCTGAGATGT
CTAGATTCCTGATGCTTTTCTCAGACTTAATACCCTCTAATATTTGTGTTCCCCCTACCC
TAAATTATTTGAGTGTATTAGTTTTAGACAATGCATTATATAGGATTATTTCATTGGCAA
ATTACCTAAATACATTTCAGACTGGCTTTAGGGAAACCTCCAGAAGTATTGGGACTTCAG
GCATAGGTGGATCAAGGTGCTGAAATATTTTTAGGTGCTCTCCTCTATCTGACTTCATTT
TCAAGCAGTCTTTCACAAAGAGATGATAAAAGTAGCCACCAAAATCTCTGAGATTACATC
CTATCAGTGAGCAAACTCGGAAGAAAGCAACTCTTTCACAATAGAGAAAAGTCTTACTCT
CACTGGACTTGGGTCACATGCCTGTACTTGAATTAACCAGTATGCCTAGAGAGATGGAAT
ATGCTCATTGGCTAGGCCACGTCACATGTATGACTTGGAAGCTGAGTTGGGAGTGTTCAG
CCTAAACTGCAACACATCTCCCCATGGGGGCCCGGTGTGCAGTGGCTGCAGACAGCAGCC
TCCTTGGTAGTGTATGTGCCTGTTGCCTGTACAGGTTGCCCTCAGGGGCCTTGGAGACAG
CCCTTCCTTGCCTATTGCTGGTCCTGTCTGTGACCTCATGCCATCCCCAATCTAGGCTCC
AGACAGGTATGTGAGGTGGCTTTGGAAAGCCTCAGGGGACAGTGGCCCGGGTCCACATCG
ACCAGGTCATCATGTCCATCTGCACCAAGCTGCAGAACAAGGAGCATGTGAGTGAGGCGC
TGCGCAGGGCCAAGTTCAAGTTCTCTGGCCACCAGAAAATCTACATCTCCAAGAAGTGGG
GCTTCACCAATTTTCAATGCTGACAAATTCAAAGACATGGTGACCAAGAAACACCTCATC
CTGGATGGCTGTGGGGTGAAATACATCCCCAATCATGGGCCTTGGACAAGTGTGGGCTCT
GCACTCAAGAGGGCTTTGCCAGCACTGCCATCACCTGACCTGTGCCCTCCAATAAATGAC
TTCCTGGTCATTGGGGAAATAAAAAGAACCTCCCAGCCTAAAACAATAGCTAAGTAAGCC
CAATAAACCCTCTAGGCACCATGGTTCAGAGGACTGTTACTTTTAATTACTGTAAATAAC
CTGGACACTAGAAAAGATACTGCCCCAAATCTCCCAAAACAACAACACTCCCTATTGTTT
TTTTTTCCCCTAAGAAAGTGAAGAGTCTTTCAGTGTGACTGCTAAGGCCGCCTCAGGAAA
TGGCAGAGCTTTTCCATTTGTCTGCATCACATCTTTAGGTGAAATAGATCTGATAATTGA
AAACATTTGGAAACATGGACCTTAATAGATCCTGGAGCCACCTTGTCTGCCTTAAATCCC
ACCACCCACATTAATCTTCCTCCCCAGAGTACAGAAACAATTCCCTTGTTGGAGTCTCTA
ACAAACCCATGACTATCTATAGTTCCCCTAATTTCATTTCAACTAGTACCATTACAAAGC
ACTCATCAATTTTTATTAGTTCCATCTATCCCAATTTACCTTCTGGGAAAAAGATTTCTT
TGGATTATTCCAAGCACACATATCTTTCTCCCAAAAGGGGGAAATTAATTTGGAACTTTT
AGAACCAGATTCAGCAGACCAGGATAAGGAATTAAGTCCCACACACATTGGGACTGTCCT
TTCAAAGAAATAAAATCTAAATGCCTCCCTTTTTTAGATACTATTCCAAATTGCATTCTT
TCTGTCCCACCTATCCCTGCCCTCAGGGTCTCCTCCTAGACCTTCAACAAATCCAAAGCA
TTCCAACTTTCCCTCCTCCCAAAATCAAGCACCAAATAAGAACTTATGCCTTGCAAGAGA
AATTGGATTCCTAATCTTTCTTTGATGGCTCAATTTTTATATGTCTTTTAAAAGCTAAAC
AAATTTAACCCCTTTCTGGGATGAAATTAGTCAAATTTCCTTAAAAGAAATAAAGCCTAG
TTTGCTCAGCACTTCACCCTGGGACACCCTAATTACACGTAACACTTTTTTCTCCATGTC
CATGAATGATAAAGGAATGCCCTGGGTTTCCTTATAAAGACCAACATAGAACTCTAGCAT
ATTACAGCCAGGAATTAGATACCTTAGCTAAGGCACTACCCCAGCATGAGGTCCATTGCT
GTGATGGCAAAACTTTTAGAATCAAATGAAGAATTAATTATGGGATCTCCCTTGACTATT
TATGTGTCTCATTCTGTTGAAGCCTTCTCTACCAAGAGATAATTAGGAAATTCTTACTTT
CCTCTCCCAATATCTCCTTTGTTCATTGTCACTACCTCAACCTGCTACTTTGCTTCCTAT
TTCTGAGAAACTCCTTTAACTGACAAATTAATAACCTCTCAAATAGATTTTCAAGAAACC
CCAATTGAAAATGCAGATGTTATCTGAAATGCAGATAGTTCCCCCCTTAAAGATAACTCA
GGAATCTATCCCTTAAGATATAATATTACCTCTAACAATGTGATCATAGAAGTAAATTCC
TTATGTAATGCTACCTCAGCTCTGCAAGCTGAACTCTTTGTCCTCACAAGAACCTATATG
TTTGCAGCAGGAAAAATGGAATATATATACCAATAGTCAGTAAGCCTTTGCAGATGATTC
ATGATTGGGGATGTTATGGAAGCAAAGAGGTTTTTTAACCTCCTATAGAGGAAAAACTAA
AAAACTCAGCACTTACCTTAAGGAATTGTTATGTGCTAAACTATTACCAAAGTTTTGGTT
ATAATTAAAATTTCTGGTCACTCTTATGCAAATACAGAGGAAAGCACTGGCAATCACATT
CAAATACAGCTGCAAATTGTCCTATTATTCCAGTGTCTATAATGACTTTTGAACCAAACA
ACTCTATTGGACACATTTAGAAAATGAATTACTCCTTGATATTCAACAAAATACTCCTCA
GATAAAAAATGGAAAAACAATGGCTGCTTTTATAAGCTTGCAATTAAATCATAATTTAGC
CCTAATGGTAAACCAGTCCTCCCTGCTTGCTTCCAGAAAACTGCTTCAGAAATTATTCAT
AATATGTCTCACTGGAACACTGATAAAAAGAAAATCCTGTTTTTAAAGCCAATCCATTCT
TGTGCGTGTAACCCTATTGTAGATGGAGCATTTTGATTAGAACTTAAGGGAACTTCTTTT
GATTAGACCACTCCATTAAGGCACCACCCAGGGTGGGTATAAATCCTCTCATAAGAGTCC
TTTATAAATGGAAGAATAAAAAGCTAAAGACAAGAAAGAAGGCTGAGGAGACAGAGAGGA
ACCCAGAAGCTGAGAGGAAGCCACTTTACCCAGAAACTGAAAGTAACAAGGTGGAGAGGG
GGGAGACACAGTCTGATGCCGCTACTGTGCCTGCCATGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAACTGAGTGGTCTGGGAAGATACCACTAAAAAGGTGACATG
AAGGAGGGAGCCATGTGGGTATCTTGGGGAAGAAAATGGCAGAGGGAACAGTGAGTGCCA
AGGCACCGAGGAAGAGGCATGATGCGGGCGCCTGCAAAATAGCAAGGAGGTCACTATACT
TGGAGTGGTGGTGTCACAATGCTGAGTCAACCGGAGAAGGGATTTCTGTCCTGTTCTGCC
CCATTCTCTAGGATGCCCGACACACACCATGCCATAGTTTAAATGTAGGTGAAGGGAGAG
AGGGGCAGAATCTTTGTGGTTTCATGTTTCATTGCCGAAGCAAGAGCGAGGCTCCCTTTT
GTGATGAGACAATGCGTGGGCATTGTATCCACAGTATCAGGCTGTGAACCAACCCAAGAT
CTCTTTACACTGTTGATGAACTAATGAGAAATGGGAAAAAGAAAGGAATGAGATGTATTC
TTCCTCTTTCTATCTTCCAATTAAAGGGGCAAGAGGTTGGTGTTGGAATAGCATTTTGAG
TGAATGTAGTGTCTCATTTACAAGACTGAGCATGGTGCTGGGTTCCTAGCAAGTCCAAAA
ATTTATTTTCTTTGTTGACTGATTATTGCTTAAGGTCATTGTCCTTGGGTGAGATGTGAT
TTTTATATGATTTCTAGCTGCTTTACATACATTGACCCTTTAGTCTTCGACAACAACTCT
ATGGGATGGATACTATTATCTCCATTTTACAAATGAAGAATTTAAATAATTTACCCGTGG
ACTCGTAGCTACTAAGTGAGGATTTGAATTTGAACCCAGGTCTGTCTAAATCCAAAGGCC
ATGCTGCTCCTAACCATGACATTGTTTTCTCAATTATGAACTTTTCGTGTTGCCTTTGTA
AATCAAAACATATTGAAACATCATAAAATAGTTTGTCAAGGAAAAACAGTAAATTCAAAG
TAATGATACTACTTTTATAAACTAAATCTTAGATTGATGAAATGACAATGAAAGAACTAC
TGTTATTTTCTATAGAATCCTTATAAACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAATGCTGTGTACGGAGAAAGAGAACAACCCATGAATGATGTC
ACCACTCTCTTGCTGATTAACCCATGAATTTTGACTGTCTTCGAATGAATTTGTTTTAGA
AGTCAAACTGTCTTTAACTTTCTGAATTTCGAATTATGTAAATGTATACCATACATTCAG
TTTTGAAGTTCAAATAAATGAAAAGAAAAACTAAAGGTATCTACTATTATGCCCTTCAGA
CTTTAAGATCTATGAATTGTAGATAGGTTGTTAATCTCAAATAGGTTAGTTTTCAGGCAG
ACTAGGTCAATAATTGTCTAATCGAATTGCTTAAATTTGTTGCCTATTGTTCAGAGGGTA
AGAAAAAGGATAGGGGGAGGAGGGTAAACTGAGCATCTTTTGGAGGTCTCCCGTTCACCA
ACTCGTGAATATTATTTACACACATATTCCCCAATGAGAAGGATGTGGTTTAAAAGCGAG
GTATTTTATAAGGACCTAAATGCTTTTAATTAGGTCAAGTATGAAATGAATTTTCTGACC
GCTGACCTGTGTTTTTGAATATGGACACTCTTTTTTAGGAGGACTTACTTGAAGAGCTTC
ATGGAATGGCTGCCTTTAAGAATTTCATCCTCAGCAGGGGCTACAGGATGCCAAGCGTGA
GTAAAGGGCCATGTCAGAAAGACCTGCTTGGGGTTTCCCGGCTCACAGTTGTTAGTGAGG
AGTTGGCACCTGACAAAATCAAAATGCTTCTCTTCCAGGCATGCACCAAGAGTCAGGCCC
AGAAGAAAGGATAGAGATAGGATGTGGTTATTTTCCCTTTTCATTCTGCCAGTTTTGATC
TTGCTACTGTCAGAAGTTCTGTGTCGCTGATTGTATTTGACTTAACCTTCCTTGGATTTG
GCCTTTTCACCAAAGTGAAAAAGATCTATGTGCGGGGCGTGTGCCCTGACCATTCTGGCT
ATTACTGGAACATTCTGAATTCTTCAGAAGTCTTTAAGGACAAGGAGTTGGGAGATTTGG
GTTGAGACAACATGGAGTTGGGATCTGCAGTTCTGTCCTGGTACCATGTGGCAGACCTCA
TGGTGTAAGTGGAAATAGACTAGTACAAAAGGTAACCTGCAGGGCCTGCCAGCGACTCCT
GCCCTTCCTCCCTTTTCCCTTTCCCCTTTTAGTGTCCCCTCCCTTGAGTTGCAAAGCTGC
CCCCAACATGATCCACATGATTAATCTCTGCCCCACCCCTGGAAGATCACGTTATTACAG
CTAGGGTGGGTGGGAGCTTGGCAGAGTGGACCCTCAAGCAGGAGGGCCTGCGGGCTGGGA
GTTGTGGGCCCACCCAGCCCGGACGCCATGGCAGGAAACCAGATGGGCATGGGCGGCCCC
CCTGAGTCGCAGCAGCTAATAAATTATGCATTTGCTCCGTGTCTCTATATACTCAGCTCT
GGAGATCTTTGAGGGGTAGCCAAAATCCCTGGAACTGGGAGACTGGAATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1054..1139, 2557..2701, 6678..6878, 7995..8008, 8010..8151, 10478..10555
1001..1051, 1054..1139, 2557..2701, 6678..6878, 7995..8008, 8010..8151, 10478..10555
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved