Dasypus_novemcinctus Locus ENSDNOG00000013393
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus ENSDNOG00000013393
Dasypus_novemcinctus
ENSDNOG00000013393
GeneScaffold_1585
SNORA68
2078..2207
3453
TATACTCTTCGTAAAGCTTTGATTATACATTTCCACTGTTTCAAATTTAAAACATTACA
CCCCTGAGGCTGAAACCAGTAACAACATTTCTGAATTAAGGCAAAAAGCTCAAGTAAATC
TGCTGTTTTTATTGTGACGCCAATTGTATGTAAAAGCATTTTTAAAACTTGTGAATATTC
TTCCAAGCGTCCTGGCTGATTACCCATACCCTGATGCTAGCGGAAAGCAAAACTTAGTAA
TATGAAGCAGCAATCTACCCGGGTTAACTAATTTCGATGCTACTTACCTTAAAAAAGGCT
TTTCAGCTTTCCACATTCCTGATCCAGAGGTGGAAGATTCTACGCTGCCATGTCTTGATG
AATCCTCTGCCTCGGGCCCCACGTTTGGGCGCCACCTGTCAGAGTCGGTGACCTGAGGGT
ATGGGGAATGAAAGACAAAGAAAGATTGGGTTCAGGTTATCTGAGAGCATTGATTTCTCA
AGCTCATCAGACAACTTTATTGAGTCGAGGGGCTAGTATATATACCCCTAACATACGTGA
CATTCAGCATAAAATCAAATTACCCTTACCTCATTCTGTATTAAGTAGTGATTGATGAAC
ACCAACAAACTCTACTGGAACTATTATTATAAAAATCAGTAACTATACTCATAAATCTTG
TTACTCAGGTTGTTCTGTTCTATACATTATTGTTCCGCCTGTAGGTGTACTTTCCCAGCC
ATGACTGTGATCTGCACCGATAATCATAAGGGACAGCTTGACTCAGTGTTCAAGGACATA
ACTTGCTTCCATGGAAACAATATGCCCTTTGTTTCCCACAGTCGCTGAGCCCACCAAGGA
CAGGTGGCAGTTCCCCTACCTGCTCACGTGGGGCTGGGGGTAGGGGTGCTGCAACAGGGG
CTCCCAAACCCCTGAATCTGGGCCTCACAGGCCTGGGGGTAGCAGTGGAGTGTCTGCAGC
TGTCACCGAGGGCTCGGCCCCCGCCCCCTTCTTCCTGCTGGCTGTGAGAGTCCAAGGTGT
CGGGTGCTACCTGCACACCCTGAGGGCCGGATGCCATTGCGGATCTCAGCTCCCAACTTT
GTTGCCAAGTGCAGCTATCGGTCTCTCCCCATCTCGGCCAAGGAAGATGCAAAACTCTTC
CCAGGAATTTATGTCCTGTGGGCAGGTGTTGAGAGGTCATTGCTGTGGGTGAAGAGCTTT
GGCATCTGGTTGGGCTTAGATGCCCACAGTGTGACCCACATGTACTGGGAGGACCCAGTG
TTACACCGACATCACTGTAAAGGTGTTTTTTTTGTTTAGTTTAGTTTTTAAATCTCCTCC
CCCCTGGGAAGCATATGTGGCTCAACTGATAGATCATCCACCAACCATATAGGAGGTCCG
GGGTTCAAACCCAGAGCCTCCTGACCTGTATGGTGAGTTGGCCCATGTGCAGTGCTGCTG
TACGCAAGGAGTGCCATGCCATTCAGTGGTGTCCCCCGCATAGAGGAGCCCCTTGAACAA
GGAGCGTGCCTTGGAAGGAGAGCCGTCCCACGGAAAAAAAGTGCAGCCTGCCCAGGAGTG
GCACCACACACACGGAAAGCTGCAGCAAGATGATGCAACAAAAAGAGACACAGATTCCTG
GTGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGCTTGGCACACACTTGTACCAAAATACTAACAGCAGTTGGAATCTAGGTGGTGGGCAT
ACCAATAATCATTGTATCATTCTTTCTATGCTTCTCTATCATTAAACATTTTCATTATAA
AAATTGAGAATTTCTGCTTCTAACCAAGATGGAGTAATATTTCCAATTCATCTTCCCACC
AAAAACTACCAAAAAAACCATTAAAAATATACGCAACACTCACACCCGAACCAAGAGCTG
CAGTTTCTTGTAACAGCGGCTCAAACAGCGGTGTGGATAGCAAGCGAATCTTGTCGCCTT
TGGGGGCTGTGCCATGCCTCTCAGAGTGAATATGGAGGTTCTATGCCCCCAGGGGGCACT
GCACAGTGTGGGGGGTGCTGACTTTGCTCCTCACCCCCCCAGACTGGGAGTCCAGCACCA
CACGCACACCTATTCCATCCAGGTCATGAAGTGGAGGAGATCGCAGCCAGCAAGTGCCAC
CAGCTGTCCATCAAGGAGTTCCATGACTCCAAGATCAAGTTCCTGCTGCCCCACCACGTC
CTGCGGCGCCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAATACCTTCTTCCAGGGG
CCCCACCCGGGACCAGCCCAAGTAAACTAGTGCAACACTCCCCCCCCAAAAAGGCAACAA
CAATTTTCAAGATACTAGACAAACAACAAAAGACAACGATTCCTGAGAGATGAGAAACAA
ACAAGATAAACTCTGAACTACCTCAGCTTACCGAACTGAGAGAGATTCTAGGCTAAAGCC
CAGGAAGAGGAACTGAGGCAGAACCCAGCAGATTCCCTGAGTTGAGGAGACAGAGCTGAC
AGTCCAGACAGACCAAGGGAGCCTGAGTTCCTAGGCCAGAGAACCAGAGAGGAAAGAGCT
GTCCCAAGACAGAACCCCAGACTTCTGCAGAGGGTCCCTCTCAGGTATACATCAGAGTAG
CAATGAGCACACGCATGTAAGGAAAATACTGAGCCTGTGGAAAGAAGCACCCAAAAGGAT
TAGAGGGAACAGGGCCACCAGCCAGACTGAAAGCCTGAAAATTCCCAGAGCACTGGGTAG
AGTACTTACCGGGGCTTGCCTTAGTTATGGGAAATAACAAGTCCCTGACTAAGCATTGTT
CTAGACCTTCTTAACTAATCATAAAAGCAAGACACACACCCCCCTCCAAAAATCAAACAG
CTTCCAAGTAACATAACTGCATTTCAGAGCAAAGATTAAGAAGTTTTACAGGAATGCAAA
AATATACAGCACCCAACAAGGTAAAATGAAACATCTGGCATCTGATCAAAGATACCAGGC
AGGAAAATATAAACCGTAATGAGGATAATCAATAACTCAAAACTGACTGATAACTGACAC
ATTAGAATTAGCTAAGAAGGACATTAAAATGGTTATAATAGGGAAGTGGTTGTGGCTCAA
CTGATAAGAGCATCTGCCCACCATATGGAGGGTCCAGGGTTCGATATCCAGGGCCTCCTG
ACTCGTGTGGGAAGCTGGCCCATGCACAGTGCTACCTGCACACAAGGAGTGCGCCCCACA
AGGAGGGCGACGCGAAAAAAGCACAGTCCACCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1007..1024, 1027..1038, 1041..1102, 1104..1164, 1185..1254, 1727..1761, 2258..2263, 2266..2310, 2313..2453
1001..1003, 1007..1024, 1027..1038, 1041..1102, 1104..1164, 1185..1254, 1727..1761, 2258..2263, 2266..2310, 2313..2453
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved