Dasypus_novemcinctus Locus CCBE1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus CCBE1
Dasypus_novemcinctus
CCBE1
GeneScaffold_6733
SNORA38
113713..113845
141417
ACCTGACCAGCCAGGGGTTCCCAGCTCAGAAACGCAAACACGGCACGGAAACAGAAGCA
CGGTGCAAGAGAATTTGGAACTCCAAGAAAGACCCAATGAGCTCTCTACTTGTCCTGAAC
TCAAGTTATGAAGAAAACAGTGGCACGGTTTATTAGCAGATGACCTGACTGGGGAATTCT
TCTCAAGCAATTTAATGCAGGCAGACTCCAACCTAAGAGCGCTTTTACAGGTCTGCAAAG
GCGGCTTGGGAGACTCACCGTGGTCTTTCACCTCTTCCTTCCTTACACTACTAGGATAGC
AGGAAAGCACAGGGTAGAAAGGCAAAGGTTGGTCTGTCCCTGGTCCTCAGAAATCCAGTG
ACAACCGGAAGGAAGCTTATTAACCCCTCTCCTCCCCCTGCCCTTTCCCCGGGTGCGAAC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCTGGGACACACGTGGT
CCTACCGAGAGGAGCCCAAGGACGGCGACAGGTAAGCGCTGCCAGCCCCGCGGAGGGCGA
GCCCCGGGGTGGCGTGCGCCCGGCTCGCGGGGCACGGGCCGTTCCTCCTGCCACCAAGCC
CTGCAGCGACTCGCACGACCGCGCTCCTCCAGGCACTGGCGGGGTGCCCCGTCGACACGG
AACTCTGCTGCGTTAACAGACTCGGCGTGCTCAGCCTCGGCTGCCCCATCCGTGGGTCCG
GGCTCCGTCACATGTCGCATTCCTGCCGCTCGCCCGTGGGTGCAGCTCGCGAGCCCCGCT
TCTGCGGCTCTTCCTTTCTCCTGGCTTGGGGCTCCTCTTGGTGTGGGACCCCCTCCGGCC
CCGCCCTGCCTTCGGGGCCGCTCGCTTGGGCGCTCGGGGTTCCCCGCGGCCTCGGCACGC
GGGCACGCCGACCCCGAAGTTGGGGCGCGCTAGGCGTTCCCCAGCGCGCACACTGCTCTC
CGCTCCCGCGCTTAGAATAAACGACGTGTACACTCCACCTTCTTTTCCCAGAGAAGTTTG
CGCAGAAAACAAAATAGCGACGACCACATACCCGTGCCTGAAGCCTTCGGGCGAGCTCAC
CACGTGTTTCAGGTAAGGCCCCGCAGCTGCACGCGGCGCCCTGGTGGATGGGTGTGGAGA
GGGCTCGGGGACCGCGGGCCGCCCGCTGTGCTGGGAGAAGCTGGGTCGGTACTCTTTTGT
GCGCACTTCTGTGTGTTGTTTCTGGACCGGAGGTACGACCGGTAACGGAGTTTGCACCTG
GAGTGTGTGCCGAGACCCTAAGAACGTTTACCACTCCCTGGAGAAATTGCGTGGTGGAGT
TTGGGGGGAAGGAGTGGAGAGGAAGGGAAGAGTTGAAAGTTGATGAAGGAAAACGGGCTG
GAGTGTGAGTGTAAACAGTGGGGCATGGCAAAGGTGAATGGCTGGTCTTGGATTTGCGTT
TTTTTTTTTGAAAATACAAAGCCAACAGCAAGGAAATACTTGGCACTTGGCTGTCTTCTG
ACCTTCAGTTGGGACAGTGTGTATCATTGTCACGGCCTCTGGGTGAAAGGATTGGAGGAT
TGTGGGTAGTTGATATGGCTGTGTTGTGTGAGAACGAAGAAAGGTCAAGATTGCTGAGCC
ACCAGAAGAGGAACAGTTTTTCTGAATGTGGTCCATGGATCACCCCCGTCAGAGTCACCT
GGGTGCCTGTTAAAAATCAGCCTGGGTTGGGCTAGGGAAACAGCAGTTTTAAAGCTGATC
CTCATGTGATTCTCATACCCAGCAAAAGGAGAGAGCCACTGCTCGCTACTTTTGAGGTGA
AGGCCAACCTTTTATTTATTTATTTCCATTGCATTCTTGGCTTCCAGTGCTCTCATGGGA
TGGAAGAGACTTGTCATGTGTCTAAATATTTACTAGTTGTCTGCTACTTAAGGTACTGTG
CAGGCAGGGCACTGAGATCCTACTGCATGCGCCTAATCCTGTCTCCGAGAATCTTACAAT
CTGCTTGGGATGCTAGGATAAACATTGGGTAGTACAAGTAACAGCAGTCCTGAGAAGTGA
ACTTAGGGAAAGAGTTTTATGGCAGGTGAATCAATCATAATGCCTTCAGCTGCAAGAAAC
AGGTTCGCATACCCAAAGGTTCAGGTGTACGTGGTACCAAGTCTGATTAGTTTAGTGGTA
CACGGGCACTGTCAGCACAGGACGTTCCATGCTTTTAAATGTCATTGGCATGGAAATGAA
TGACTTAGGTGAATCAAGAGTCATTTCTTGGGGTTGGGAGGGACCTTTGTGTTCAGTGTT
CACCCTTCATGTGCCCAATGTGTTAGAAGAGGTGGCATTCTAGTCACCTGACAGGTAAAG
ACATAAAGAAGTTAATTTGGGTAACCAAGGTCACCCAGCTGGTAAAATGAGCTGCTTACT
TGCCTGGTTCCAGTCCTGTGTTCCATTCTCACAACCACAGGATTTCTTAGGCATTGTTTT
CCTATTACCACAGTATAAAGTGTCTGAGTTAACATGGAAAGTGCCCCGATATGGTTCCCT
CATTTGTTCAGTCCCTGAAGGTCAGACTCCACATAAATCAGTGACAGAGAATGCATGTCA
GATTTCCAGAAACCATTGGCGTCTGATTGTTGTTCTAAGCTGATTTCATTTGTTATGCCA
TTACTGTCCTCTTTTCCAGATTTTTTTAAAGTAGTGTGGTGTTTCTTTTACACCAAGAAT
CTCAAGAGACAATAGCAGCATCTTGATATGTTTTCCTTAACAGCTATGCAGAGAAACAAC
CATAAGGTCTAACAAAAGGAAATTTTATATCCAGGAGAATAGTCAAGACTTTGTTTTGGT
GAACGAGAGGAATGTGAGAGGATGTTTTCAGCTTGAGAAGGTGGTCATGGTCCTTGTGAC
CGTGCTTTCTGGTTTTGTTAGATCTGAGTTACTTTCTTTATGGACGTCCAGAGCTCTGGA
TACTCTTGGTCTTATGCTTTTACCATAATCTCTTAAAAAGAGAGTCAGTTGGTGGTTGCT
GCTTCTGTTTTGCTTTAAAATCCCAAGAAGGGAGGAATAATGTCCTCGGTTCTGTGTTCT
ATCTCTGAATATCCTGACCCTGGAGACCTTTGCTANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTAAATATAAACATTTGAC
AAGCCAGGAGCTTTAAAATGCCATTTCTTAGGGGAAGAGGGTATATTAATTTAAGAATAT
AGGATATTACAATGGAATATGAAATGAATATTTTTCTGACATAAAAAAGGTGTTCTGATA
TTACACACCAAACATTTTAAATGTGGAGTGTGACCCAATTTTTGTAGATGAGTGAGTGTA
ATAGTAAAACGTCTAAATTTTTATCCAATTTTCAAGAAATATTTAAGTGATTGTATGAAT
GGTCCTCTGAGTAGAGGGGTCATCAGAACTGTCATTTTTGTCCTGATTTTCTGTTGTGTG
GGTTATTCCGTTGCCCCTCCCAATCATTCTCCACCCTTTTCCATCCTGTTCTGTGTCCTG
GGAGCCAGTCCTTACGGAATGAAATCAGCTGCCCTCTGGCTTCCTGTTGGGTCCAGCCAG
TGACAATCCCTGGTGTAGATGAGAGGGTGAGAAGAGAGGCGCTGGCTATTGACTCCCCAG
CGTCCTTCCCGCAGCGCTGTGGGTTGGGATTGACTGTGCCGGTACACAAGGCACCGGCCC
CGTTGGTGGCTCTCTGCCTCCCCTCCAGCCGTAGCTGCCCCTGGCTCCTGTAACGACCCT
GTCCCCTTGTACCGTGGGCCTGCAGGAGGTAGCAGCTCCCTGCTGTTGCTAGTCCCTCCG
TGCTTCTCATCTGGGTTGATCTCCTTCACCCTGCACAGACATTGTTAAGAGCTGCTTCAA
GAACCTCTCCTCTACCTGGTTAGCACGAGCTCCGTGCTTCTTCCTGAGCCCTGGAGGAAT
ACGTCAGTGGTTTCCAATATTTCTACAATGAGCGTACATTGCTTATAAAATAGAAAAATG
TGCCTTGTAGCTTTGTGGCAAGCCGTGTAACAGCAAACCCTCTCCCTGCGAATGAAGCAG
AGTTTCCACAGGCCCTCATGACTCCGTTCTTAGTCACTGACCACATGGCGCATGCCACCT
GACTGAGTCCTCGTGGAGAATGTCGTTGGTTCCTGGGCTTCCTCAAAAACAGGAGCTTTT
GGCCTGCAGGCCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAAATAAGGTTTA
AAATGTTGAGCCGCGGCCCGTCCTCTGTCTCCTGAGGATAGTTATTAGCTTGTAAGCAGA
GTTTTGTCTGTCCTGAGTGTGCCCCCATCTCTGGGGGAGCACCCCAGTGGGCCAAGGCAC
AGGCGGGTACCCCACGGAGCAGGCTGGGTCTTCGTGGTCACTCGTGCACAGAGAGAGGTG
ACTGATGACACAACTGCTCCTGGCCTTTGTGTACGACTTAGGCAAACAATGAGATCATGA
GGAGAGACTTCAGTGAAATCTCTTGAAGTAAAGGCTGCCTTCAGCTACTGGACTTACACG
AGGAAGTGCATTCCCTAAGAGAGGAAGCCGGGGAGGCTACTGAAGAAGGCTGACCACCGT
CCGCCTCTGTTTCAGTCTTTCACGTTGCTTCTGCCCCAGCTCATGCCCTAGGTGTTGGTG
TTTTCCAGATCAGTAACAAGTTAGTGAGTTTTAAGTAGGAGAAGATGCTTAACCTGGGCA
ACCTAGTTCAAAGGGCAGGGAATGGAGACTAGGGGAGTTATGTCAAAGCTGTTTTTGCAT
AGTCCATGCTTTTAAAAAAATTTTTAAATTCTTTTTCGCAGGTACCAGGGATTGAACCCA
TGAACCTGCATCTGTTCCCCCATTCTTAATAGGGCTGTATGCTTCTTGCGGACACCTTAG
AGGGAGTGGTTAATATTCGGGGTTTTGAGGATGGGTTTCTTCTCCTCTCGGTCTGTCTCT
CTCCCCACTGCCCACAGTGATCTCCTCTGTTCCCATTTACTTTCTCCTCAACTGCCAAAT
GCACATGGACAGTTCTTTCTCTCAAAGCTGCAGGTGTAGATTTGCTCACCTCAACATCCT
CAAACACCCAAAGCAGAACTCAGGTCTAGATCTTGCTTAGTGGCTTCACTACCAACTTCC
TAGTCTGCCAGGCTCATCATGGGAGTTACCTGTTTCTTCTACTCTGCCTTTCAGTGTTCT
CCATGTCCACTCAAGTGATTATCAAATCCTATAACTGCTACCTTATGAGAGGCTTTTTTG
ACCATCTCCATTGCTACTCAGCTCATCATCCCTTGCCATAAATAATGCTCCCTGACAACC
TTCTGAGAGGACCAACCTGAGCATATCCAGCTCTCCTTGCTGCCTCTTGCAGAGACACCC
CCCTAGCGAGGCATACCCAACTTCCCTCTCTAACTCCAGTTCTTCTCACTCTCTATATCA
GTATTAAGGGCCAACTATTAAATTATTTCTTCTAAAGAGAGAAGAAAATGTTCAGCAGGG
CGATGCTAGGGATAAAGGGAATCAGTGTCATAGGAGCTTAGAACTGACAGGGACCCCTGA
GCTCTGCTTCCTCTCTACAACTCCCTCATTTTACAGAGGAGCAAACTGGGCCAGGAAGCT
TTTGTCCATGAGTTTGCTTAAGGTCATTCATTCATTCTTTTAAAAATTAAGCACATTGAA
CTTGGTACCATTCTTTTTTTTTTTTTTTCTCTCTCCCCTTCTCCCCTCTCCCCCAGTTGT
CTGCTCTCTGTGTCCATTCCCTGTGTGTTCTTCTGTGTCCGCTTCTATTCTTGTCAGTGG
CACCGGTAATCTGTGTCTCTTTTTGTTGCGTCATCTTGCTGCATTAGCTCTCTGTGTGTG
TGGCCCCACGCCTGAGCGGGCTGCACTTTTGTCGCGCAGGGTGGCTCTCCTTACGGGGCA
CACTCCTTGCACGTGGGGCTCCCCTACACGGGGGACATGCCTGTACGGCACGGCACTCCT
TGCGTGCATCAGCACTGCGTGTGAGCCAGCTTCACCACACAGGTCAGGAGGCCCTGGGTT
TGAACCTTGCACCTCCCATGTGGCAGGCGGATGCTTTATTCATTGAGCCAGTTCTGCTTC
CCTCGGTACCATTCTTGAGGTCTTGTTCTGCTGTTGTATACCTTTTTGATACTCTTATAT
TCATATAGAAATTTAGCTTGTACAAAGCACTTTAAGTGACCTAATTTAATTACCCCAAAC
TCGCCGTGGGCTTTTGCATCTATCGTCTGCCATGACTCCTTTCCCTCCACCTGGCTAACT
TTGGGACTGGGCTTGAAGGTCACAACCTACCTGAACTTGTCTGCATTAAGGCCCGGAGTT
TATAGTCTCATAGCTTCTATTGCACACAATTATTATCATTTTCAATTGTGTAGTTGGGTG
ATTATTAGTGCAATTTCCCCGCCCAATAATCTACTAGCACAATGAGGAAGGAAATCTGCT
CTGCTCACTTTTGTTTCATGTTCCATGGTAGCTGATATTGAGGAAGCATTCAATTAATAG
TGAATGAATAAAGTACTAGCCCCATTTCTCAAATTGTGGAAATGAGCTCAAAGAATTTAA
ATGCCTTGCATAAGGTCAGACAGTTCTGAACAAAGCACTTGAACTTTCATTTGTTCAGCA
AGTATTTATTGAGCCCCTCTTCATGTCAGGCATTTTGTGCATTTGACCCTTGGATCCTTA
ACCTTCAACCCAAATGCATATGAACAAACTGTCCTAAGTAGGTTGTTATAAACAAATAGT
CTCTACCGCACAAATCACCAAACTCCTTTTGAGCTAGACCAAAAATATTTGCTGTGTGAA
TTTGGTCTCTAGTCTGTAGGTCCATAGAGACGCATATTAGATGGCCAAGATATTTTCTTA
AGTTGCAAAATTTTCCAGATGAATTCCACAGCATGAGTGTGTGAGCAGTATATTATTGGA
ACATAACCAGGGAAAATAACTTTGGTCAAGGGGGAAATACACATTAAAAAAAATCTCACA
CCACTACCATTACATACTCATGGGGAGGAAATAGTTTACAAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCTTTCCAATGAGAGAAGAATAGTTCTAAGCTGAATCACTTCCGGT
GAAGCTTAGTTTTTCTGAGCCATTTTAAGAAAGAAATATTTGGATTTACTTTCATTTTTG
AAAAATCATTATTGTCGAGTTCAAAAAAACAACACAGACATGTCAAAGCTAGCAACACAT
GGCTGTATTTATATACTGTGGTTCAAAATAGATTGTATATACCAAATACTTAAATCTTAG
GCTTAAATAGGACTTTGTCCTCTACACAAACATAACCAGAATATCATAAAGAATAATATT
CTGAAAAGAGCAACTAAAGATGGTATTTAGGAATTGGAATGTGAGGAATCTTCTCTTTTC
CTTATAGACAAGACCGATGTGTACAGTATGAAGATTTGGATTCTATAAAAGTCAGAATCT
CTCCTTAAGGACATTTAACTCATGTGTTGGACTGAATATTCATTTGCTTGCCATGTACAC
TTACGCTTTTTGTGTTTGAAAAGGTTCATGTTTCTAGGCAGGACTAAAGGTAGCATATAC
AAGGCCTTTGAATAGAAGAAGGCATCCCTTTCTCTAGACTGATGCAGAAGGAAGTGTAGG
CTGGATTTCTGTCCCCAATGGCTCCATTAGTTGAGTGTCCTTGTGAAGGGCATGGCTGCA
CATCTGACACAGAGGTCCTGAAGGACATCTGGAGAATTATTTGGCCTCTAATGAGTTTGT
GCATCGTCTGCTAAGAGAAGAAAATGTTCAGCAGGGCGGTGCTAGGGGTGAAGGGAATCA
GTGTCATAGGAACTTAGAACGAGGAGGGACTGCTGAGTTCTGCTTCCTCTGTACAACTCC
CTCATTTTACAGGTGAGCAAACTGTGGTCCGGGAAGCATTTGTCCATTTGTTTGATCATG
CAGCTCCTTGATGACAGAGAAATTTCTGATTTGGTCCACTCAGGATGGTCTTTGTATTTC
CTCTACTGATGACACAGTTGTGTGTCACTGGGCACCTGGCAAGATCCACCTGTGTTTCCC
TGGTACCCAGACTCTCAAGAAATTGCTGTATTGTGCCTAGGTATATCACTGGCAAGCTTC
TCCTTTCTGGCTTTACACTAGATGGACTTGATGGATTTTGTTTCATGGCATTTTCTTTCT
TTCATTTTGGCATGCAATGAATACAAATTGCTGAAAATGCAACGCGGCAAATCACTTCTT
GAAAACTCTAAAAACGTTGGGAGTAAATTTCTGCCTGCCTACCTCTCTACCTTCTGGTGC
CAGAGAGAAGGCATAAAGGAGCACTTCTAAGAATTAGTTGGTTGTTAGAAAGCCATGTAA
GAAATCTGTCTGGTTGGAATAAGTGTCTATAATGGCTTCTCCTTCAAAATTTGTCCCTGT
AAAGAAAGCATGTAAACTCTTTTAATTTAATGCCTTAAGACTGTTTATGGAATGTGCTCC
AACTTTAGTGTGTTTAGCTCTATTTCCTTATAAAATTTCTCCAGTAACATAATCCTCAGG
ATTTACACGGAACCTCTCGTGAAGGAGATCAGAGGCCATTGTAGCCATTGCTTCATTACC
CCTAACAGCTCTGCTGTGCATGGCATGCACTTGAATTGCTTTCTTTTCCTCTTTTAAAGA
TTAGTGTTGGAACAAAGACACTGATATGGTGCTGATGAGGATGTATTAACCTTTCTGATG
ATACAGCCCTAAGGTTCACATGCCATTTCATAGAGCATAATTACTAGCCATTAAGTCTAG
CTAGGACAGGCCATGTTTATGGGGGCTTACTGTGTGACAGGTCCCGCTGTATGCTCTATG
TATCTTAACTCATTTAATGGTCACATACACATATGAAGTATTATTGGTATCTGCATTTTA
CAGATGAGTAAACTGAGGCACAGAAAAGTTAAGTACCGTGCCCAAGGTCAAATAGCTTAT
AAGGGTCGGAGTAGTTTCAAAATTTGGGCCATCTGCCTTCAGGGCCCATGCGTTTAACTT
TTGTGATGTACTACCTCCAATAGCTACAACACTGCTTCCTTACAACCCAAATTGTAAAGG
ACCTGTAACTTCTCTATTATTGTTTATTTCTTCATCAGATTTTTCTTTATAGCAGATTAT
GTTGTTAAGTCTAAAGATTAGCGTCAACAGTCTTAATATCCAAGCAACTTGAAAAATCAA
TGAAAGCAATGTTCTTTGTTCATCAAAGACACAGGGTGCTGGGAATCTGGTTCACGTGTG
TGTGAAGAAAACTGCTGTGCAGTGCTCTGCCCTGCTCAACTCTGATGCAAATGGAGGGAG
AAGTTTGTCTTTTGGGTTGCTCTTCTCCTTTCTCCCTTTCCATGTTTCTTAGTCCAGTCA
CCTCCCTGGGGTTTCCTGGCTGTTGAGCACCCCTCGCTTAAGAGCTGCTGTCCATCCTAG
GAATGCTTCAAAGCTTGTGTTTCTTCCACTTTCATGCAACCCTGCCTTAGGTCTTATTCC
CTAGATGCTTTGCTGGGTCATTGGCTAAACTGGAACCAATTCGTGTTGCAGAAAACAAAT
GTAATTAGTGACTTTGAGGGTAATTTCAGTTGTATAGAAATCTTCTAGAGATAATGAAAC
CAAGGAAGAATTTCAGGATGTAAAAGACAAGGGTTAGGAGATATTTTGGGCCCTGTACTG
TACCTTCCATTTCCCCCAGGGAATAGTCTATGAAGCCTACAAGCCCTTTGAGGCCCCAAA
TTCATCTTCCCAATTGTAATAGCTCTTTCTTCATTTTGGGATCACCTCTTTGAGGTTAGC
TAATGACAGATGACAATGGTGGCTCATGAGTGCGGAAGCATCCTGAGATGCATGCTGTGA
ACAAAGTTTATGTTCACACTAGTATAAACTACTACTGTGTCCAGAGCAGTGTGTACGGTA
GAGAGAACCTGTGAAATTAGCACGGGCTGTATAACGAGCTTTGCTCTTTAAACAAAACAG
TCAGATTTGTGTTTATAACTCACCACTAAAAATGTTAACCTCTTAAAATATTAATTGGCT
AAACAATTGCCCACTAGATGCACATGCAAATAATTAGGCCCCAGATGCCATTCCTAACCA
TCAAGAATTGAAACTAATGACCCAGAATTCATGTTCTGAGAGCTGAGTCCTTAAATTCTT
CCTTTAGAACCAATTTAAAGTAATGGCTCTCTGGAAGGTAAATCGGCCTCCTTCCATTTA
AAATATATTGCAAACTAGCAATTACAAATATCCAAGAAAATACTTTAGTATTCAAGTAGT
TAGTTGCTTTCCTTAGATTTAATAGAACTGAAAGTACTCCTTCAAACATGCTACAGTCAA
GTAAGCAAAATCATAAATGCTTTGTAGGTTTGTTATTGTTTTTTTTTAAACTGCTTATAA
ATAATGCAAAATACATTTGTCTTTTTCAGTTAAATGAAATTTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAGTTGCCAACAGAAGCTTTAATCAGAGTTATTTTAG
CAAGACGTTGCAGTCTCTCTCCTGACAGCCCGTGTCGTCTTTCTGCTTTGTGGCTCAGCC
CTTATCCCCTTGGTTTCACTTGCATTGCTCCCAATGGGTAAGGTGTCAATGGGACTGTTT
TGTCCAGGCCTGTGTCACTGGTCCTCATGACTATTTTTTTTTGGAAAATAGAGAAGGGGT
GATGAGTGAAGTGGGTAGAACAGTCAGATGTGCCTTCCTTTTCAGAGAGCTTTACATAAC
AGCACCTTTAAAGTGGTGCTGACATCAAACTCCGTGGGAACTGAAATTCTCTTTTACAAC
TCGAAGAAATCTTTTTCTTCCTTAGTTCTGAGTCAGACTGCCAGTAAGTTATCTTTCACA
TTGGCAGCTACTGCTTCTCCTCTGTCTTCCTCTTCTTCTCTTGTTTAGCCTACTATTGTA
AAACATTGTTTTCATAGACCCAAGCTTTATTAGAGGATTATAGAATTTTATTCTGGGCTG
TAGAGACTTTCCTTTTTGCAAAGAGAAAAAAAGTAGGTTTAAGTTATGTATTAACTTGAA
ACAAAGGCTGTTGAGAGAGCTCAAATAAATCATCCAGTCATCCTTGGGATTCAGGCTAGA
ACCCTGCCTAAATGATAGAAGGACCCTCTCTAGTCCAACAAACAACCAGCTGGCCTTCTC
ACTACTTGTTCAAACCCATCTGTGATGTGCGAGGACTGAATCTTCCTTGATTCCAAGACT
GAGAGTTTTGGGAAAGGTATATTGTTAAATGATCACACTGACTTTTCACTTCATTCATTT
CCCTGGAGTTGAAACTTAACATGAACTATGAGATGGGACTCTAGGCTGCTTTCAGAGTTG
AAGAAGTTTAATTCAGTCCTGGTAAAAATCACTCTCCATCTCAGAAAAGATCCTTGCTAA
GGTATGCAGAACCATAACTAACACATTCTTTGACTATCAGAAAAAAATTAACAGTGCAGA
GACCTCTCGAATTAATTCTCTGAATGACAGGCCGGCCCTGTCAATTACAGAAGGAACCAA
AAAGCATTTAATGTTCACTCTTGTAAATAAGATTTGCCAGCAATTTTCACTCAGAGAACA
TGCTTTGTTTCCTTACCAAAGTAGCAGGTACACTCAGTTTTGAACACCTGCGGGAAACCC
CCTTGCCTGTCCTTCCATACGTAGATTTGCTTCAGGGTCTGAGAGCTTCTAAGCAGCCTA
ACATTTTCCTGGGAACATGGTGTAATTGGTGGTGGTACCAGATTTTGTCTAGGTTCTTGA
CTGTGCTACAGAAATGAATTTCAAGAGCACATCAGGTGAATTAGGACAGTAATTTATTCA
GATAGGGAGGGACAAGAAATGGGAGAAAATAACAGATCAGGGGTCCCAGGTAGAGAGGAA
GGGACTGAAAAGTGATGAAATGGGCTGATTTACAGGCTACAATTCCCTACTATAGGTTAT
AAATGCCCAAGTTTTATTTGTGTGACCACATGGCAGAGGAAAATTGGCGAGAGCAGTGTG
CAGAAGACAGGACAGGTCCACAGGCAAGAGAGCGCACAAGAGCATTCAGGCCTCCCACCT
GCTTTTTAAACTGTTAATTATTCCACCCTTTGCTAATGGCAGGGGAGGAGTTCCAGCTGC
TTACTGTTTTGATTGATTTTCTCTCCCATCAATCTCCCATGAGGGCCCAATTATAAAGTC
CTTAGGGACTATTCAGGGCTTCTGGCTTCCAGAGGAAGTCTTCTGAGTGGCAGAATCTTG
GGGAGGATCTTGCAGCAGTCATCTTGGGGTTATTGATGTCCACGTGGACTTCTTGCCAGG
TTGCAGATCTGTCTATTGATTCCCTATCTTACTAGCCTGCTTCAGTGGGATCACAGGTCC
TTTTCTTTCTGCAGCCTGGGGTTAACTACTTCTCCTTTATGTTTTAGAGAAAAGAAACAG
AGTGAAAATCCATCACAATTTCTGGTGAGGTTAAGAAATCCCACTCTATATTTGATTCCA
TAGTTGATCATGACCTGGAAACACTCTTTTCTTAGTAAACTCATGGAAAGTGCCTGGACC
CTTAGGTTCTATAGTTTCCCACTACACTAGAGTCTCCTTTCTCAAGGTTCTATTGATGCT
CTTCTCTGTGGTCCCTGGCATACAGGAAAGGAAATTAGTTTCCTTGTCATTCCTCCATTC
TTGCTGCTGCTTGACTGATTTCAGAGCCACTGTCTCAGATGCCAGTGGGATGGCGCAGAT
GAGAAGCAGGCTTTCTATTGGGATGAGCAGGGCAGTGGGGGTGAAGGAACTCATAACTGA
TAAAGACACTCAGGAGCCAAAAGAAGAGGCTGTAACACACAAGCAGAGAATGGCTTAGCA
GGAGAAATGCGGTTCTGGAATGCTGGGTGAACTTTGCCAGGGCATCAGGAATGGTTCACA
TGCAAATTCCAGCTGGGATAATCATTTCAGAGGAAATTACACTTCATGTAAGCTGGGGCC
AGGGTTTTCTCTGAAATTATTATCCCTTACACTAAAAGGATTAGGCGTCTTTTAATGTGT
TGGGGACTTTCTAAATTAAGTTATGCTAGGAGGTTCCCATGGAATGATTAAATGTTGAAG
GGAACAGTTAAATGTTATTCACATGTAGGAATCCAGGGGCAGGGCCGGGGTTGGTGGTGT
GTGGATTAAAGTCACTCTGCAGAGGTTTGGAACCTTTGTTTTACTCTGAGTGGAGAGCTG
GGCTTCTGCGCATGTGGAAGACTTTGTCTTTCTCCTACCCTTTTAAGTTGGTATCAAGTC
AGAGGTAGAAATGAGCCCCAGCTGCTGTCCATGTAAGTTTTTAGAAACAGGTCCTCTGGG
ATAATCCTAGGGGTGTTGTTAGGATTCTGTGGGTAAAAGCCTTTCTCTATTTATTTTTTA
AATTTATTTTTTTAAAAAGATAGTTAGCTTACACAAAATGTTACACAAAAAAATGTAAGG
GTTTCCTGTATACCCCACTCCCCATACCTTCCACCCTTCTCCATATTAACAACTTCTTTC
ATTAGTGTAGTATATTCATTGTAATTGGCGAACACATTTGGAGCATTGTCACAAGCATGG
ATTATAGTTTACATTGTAGTTTGTACTCTCTCCCAGTCCATTCAGTAGGTTATAGCAGGA
TACACAGTGGCCTGTATCAGTCATTGCAATGTCCTTCAGAACAATTCCAAGTCCCAAAAA
TGCTCCTATATTAAACCTCTTTTTCCCTCTTCTGCCTTCAGCACCTCTAGTGGCCACTGT
CTCCACATCAATGATATAATTTCTTCCATTGTTAGAATACCAATAAGTGTATGGTAGAAT
ACCAGTAACTCCACTCTAGTCCATATTTTATTCCCTAATCCTGAGGATTCTGGGATGGTG
ATACCCATTCCTCCTTTAACTGAGAAGGGGCCTCAATCCCAAATGGCTGATGGATGGAAC
TCTTTTGCTTGCAGTTGTAGACTCTCTGGGTTCCTTGGTGTAGTGGTTATCCATCCTCAC
CTCCTTGTTAGTTGTCCAAGGTGAGTCCAGTGAACTGGAGAGTAGGTGTTGTAACTCTGC
TGAGGCTCAGGGCCCAGATGACACATGGACAGCCCAAAGATTCAAGTCTCTTGGACCTAC
ATCTACCAACTCTAGCACAACTATAGGTTCAAATAGAAGGGACAGAAGAGGCGTATGGAG
AGAAGTCTCATCTGAGCCTAACTCTGTCATATTTGAGAGCATAAACTCCAAAGTAGGGCC
CACTGGCAAGGCACCAAACTCCAGAGCTATCTGCCATGACTGTAGGACCTGGATGTCTCC
AGAGCCCTCAGGAGCCCCACTGTTTGGGGGTAGTATCTACTTTGTCAGTCTATGAGATCC
TTCTGAGACATGCATAAACATTACCTCTCTGATGACCTCCTGACTCACTTTGAAGTCTCT
TAGCCATATAAACTCATTTGTCTTTACCTTTTCCCCTCTTTTGGTCAAGGTCTTTTTCTA
GTTGCTTTGCTAGTTGGTGTTTGGTGGTAATCCCTTGGTGCCAGGGAGGTTCATCCCCAG
GAGTCATGTCCCACAAGGTGGGGAAGGTAATACATTTATAGCTGAGTTTGGCTTAGAGAG
AGGCCACATTTGAGCAACATGAAGGCTCTCAGGAGGTAACTCTTAGGCACCCTATAGCAC
TAGGCTGAATTGCAATTTCAAGAGCAAAGGCTCATAATTGCCATTATCAAGGGCCCAACA
ATAGACCATCCTTCTTCACTAGTCATTGCCCTGCACTTGGGAGATTGTTGATATTCCATT
AGAGAATGTGACAGAGCTGCCCAGGATGGGAATTCAATATTCTTTCAGTTATTGCGTGAA
TCTCCAACCACTGTGACAATGCCTCATGAACATTTGAACACATTTATGTACCTTANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAAAACTTC
TTCAGAAATGAACCAAGAATTATTGCCAAATACAATGATAGAAATATAAAAATAGTTTAA
ACATAAAAAATAAAATACATAATTTATAAAAACTAAAACATAAAATTTTTAAATTGGTAT
ATTAAAAAATAATGAAAAATATTAAAAAGTTTTTTGACCTTTTGCCTATCATTGCTGTAA
CATCTTTTGTCCTATATATACAGTGACATTTTCTTCCATTTCTTCCCCACTGTCTTTTTT
TTCAGTGTGTCTTGAAAGAAGTTTTAGGTCACAGTAAAGTCAAATACAGAACATGGGACT
CCCATATCCCCAACATCCTCCCCTTTTTCCCCCTTTCCATATAAATAACCTTTTTATATG
AGGATGGTACATTTGTTACAACTGATGTACAAATATTGAAACATAGCCACAAACCATTGG
TCAATGGTTTACATTATGGTCTATACTCTAGACCATACACTTTTATAAATTTTTTGTGAA
ATTCAACATAGAAGCCTTTCTCTCAAAAGAAGTTCCATGGATTCTGCTGTATTTCATATC
TACCCTTATGGCTCTGGCTGGACTCCCTGTGCAGTAGAGGACAAGATGGCTATGGGAAGT
GGCTCCCAGCTGGCAAAAGATGGTTTACATCACCCTCCCAAGCTGTTACCCCAATGAGTG
GATGAAGCCTGCCCGAGACCCTGCCCCCTCTCCCATAAGCTCTTGCAGGCCACCCTTCCA
TGCTCATTTCAGCCATTGGGAACCATGAGGCTCTGAGCTCCTTGATGGTGGGCTTTGGCT
TAGGCATTCTTAGCACTCCAGCATCTGGATGAGAGGGTCCTCTGCTCCATGAGAGGGTCC
TCTGCTCCACAAGAGGTGTTTAAGTGTATGAGCCTTTTGCTCACCCCACCCCCACTTCTA
TTTTTTTGTTGAGAAAAAGGAATGGAAGGGTATTTTATAATATTAAAATCCCACAGTAGC
CTGACATGGTTAGATATTACAGTTGAAAGAACAAGAGCAGGGGAATCAGAAGGATGTGTG
TGTGCCTCCGGATTCTGTTGCTTGCTAGTCATAGGCTCTTGGACTGTTAATTCACCTCTC
TGAAGTCCAGTTTCCCCTCTCTATAAAATGATTGCTGGGAGGATGAAATAGCTAATGTGT
GCAAAATGCCTGCCATTTTATTTAAGTGCTCTGTTAACAATAGCTGCTATTACTATGCAT
AAAACCTTGACTTATAAAGGAATTTCTTTTATTTTGCTAAATTGGAGGAGGGCTGGGTAT
GGCTTTATCTTGTATTTCAGTGTACATTAGGGGCTGAACACTGGCCAGCTTTAGGAGCAG
TACAATGTGTAGCGTGTGTGTGCAGGGCTTGGATAGCTGACTGGAAAATGCGGTAGGGAT
CTGAAGGGCAGAATCCAGAGCAGATCTCCTGGAGGCCACAATTCCCCAGCAGATATGGAG
AGGGAGAGAAATTTCCTGAAGGCTCCTTTATCCTAATAAGTACACTACCAGTAGTAGTAC
ACAGTACTGCATGAGAGGTATGCTTTTAAAAGACAGTCTTGATGGGCCACTTTGAATCTT
CTACTTCTCCAGCACTGTCCCTTCCTCTGTGTTAACCCTCCTGCAGTTCATTTGAACTAT
GTATCAATAGGGAATCAGACATAGATTTGATCAGCAAATGACGGCAATTAGTATTAGATT
CTCACAGCTTCAACCTGGGCCTTTCAGAGGGAGTCAAGGTTGAGGTACAAGGAGATGAAA
GAGGAAAGGGTAGTAGATGGAGCCTAACCAGCCTGTTCCCATCCAAAGCCACACTCTAGG
CTGTGCTGAACACTAGTTGAGTTGGTTCATAAACATCCAAAGTTGCCCTTTTCCCATTGC
TGATACCTGAGTTTGTATCAGCTAAAGGGTTCTAGACACATGTACATTTGGATAGTCCCT
CACTAGGGTTCTGTGGGGCCCAGCCACCTAGTTCTCCAAGCATTTGAACATCTTTTCTCT
ACCATTGGATTGAGGAGGAAGAGGTATATATGTGTGTGTGTGTTGGAGGGGGAGGGTGTG
TGACAGGAGTGGCCCCCGCTGCCCACATCTCCCTAGTAGGTACTAACTCATGGTTATGCC
CAGCCAGCTATTGTCAGGGGGGGCCACTGCCCCAGGTTGTATAGAGAGCGCATTTTTGCA
TTGTGTGTTCATGCATCCTTCCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCGATAGATTCCCTA
ACTCATAACCACACACAGCGTGAGAACACTTTTTAAAGTAATTTTTTACTCAATAACTCT
TAAGGTTAAAAGCCTTATTTTTTTCTGAACTGAATTTGTTTATATCTAAGCAGTTGAAAT
GTGTATCAAATAGAAGGTTGTGAAAATTCATTTCCTTCTTCCTCACAAGTACCCAGTTGA
AAACTGTGTATCTTAATAAACTGGAGGTAATCACTCAGAGAGGGGGGATAGATCTGTAAT
GTGGCATGGCACTTCCTTTTATGACTCTGGACTCAATTTTATGATGTGGCCATAATTTTT
TAAAGAGAACAAATGAACAGAAATTTTCTGCTAACCTAGTTGTTAAGAGCAAGACCTGCA
GAGGGAATTGGGTAACTATGAGGTCTGATTGCCAAAGCAAAATGTTCTTTACAGAAAATT
TGGAAAATATAGAAAATTACAAAAGTATAAAAACAATCCAGTTATAATTGTGTCAGTCAG
AGATAACATTATTGGTTTTTTAGAACATGTCCTTCCAATCTCTTTCTATGTACGTGTATG
TATTTCTTGTGACTGAGATCATAGGGTATGTATAGTTGTGAAACTTATGTTTCTCTCATA
ACCATACATGGTGAACACTTCTCATGTCATTAAACATACAGCCATGAAAATAATATGGAA
TAATTGAATTCGGGGATTACTTTGAATCTTTAATGTTTGAAAGCTGAATTTATTCCATTA
TTGAATATGTGATGGATATTTTTAGGCAGAAGTGAAAGCAAATGTAAATAGGGATTAAAG
AAAACAAAAGTCTGGGAAACTGTTACCAAGGTTGTTTTTTGTTTTGTTTTCAAAGTCTAG
CATCAGCATCAGCCTTTTGCTTTAGTCACTATTTCTATTATTAGGCAAAATCAACTCAGC
AAATCCCTTTTGCATTTAAGCTCCCACCGCCAGGACCACAGAGTGATCAGAACCGGGTGC
ATTGTTGTACTCAGGCTCTCTTGGTCCCCTGTGTTTGATTATGGGTTAATGTGGCACAAA
ACAACTTTCTGGGAGAAGATGCTGCAGGGACTTGACCTTCGGTTCTTCCGTGTTCGTATG
ACCTGGCAGGGCCCGGTTCCCAGCTGGTTAAAGCAGACGGGTCAGCACTTCGTCAGCACA
GACTCCATGCACACCCGGTCCTCAGCAGGAGAGGCAGCTCTTAAATCACTGCTCTACAAG
ACCTGTCAAAAGTGTCTGCTGAGAGAAAGAACACGTGTGGGGGAGAGTTACCTTAGGGCA
ACTGTTCTTAACCATTTTAGGTCACAGATCCCTTTGAGGTCTGAACAACTGGTCACATGC
ACGGCCCAAGTTGAGAAGACTTGCATTCGATACTGGAAACTCTGCCCCAATGTAAGACCC
CCTCAACCACAGCAAAGGTTTTACTGGGGTGCAATTCTGTGTGAGGCCTTCCATCTCTGT
TGCAGCAGTGGTAAGAGCCCATTCTGGGCATCCGGGCACGACCTTTCCCCTGGGGAGGGT
CTTGCTTCTGAGAAGGCACTTTCAGTATATCTTTTATCTTGGTCTTAGAAGTAGTTGTGG
TTCAAGAAAATTGATTATTTTATGAATACAGGAATCTTTAGTTGTCTCCCTTCCTCCTCT
TGACTACTAGAAAGCTTAGAATCTAGTAGCCCAGGTACATCGTGTTCCATGACATACTCT
GTGAATTTTCTTTCCCTCATTATTATTATGTTTCATGTTGAACACTATTCATCTTTGAAA
GCCGGCTTACATTATTCCCCTCCCCCCCAAAAGAAAGACACAGGAAACAAGAGAGGAAGG
GAAAAAGAGAGAAGACCAAATTATTTTTAGGAGGAGGTCCTAACAAGAAAGGCCACTCTC
TATACAGAATAATTTAGGGACTATTGAGAAATCGTAATACTTCAAAACTAGTTGTCCCTA
ATCAGCTTCATACCTAAAATTCATACTGAGTCCATTGGGTAAAGGCGTGGGTATTGTACT
AGTTGGAAGGGGATGGAAGTGAATGAATATATATGGAACAGTTTTGTGAGCCATAATTTA
TTTATATCTTATTAGTTCCTATAGAACCTACTAAGTTATGTATTATCATTTTACAGTTAA
GAAAACTGAGGCTCAGAGATGCTGCCCAGAGAACTCATAATCCTGGAGTTAGATTTGAAC
CTGGATTTGCCTGACACTAGAACAGCCTACTTTATCATTCAAGTATATGTAAAAGTAGGA
TTCCAGTGTTGAAAGAAGAAACCAAACTTTTCAGTCCTTTTTATCTTCTCACTGAACTTT
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTCTAATCCCACAGATGATGAA
CATTTAGTGCAAATGTCTCATTCTGATATGATATGTCATCATTATCGTTTCCATCTAGTA
GAACAAGCAGAGAATTGAGAGAAAGACTTTGAGCCTAGTATCTATTCTTTCACTGATACT
TTGTAGAAAGCAGGAGAAACTTCTTTCCTCTGGACTTTAATTCGCTTGTAAAGGATGCTC
TTTTTTAGGTATTGGCAAGGATATTCTTATAGGGTTTGAGGGATGTGAATGAAGAGTCTG
TCTTCTCCCCTTCCTCTATACACAGACAGCTGGGAGTTAGTGATAATATGTAGGGAAGGA
TAGAGTAGGTATTCGGGGGGCCTCTATGCAGAAATTCTTACCCCTCATACAGTGTCAATC
GATTAGAAATTAATTTTTATTTGGCAAGTTTTTCTTTAAAATGGCAAGTGGTCCTTGAGA
GGATTAGCCACATGGACATTCAGTTAGATACTCAAATAGTCCTTCTCCAGAGGATTATTG
TTCTGAAGTATTGATAATTATGATTGGGGAAAAACAGTAATTTTGGAGCATGCAGCTCTT
CACCTGAGGGCAGGTTAAAGCGGATTGCCACGATCTGGTCTAGGACGGGTGCTTTGTGTA
GCCAGAGAACATGGGAACAACAGAAGTTATAGGCTCAAGAAAGAGCGGTCTTAGAGGTCA
GTGTCTGTCAAATCGTGTTCGCCAGGAAACTCATTCTATGGGATATTCCAGAAGGAGAAA
GTGGGAGAGTCTACAGCAGGCACTCTTAACAAGAAGTGCATGAGCTTGAATTGAAATTTT
AAAAGATGCAAAACATTCTTGTGGGGACATGTTGGTGTGGATGTGATGTATTATTAAATA
ATACGCAGTATAGTGTGGATTTAGTAAAGGGTCTGTGGTTTTCAGCTGACTGGCAAAGGG
GTGCGTGGAGCAAAAATTAAGAAGCCTCTGGTCTGCAGTTAAATACATTTGGGGTGAACT
TCTTGCAACGCTCTCTTGGGCATTCGTAGTAAAGCATTAGCATAGTAAAGGTTCTGAGAA
GACTTACAGCTTAGAAATTGTAGCTGTTTCTAAGCAGCGCAATGTTAAGACATGCACTGG
GGATATTGAGTTTGCGGCTGCGTTCAGAGTTGCTAAAGCTGCTTGCAATATATCTGGTGA
CTTTTTCTTTAGCGTTGACGATCAATTTGAAGCTCAAAAAGAGGCGAAATAGCTTAAGTA
AGGGCTGATGAAAAAAAGCAGACTAGTATTGTAGTTGGGGTAAATAAAAATGAAATAATT
GGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGATGAGCCAGATGTGCTGACAAAGTGCTTAATAACCAGGCA
CTATGTGCAAGTGCATTATATATAGAGAGAGTATTAATCAGCCAAAGGAGTGCTGATGCA
AGATACCAGAAATCTGTTCGCTTTCATAAAGGGTATTTATTTGAGGTAGAAGCTTACAGT
TACTGGCCCATAAAGCATAAGTTACTTCCCTCACTGAAGTCTGTTGCCTCATGTTGGAGC
AAGATGGCTGCCAAGAACTCAGGCTTCCTGCGTTCCTCTCTTCCCTGGGTTTGTTTCTCT
CTGGGCTCAGCTCCTGAGCTCATTTCACAAGGCCAACTGTAGACTGTCAGGAGAATGGCT
CTCTCCCCGGGGCTTCTGCCATGTCTAAGGAGCCATCTCTAGCCCTTTGTGTTCTTCTCC
TGTGTGTTCACTTCCTGGGCTGCAGATCAAAACTTCCAGCTCTGTCCTTTGCCATGCCTT
TTATCTCAACACCCTACTGACGTGGCCCAATCAATGCTCTAACCATAATTTAATCTAGTA
AACCTCTGAATCCATTATAATTTGATATGCCGAAAGGAAAAGACCAGTTCACAAACATAA
TTCGTTATCTATTTTTGGAATTTATAAATAATGCCAAAATGCTACCTATATATATATGCA
TTGTATATATATATATATACATGCATTGTATATACATATAGCACTTAATCCTTACAATGT
TTTCTTAAATAAGTTTTGCTGCCCATATTTGGTGAATTTAGGAAGTAGCTGTAGACAGGT
AGGGTTTTACATGATTAACCATTTTATTCATGATTAACAAAGTACAAAGACAGTGTGTTT
TGTTATTATTACTGAATGTTGAAGAAAAAGCTGAAGAACTAGGCTTCGATCTTAGTATCT
ATGGGCAAAGATCAAGCAAAAATAACATTGTAAACTGTGGGGAAAAAGGTGATGTATGAT
TTAGTGTCACCTCCAAACTTATTAAATCTGTAAGGAAAAAAAATATATATACACATGTAC
ATATAAATTCATATGCAAACATGCACTCATGAGCAAAATAGACAGTCTTGGCCCTTATGG
AATTTACCTTCTAAAGAAGAGGAGAAGAAACAGAAATAATAAGCATCATCAATAAGTAAA
ATGGATTGTGTATTAGAAGGTCATAAGTGAAATGAAAAGTAAATAGAGTAGGGAAGCGGA
TGTGGCTCAAGCAATTGGACTCCCGTCTATCATATGGGAGTTCCAGGATTCGATACCCAG
GTCCTCCTGGTGAAGGTGAGCTGGCCCCAGCAGAGAGTTGGTCCGTGTGGAGTGCTGGCT
CCCTGCGCAGGAGTGCTGGCACACTCTGAGAGCTGGCACAGCAAGATGATGCAACAAACA
GATGCACAGGAGAAACGATGAGACATACAGGAGACTACGTAGCTTAGAATGGTGCCAGAG
GATGGGCATCCCCCTCTCCCACTCTGGAAGGTCCCAAGATCAGTTCCTAGAGCCACCTAA
TGAGAAGAGAAGGAGACACAGAACCACACACAGTGAGTGGACACAGAGAGCAGACCATGA
ATAGTGGGGAGAAATAAATAAATCTTTAAAATAAATAAATAAATAGAGCAGGATCAAGGC
TGGGCAGAGGAGGGTTGCAACAGTCAACCATGAGGTCAGAGGTCTCAGCAAGAATCGGGT
ATTTGAGCAAAGACCCAACAGAGATGAGGGATTTAGTTACGTAATATCTGGTTGAGGATT
ATTCCTTAAAGAAGAAACAATCAGTGGAGAGGCTTAAATTGGTAGCAGGGAGGAGAATTG
AGCCCAAGGTAAGAGGGATAGATGAAATCAGAGGGCCTCACAGGCCATTGTAGGGACATT
TTACCTTGAGGGACATGGAAACTGTTGGAAAGTTCAAACAGGTATGGCAAGATCTGACTT
ATGTCTTAGACTTTTCTGTCTGTTGGTTGACAGTAGACCATAGGGGGCACATATATAAAT
AGATCCCATAGAAGGCTGTTGCAATAACATGGATGAGAGATGGTGGTGGCTGGAGCAGTG
GAAGGAGCAGTGGAAGAGGTTGACTTTTGAGTATGTTTTGTAGGTTGAGTCAACAGGGTT
TCCTGATAGACTGAGACTTGGAGGGAGAGAGGTCAAGGATGTCTCAGAAGTTTTTCCCCA
TAATTGGAAGGATGAAGAAGCCTAGAAAGCTGGTTTTGGGAGATTAGTAGTTCTGCTTGG
GCTGTATGAAGTTTGAGAGGAAGGCTCTTTTACATTGTACTAGTTTGCCAAAAAGTGCCA
GTGCAAAGTACCAGAGATCTGTTGGCTTTTTAAAGGACATTAATTTGGGGTAAAAGTTCA
CAGTTCCAGGGCCCTAAAGAGTCCACCTCAAGGCTGCCTTCTCACCAAAGTCACTCGCCA
AGTGTTGAAACAAGATGGAGGCTGATTTCTGCCTAGTGTCTTCGGCCTTCTTGGCTGCTC
TCTTCTCCTCAGCAAATGGCTCATCTCTCTCCTCAAGGCTTTAGCTGTTTGAGCCTTCTC
CTTTCTGACATATGACAGGGCCAAAATGACCAAGTCCTCTCCTCTTCTATGTATGGAGCT
CTCTCTCTTCCCATGTGTCTTCTTTTTTTCTTTTCTTTTAATAATGTTACATTCAAAAAA
TATGAGGTCCCCATATACCGACCACCCCTCCCACATCAACAAACTCTTCCATCATTGTGG
CACATCCACTGCACCCAGCGAATACATTCTGGAGAACTGCTGCAGCACATGGACAGTGGT
CCACATTGTAGTTCACACTCTCCCCCAGTCCACCCAGTGGGCCACGACAGGACACACAAC
GTCCAGCATCTGTCCCTGCAGCACCACCTAGGACAACTCCAAATCCTGAAAATGCCCCCA
TACCATATCTCTTCTTCCCTCTCCCGACCATCAGCAGCCACCGTGGCCACCCTCTCCACA
TTACTACTACAGTTTCTTCCCTTACTAATCACAATATTTCCCCAGCAGAACACCAGTAAG
TCCACTCTAATCCATATTCTATTCCTCCATCTTGTGGACCTGGGATGGTTATGTTCAGTC
CCCCTCTACATCAAGAGGGGGTTTAGATTCCACATGGATGATGGATGCAATTCTCCTGTT
TGCAGCTCTAAGACTCTTGGCTCCCTGGTGTGGTGGTTGACCTCCCTGTCAGTTGGCCAG
GGTAAGTCCAAGAAACCAGAGGGTAGGAGCTGCAAGTCTGCTGAGGCCCATTCTGAAACC
GGTAACAAAGCTGTGTGACCACTGTGCTTTTGAGATCTTCTAATTGAAGATAACCCAGCA
GCCCCTTAGAAAGGGTCTCTTTGTTCAAGCCCAGTTTCTTGTTCCTGACCACCATACCCA
TATGCTCAACTGCCTCCTCACATCTCCACTTGCATGTCTGTGGCAGTTTGAGATTGTTTT
TTGAATCTCAAAAAGAGAAAGATCTTCTTGAGTGTCCATTTATATCAGCCCACCAAGGGG
AGGACAGGGACTCAACCTGAGTCATGCCCTGCTGATACGGTTGCAGCAAAAATTCAGTTG
AGGGACCTTTACCTGGATTACCTGATGAGATTGCTTCAGGGCTTTTAATTGGACTATGTA
GTGAAGCCTGACTCAGGTTGAGTCCCCGCTCCCTTGCTGAGTCTGATATAATTGGGGACA
CAGGAAAAAAGGAACTGCCATGTTTGATTTTGCCACATGAGAGAAAAGACTCCAGTTTTG
CCCACAGCTGAGCTGTAAGGAGAGAAGCCCTAGGAGATAAATCCTATGCCAGGTGTAAGA
GGACTAGAGGATTGTGTAAGCACAAGCCCCCAAGAGGCTGGACCCACTGGGCAGCTCAAG
AGGAGATGGTGAGGCCAGAGGGGAAGGCTGATGAAACCTCACAGAGATGGGTGGCCATCT
TGCCTCACCACGTGGCAACACACCAGGACCAACAGTAGCTGATTTTCGTGAAAAAAAAAA
TTCTGATGGTGCCTTGGTTTGGACTTTTCATAACCTAGAATCTGTAGGTTTTACCCCAAA
TAAATACCCTTCATGAAAGCCAACCCATTTCTGGTACTTTGCCCTTTGGCAAAATAAAAC
AGGATATAAGCTGCTGTATAAACTAAGGGAATGCTGCTTAATTAAAAGAGCTACTACTGA
ACTAAAATGAATAGCTATCTTAGTAATTGATTTGGTATTTCTTCCTCCTTGTTCGCTTGT
TTAAAAAAATTCTACCACTTCACATAAGTTTTAACACTACCCCCCCCCCGCCAATTCGTC
ACATTTCATATTGGTGAGATTTTTTTTTTTTTCCAAGTAGTCTGAGTAGAGACAATATTT
TTGGAGCATATCACTCTAGGAAACATATCAGGATCAATGTGCAAAGGACTGAAATCTACA
GACCTCGCCTACGACCCCCATGAACTGCTGAGCTAATAAATGAGAAAATCTGTCTCCTCT
GTGTCCCTCTGAAGTGGGAGCATTCAAAGGAACTGCGAACATCATGCAAACCCCAGCTCT
GCTGTGGGACTGCAAGCGTGGCCCCTGCCCGTCCAGGGTCTCATGTTCTTGTTATAGCAG
AGGGATGCTTGTACTCATCTCACAGGGTTCTTCTGTGGATCAGAAGAATTAATTTGTGTG
CAGGTGGTACAGAGCAGCCGTGGAGAGCATGGATTTTGGCGTCAGCCCGGCAGGTTGGTC
CTGGCTTCCCAACTGAATACCTGCATGACCTTGGACATTGTGCCATACACCTTTCTATGC
CTCCATCGCTCCTTATGGAAAATGAGGATAATAATCGTACTTACCTCAGATGGTGGTCGT
GAGGACCAAATGGATTAGTACATGTAATATTCTTAGAACAGTGCCTGGCTCCGAACGGTG
CTGCTGAAGTGTTTTCCGTAGTAAAGTGTTGATGCCTGCCAGGGCTGGTGTGTGAGCCAT
TTCCTTCAAGGAAAGCTTGAACATTCAAAACAGATGCCTTGAGCCATAGCTTACTTTACA
CAGGACTTACTGTGGGATTCTTTAAATAAACTTGCACTTTAACAAATGTGCAGCATTACT
TTCTATGTAGATCATCTTTGCAGGAACTTCAGAAAGTGAATCTCTTGATACTGAGTTGGA
CAGATTAAATGTCCTCTGTTGGATTGTCTTATCACATATCCTTGGCATATCCACTCCTGT
GCTTTGACACACTTCTACAGAGCTAGTTAGCACACATTACCTGATTAAACTTAAATGTTA
CCTAAGCAGTAATGCTTGAGCTTAGAAGTAAAGAATGAAAGAAATGAAAGGTGCCAGAGA
AATCAGCAAAACCTCACCCCTCTGCTGGTTCTGCATTCAAAAGCATATTGACTCAAACAG
TGAGGAAGTTGTACCCTTCTCAGAACTTATTCGGTTTTCCAGGTTATTTTTTAAAAGTCT
CAGTTTGGTAGTTATTTTATTTATGTTTAAATGAGAAAAGTTGTAGGTTTACAGAAAAAT
ACAGAAAATACCAAGCTCCCACAATACTCCCCCCATTATCAACACTTTACATTAGTGGGG
TGTATTTGTTACAATTGATGCAAGCATATTATAATTATACTGCTGTAATCCATGGCTTAC
ATTAATGTTCACTGTGTTGTATAGTCCTATGGGATTTTAAAAACTTTAGAAACATATACA
ACCTAAATGTCCCCTTTTAGCCACATTCAAATATATATATTTTAGTTCTGTTAATTACAT
TCACAATGATGTGTCACATCACCACCATCTATTACCAAAACCTTCCCATGGAAATACATT
TTTTAACAAGGTGGCAACTGTCCAAAACTGCCTATGGTATCTGGCTACTTCATGCCACTG
AGTTGACCTTACCTTCTATTTACAGGAGGGGTTTTTGATATTTGATTGTGATATTGGTGC
TCAGCCTTGGTAGCATATTTGAAACACCTGGGAAGTGTTAAAAAAAAAAAAACTACAGTT
GCCTTGGCCCCACCCCAGAGATTCAGTTTTTGGTTTTTTTTTTTAAGATTCCTTTCTCCC
CCTTCCCCTCCTCCTGCCCTGCTGTTTTTACCCATTTGCTGTGTGATCTTCTGTATCTAT
TTCTCTTCCTGTCTTCTCATTTTTTCTCCTTTAGGATTCACTGGGATTTGATCCTGGAGA
CCCCCAATGTGGAGAGAGATTCCCTGTCAATTGCACCACCTCAGTGCCTGGTTTCTGCTC
CTCTTCACCTTGACTCTCCCCTTGTCTCTTTTTTGATGCATCATCATCTTGCTGCATAAC
TCACTTGCGCAGGCACTGGCTCACCACGCAGGCACACTTTCTCTTCTTCTTTATCACCAA
GCGTCCCCAGGAATCAATCCCGGGCCCTCCCATATGGTAGGCAGAAGCTCTATCACTTGA
GCCACATTCGTTTCCCAAGCTGGTTTTGTTTTTTTTAAACTCCCCAGTTTATACTGGTGT
GTAGCCATGGTTGAAAACCATCAAGTTGTAGTCATGGTTTACTGATCCTTAACCGTGAAA
GTACGTCTGTTTTTTTGAAGTAAGTGAACTTCAAAGAAAATGTTAAGTAATAATAGCCCA
AGTGGCTGCAGGCCTGACTGACAGAGCCCGGGAGGCCGGGTCACCTGGCTGGTGGCACCA
AGGTGGCTGAAGTCAGTTTCTGAGCTCATCCGAGGCTCACTGCTTTTTTCTTTACTTCGA
GAAGCTTGTCACACTTGAAACAAGACAGCTGCAGATGTCTGTACCACCAGGAAGCCAAGA
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTGGCCTTCGGTCATC
CTGTTTCATAGCTACCGCCTCTCTAATAATGTTTATAAACTCCGTTGTTCCTATTGCTTA
AGCTTCAGGAGGCCTAACTCTGAATTTTGTTTTCTTAGTCCTGGGTGTTTATCAAGGTTG
GAAAGTTATGTTCATTAGATGTCGGTAGTTCCAGCAATCACAAACATGTGTAAAAACCAC
TTTAAGTTGATTTCATGTTTTAGTAGTGCCCCTGTAGCGCTCTTCTTCCTCTATTGCCCC
CTACTCATACCCCACACATATCCCCTCATCTCAACTCCAAGATACTCTTACATTTGTAAC
TGAGTCCCAGTATTCCATCATAGGCTTGGAATGATTATATCACAGGCTGAAATGTTAAGA
TCAGGCCAGTGAGAAGGAAGCATCAAATGCTCTCTTCCTTGGGCGTGCAAGGAAGAGTAA
GGACAGCTAGAGCTGAAAAGCACTTCTTTACCGGCGGCTCTGCTGAGCGGGCAGGCAGCT
ACATGTAGTCTTAAATTGCATTTCTGGTGACCTCAGCTGTGGCCTGGCCAGACCACCCTC
CTTTTTATCCAGCAAGGTAATTCTGCCCCTGAGTTCAGTCCATCACCCCCCTATCGCTTG
GAACAGGTTATCCCCAGCGGCCTTGTGGTTTGTGTCTCTTTGCACTGGGGAACGTGTTTA
ATAAAAACCACATAATTCATTTTGACAGCCTTGGCTCATCCATCCCTCAGCAAGGAGCTG
CTTGTGACTTTTTTTTCTATTTTCAGTTTGTGTTTTTTTTTTTGTTGCAAAATCCAGCAT
TCCTTTGAATTCATGTGTGCCCTGAAAAACAGATCAGCCATGTTTTCAGCAGCAGCACAG
ATGCCCCCCTTTCTGCGGCTGCTGGTAGCCTCGTGTATGCCTCAGAGCAGAGGCACTGAG
GAACAGTAATTAGTAATCACATGCCTGCCAGCGTCCGACTGCATGAAGGCCAAGTTGTAG
CCCCCAGGTACTGTGTGACAGCAGGGGTGTCCTAGCCTGTGACGATGAGACATGAGTTTA
AAGCGAACCACCTGCCACTTGTTACAGGGATATGTGCATTGTGTGAATGTGGAATGAGGA
ATTACCCAGAAGGACGTCCCAGCTTCATGCAGACGAAGCTCAGGAAGAGGCAGGGTGACC
GAGTAGAAAAAATCCAGGTTTGAATATTTGCTCTGCCTTCTGCTTGACCGCATGCCATGC
CTTGGTGTCCTTTTGTAAAATGAGTGGCAATGATAGGGTGTTCCCAGTCGAGTCGAGTAG
AGAAAATGTTTTCAAAGGACCTCCCACAGGCTCTGGCACGTAGTAGGCCCTCGCTAAATG
GTAGCTGTTAACCATGGTAGAAACGGCAGTCGGCAAAACGAGTGAGCCAGACTGTACGTG
TGCCACCTTCTGAATCCCAGAGCCTGCTTTCCAGTCTTTGCCCAGCTTTCATTAGCTTTG
GCTTCGAGTCGTTTTTGACTCTCACCAAAAATCTAAACAAATCTGAAAGGTTTGCTGCTA
CTGGGAATACTTAAAAGAATTTGCTGCAAACTCTCTAACTTCAATAGACATGTTCCCCCC
AAATTCAGAGAAATGACAGGGTTGTTGAAATAAATGTGTAACTGCTCGCAGTGGCCCCAT
TAAAGGGCACGCTGCTCGTTTGGGAGGGCTGCCCACGTGACCTTCATCTCTACAGAACTG
GAGGAGGGCAGCTTCGTGTCTGCCCCACCAGGGGAGGCGCTCTTGAACATTTTTAGAGCA
GAAGGGGGTGCTCTTGGAGACCACCCTGGCAGGGAAAATTGGAGAGGTGGAGAAGCTGAC
CTGCAAAGACGGTGAGCAGGGACAGAAGTGGAGTGGCCAAAGAAGGCTGGCTTTGAATGG
TTCAGTGCCAGGACTTGAAGAGCCAAGAGTCTGGGAGGACACATTCAGGCAGATTTCTTT
GCGTGGTGGCTTTAGGGGTATCAGAGAACACTGGAGTCTTATTTAGATGGAATCGGAGAG
TAGGTCCATGGCTGGACTCTGTAACCATGGGGGACATCTGTCAGTTGCCAACCTTAACAG
GCATGCAGCAAGATTACCCACGTGGAGTTAAGCTCATGATATTGCTGCAGTCTGACGCCT
GGTGTTAAAGCACAGGATGACGGCACAGTGGCTGTGGCCTCCCTCTCCCCTTTCTTTCAT
CTGGGACTCTGGCTGTTCTAGTGAGAGAAAATGGGGTGGTCTTTGCAATCAGGGAGATGT
GAGTTCATTTACTGGCGGCCTGTCCCTGGGCAGGAGGATCCCCGAGCCCCTCTTTGCTTT
AACTGTAAAAGAGAGATAGCATATTTCTTGGAAGGTGGTTTTGGGATTTGGTTAAGACCT
TTGCAACCCAGGCATGCAGACGATGCTTAGTAGATTGTCACTCTCGTGATTTAGGGTTAC
TTATTCACATGTCTCTTGCCTCTGTGACAGGGGCATGGTGGCCCATCAAGCTTATCTGTC
TATGAGAAGCTTTACTGAGTGGTTTCGAAGACAAAATGTAACTCCAGAGGCACCAAACCA
GGTTGCCAGGCAGTGGAGACATCTAGAAGGATGACTGGGAGAAGCAGATTTGGCTCAATG
GATACAGCCTCCACCTACCATTTGGGAGGTCCAAGGTTCAAACCCAGGGCCTCCTGACCC
ATGTGGTGAGCTGGTCCATGTGCAGTGCTGATGCACGCAAGGAGTGCCGTCATGCAAGGG
TGTCTGCCGCATAGAGGAGCCGCACATTCAAGGAGTACACCCTGTAAGGAGAGCCACCCA
GCGCAAAAAAAAAGCTCAGCCTTCCCAGGAGTGGCGCCGCACACACGGAGAGCTGGCACA
GCAAGATGACGCAACAAAAAAAGAGACAGATTCCTGGTGCTGCTGACAAGAATGCAAGTG
GACACTAGAAGAACACACAGCCATAGAGCGGACAACCAGGGGGGAGGGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGGGCAGATTCATCTTGT
CACGATTGCTTGTCCATCTGTATGCCCTCAGTCAGGTATGAGCACAGGAGCCCCCCGTGT
GGTAAAGCTGCTTGTGCTTTGAGTGTGAGTTGGTTTGCTTCTAGGAGTTTCTTTGGGGAC
TAAGTGGTAGGAGGACGTGTCCAGGAGTGACTGCTAGGAGGACATGTCCAGGAGTGACTG
CTGAGCGTTCCCTGGTGGCCCCTTGGCCCCAGCGCCAGGCTCTGCTTTGTTCCAGAGCTT
TGAAGCCCTTGTGAGGAAGGTGTGGGCTTTCGGAGCCTTTGCAGATGTTTAGACTTTTGC
TCCCACTTCAGCTGCCAAGTTTGGACTCCACGGGGCTCCCTCGCTCTCCGCACACAGTCC
TGCCCGCTCCACCACTCTGCAGTTTCCTCAATGGGACTCGAGGACCCGGTGCCCTGACAG
GCCTGGTCACTGCAGGGACATGATTAGGAAAACCCTTCTCGTTTGGCCACCAGGCTCGGG
TCTTGCAGATACAGCATCAGGATTTAGAAGTAAAAATAACTCCTTTTAACATCACGAGGG
ACGTCGTGTTTCCTTTTGAAAGGGGCAGGGCAGTGGCTATGCCTTCTGAGTGCAGAGGGG
ACAGTTTTAGCCCTGTGACTTGCCACCTTTCCAGCCACTCCGGTGTTCTTTCCCTCCAGC
CAGGTGTGTTTTATGTCCAGTAAGTCCTAGAAGTGGATTTCTTCTCTTATTCAGGGTGGT
CTCTCTAGAACACTGGAAGAGAGTAAAGCAGCAGTAGCACAGAGGCCAGAGAGGAAGGGG
GAGGGCTCTCCTAGGCCTGGGGGGGCCTGGAGTCAGGACTGTCACACTGTGGGAAAAACG
TGTGCGTGCCCGAGTGTGTGCTCAAGGGTTGTCTTTCCCTGCGTGAGCAAGGCTTGATCG
CACTCTGATCACTTGGCTTACAGTGAAAGCCAAAAGCCCTAGCCGTGTGAACTGGGCCTG
GGCCTCACGTGTCCTCTCGTCCAGCTCGCGGCTGCAAATTCCCCACCCGCTTGGCTGGAT
CATGTTAAAACATGCGGGTCCTTTTCTTCCTCGATGTAGACATCATCACTGCATCCATCA
GGATATGGGGATTTTTTTAAAAATCCATATATCTTTAAAAACATCTCTAAACTTTATTCA
GAACAATAAATCAATGGAACTATAAAAGAAAATTCCAAAAAGGAGAATTGAGATGTAGCC
AATATGACCAGATTAAAAAAAACTGTTTTATATTTTTTATTAAATCTGTTGGCAAAACAA
CACGCTGTTAAATGGGACAGAATAAATCATAAGAAGAGCTGTCACATCTGAAACTTCAAT
ATGTAATAAAGGAGGTGCCACTACTCAAAAGGACGAATTATTTAATATATAGAGTTGGAA
CAACTGGCTTGCAATCTGGAAAAAATATTTAGTATCCATCTTCATGTGACAGACCAAATA
ACTAGCGACTGAGGCAAATAAAATACTTTTGAAATTGTATTTTAAGATTCAGATAAGTGT
GTATTAATGTGCATATTGGTGACATCATTTCAGATGTAATTACTTAATTACTTATGTTTA
TGAGGTAAACATATTTGGGGGCTGATACTAAAGACTTCAAGTTACTTTCTATTTTCTTTT
AATATTTTCATATTTATAAAAGAAAATATTAAATTTCTAAATGCTCAGAAGCAGTGGAAA
AGCCCTTTATTATATGAATTGTAGTTATACAGACTCAGCAAATGTTTCATACGATTCCTG
GGGTAGCAGAAGTTGATTCTCTCTCTCCATCTCTCTATATAAAGTAAAACATAATTATAC
AAAGTTTCTTAACCTTTAGTGAAGAAAAGAAAAGAAAACTTACCTCTTTTTAAAAAAGAT
ATGGGTAGTTTACAGGTATATTGATAAATTCCAAGAATTTTCTTCCTTCCTAAAGCAGAG
ACATAGACACCTTTTAACGGCTTTCAAGGTTTAGTTCAAAGGGAGAGCTTTTCTAAGGGA
AAACAGTTTGGATGTAGACATCTGAAAGTCACACTGTTAGATTTCTGCAAATGGAACTTA
AACTCCTCCAAATTTTGCATTTGCATGAAACCTACCAATAAAACTAACAGAAAATTAACT
CATAGTTATGGGGGACATTTGACTTTTAATCAAAGTATACTTAGTTTGTATGGATTATCT
TTCTGATCTCTAAGCTCTGTGACTGCAGGGAATTGTATCGTTCACCCTTGAACTTCCTTT
GCTCACTCAGAAACTCTCAGGATCAGTAGCATCCTTAGCACTAGGGAACCTGATAGAAAC
GCAAAATCTTGCGCCCCCCTCCAGGTGCACGAAATCAAAAATGCTGGGGATGGGGCCCAG
CAATCTGCATTTAACGAGTCTCCCAGGGATTCTTTGCTGATGAAAGTTGAGAACCACTGG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACCCAAGTT
ATGTTTTGTTTTAGTTTGATTTTTTTCTTTAGTCTAGAGGTTAAGAGCATTATTTCAGAC
AGCTTGGCTTTAAACCCTAGCTCCACCACTTAACTATGTCTGTGTCATTTAACCTCCGTA
AGCATATTTTCCTTGTCTATAAAATGAAGGATAACAGTACATTAAATATAGTTCCTAGGA
CATAGTAAATGCACAATAAATAGTACTTGTTTATTTAAGATGTAAAAAGCTCATTTATCA
TTAATACACACTATAAGCTTAATATGTAACTGTTTATGCTAAGCCACTGAAATTTATGTA
AATTGGGAGAAATTTCTTAGTGATATAAAGGAGGAACTTTTAATACTTATCTCTAGGAAT
AATAAAATTACAAATTCGAAATGTGGTTCACGAATTCAGTTGTGAGTGCAGTTCATGATT
TGTGCCTTCCTGATGTCGATACCAGGCAGTGTATTTCCTTTTGCCATGACATCCAGGAGG
GCATAAAATATCCTTACTTAAAACTACTTAGTGACCTCAGAATTTAGGTGATCATTTCCT
GTACTTCTAAAAGAATGTGGAAATATACATGGAAATGCCATAAGGATTACTGTTAGCCAC
AAATGGAAGCAGAGTCACCTTTCAGAGAGCAATTAAACTCAATTTTTAAGCTTTATTTAG
ACTTTGTACATTATAGTTTAATTCTAAATCTTAGATTTTAATTACTTAACTTTGAAAGAT
CAAATGGATCCTACATCTATTTATACAAATCTTACTTTGAGGCAAGTCATCTAGCAGGTA
ATTTATGGACTGATTAATTCCACATGGCATTTAAGTCACATGCTGACTTGATCAGTTCAG
GCATGTGCCCTGTTCCTTCCAGGCCACAGGGGTGATGGATCAAGTAGTAACATTTTCAGA
TGTGGAGGCCCCGTAAGACTGCTAACATATATCCATAGTAATTCCAAAATCAGAAGGATT
GTCTTGAAAAAAAATGTTTCACCTAATACCAATACCGTACAAGCTTAAGTAAAACCTGTG
TGGTGCAGTTCTCCAAGAAAAACCTGTGGGTCTGAGTCAACCCCCCCTTATCGAATCATT
GCTTCGAACCTGTTGGGTAAAACCTCTGAAAAAATAATGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
ACACTTCTAACCCTCTTGCAGTCCACCAGCCAAGGTACAAGCTGAGGATCAGGCCTTGGC
TGTGAATACCAGATAGTACCAGGTCCCTGGACTTCTGAGAGTCAGTGGAAGTTTCTTCAG
TGACCAGCCCCATCCAGGTCCCATTGCCTCATCTCCCCAGACCAAGCCTTTAAAGAAATG
GGGTAAAAGCCAAAGACATTAGAAACCCAACCTATACTTGAAGGAAGTTTACCACAATCT
CAATGCTCAGACTCATTAGGCTTGAGCATTGGATAACCTGTACCTTAAGTCCTAGGGATG
TGGGCTTTTGGAGAACGTTGGCATAACAACCATAGCACAGTATGGAGAATTGCCCTGGTT
GGCTGCTGCTCCAGACTTAGCCAGCTAGAAAGGTGTCCACCCAAAATTAGCTTGGGAAGG
CAACTCAGAAATTATCTGGGGAGATGACATTATTTAAGTGTGTTTTAAATTTAAATTAAA
ACTATGTAGAAGAAGTAAATCAAGCACTTTTTTTGGTTAAAGGCCAATCTGTACATTTTA
AATATTAGCGATGTTTAAAATAAAACTTATGCCCATTAGAGAAATATATTATCCTTGTGC
TTAAATTTAAAATAAATAAGAGGTTTAGACTTATGTTTACGAGTATGGGGACATAAGCCA
TTCAGAATCATATTGATATTTTAAATTAAAGGGTCGAGAATTAGGTTGTCAAACAGCTGG
AGTACTCTAAAAAGAAACAGAATGAGTAACTCACTGAATGCAGTTTAATATAACTTTAAA
GCCCCCCCTTAAGAGTAATTGTTAAAATTTGCTAGACATACATAGAATAAGATTGGGAGT
TGAACTTTAATTCTTAAGAGAAAAGGAGGGATTTGAGTTTAAAACTTAAATGCATTGATA
TTAATTTTTTAAATAAATTCCAAAGGAACTTTTGCATTTTTCCTGTACACAAACACTAGT
CTCTAGGGTACTGTTTTAGTTTCCTGGGTTGCTCAGACAAATACCATGAAATGGATGGGC
TTAAACAATGGGAATTTTGCTCAGTTTGAGGCCAGGAAAATGTCCAAATTCAGGCATCAT
CAAGGGATGCTTTCTCCCTGAAGTCTGGGGTGTTCTGGGCCGCCAACAGGTCCTTGGTTC
CTCTCTCATATGGGCAGGGCACATAGCAGCATCTCCTGCTCTCTTCCTTTTCTGGGTTTC
ATTTTGCTCTGCTTGTTGTGGCTTTTTCTCTGTCGGGTGGAATTCCGCTTATAAAGGACT
CCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTAT
GGCTTTCCTCAACTTAGCCTCCCATCTCTCACGGCTGTCTGTCACTGTCTCTCCCCTGTT
TTTATTCAAGTCATCTTCCCCTGAACTAAAGGTCTTTGCCCGTCCCCATCCCCTCCCCCC
ACCTCCGGCCCCCACCTCCTGCCCCCACCTCCTGCCCTGGTCTGGGAGCTTCACTGAGGA
ATTTCTTCTCTGAATTCCTTCAGGATGTACAGTCCATACCATTCAATTTAGCACTGAATT
ATATGCTCTCTCATCACAGCCTCTAATTCTTTCAATGTGTGTAAGTCTTGTCTTCCCAGC
TGGAGCTTCAAAATTGTCTTTTGCTTCTTTATTCCCACTTAGTTCCAGCCAGCCATTTAG
TCAATCTAACAAAGAAAAAGAAGCAGCTCCTGGATTGAGTGAATGCATTTTGACTTTTTT
TTCCTGACCACTTTAGATGAAAACAAATCACAGGAGGCAGATTTCAAGAACCGTCTACAT
TGGACCGCTCCCATCGTGTAGTATGGTGCTTGGACATCAGAATACCTTGGTTCAGTTTCT
GGCTCTTTCTTCCTTGCTTTGTGAACTTGGACAATTTTCTTAGACTGCTCAAGCCTCAGT
TCCTGGAGGCCTTTAGCACAGTGCCTGGCAAATAGTAAAGCACCATAAATAATCACCACC
TTTAATAGTGAAGCCCCTGTCAAGAAAGTTCTAGTTTCCACAGAAGAAGGGAATGGCATA
CTCTCCAGCTTGAGTCATTGCTGTTTTCTTTTTTTTTTTTTTTAAAGATTAATTTATTTA
TTTCTCTCCCCTTCCCCCCCACCCCGGTTGTCTGTTCTCTATGTCTATTTGCTGCATGGT
CTTTTGTCCGCTTCTGTTGTTGTCAGCAGCATGGGAATCGGTGTTTCTTTTTGCTGCATC
ATCTTGTTGTGTCATTTCTCTGTGTGGGAGGCGCCATTCTTAGGCTGCACTTTCTTTCGC
ACTGGGTGACTCTCCTTATGGGGCGCACTCCTTGCGCTTGGGGCTCCCCTACATGGGGGA
CACCCCTGCGTGGCACGGCATTCCTTGTACATATCACCACTATGCATGGGCCGGCTCCAC
ACGGGTCAAGGAGGCCCGGGGTTTGAACCGTGGACCTCCCATATGGTAGATGGACGCCCT
ATCCACTGGGCCAAGTCTGCCGCCTCATTGCTGTTTTCTGAGCAGGCCGGAAGGAAGGCT
GGGGCAGCCATGGGGCTGCAGCCGTTCACCTCCTTTATAGCCCTCGAGCTACCGCTGCCT
TTTGGGTCCCTGATGAGGGCTGGAGTTTGGGGTCCTAGCCAGGGCACATTGTTCTAAGTC
ACCACCACTCTGTTGGCTGGAGGGAGAGCTAGCAAATGTGAGGAACCAGAGCTTCCATGA
AAGGATTCTAGGATCTTACTGATGCATGGGCTTTGCCCCACACTGCTTTCTCAGCCCATT
CAGAGCTGTGCAAAGACTTGATCCTTGAGTCACCACCCTCTACCTGAGCCTGCACTGTAG
GTGTCCTTCAGCCTGCAGGGGAATCAGTGCTCAGAAGTCTGAGTAATCCTGTGGTGCCCT
GGAAGCCTGTCACATCTGAGCAGGGTCCACTGTGTGCACACTGAATAGCTTTAAACACAG
CAAAGCAGGTAGGCCTCTCCCTGCTCCTAAGACATTTTAGACATGTTTTTCTAGTGATTA
TTTGAATCAATGAGCCTGAGCTTTATGCTTGTGCCTCAGGCTCCGTTTTGAAGCCTTTAC
TTCAGTGTCATGAATGCCACTTTCTGCATTTAATAAAGAGAGAAGTGTTTTGACTACCAT
CTGCTTTGCCCAGCATGGGCTTCTCCTAAAAAAGAATTTTGAATACCAGTCTTTCAGAAA
AATGTTGGTTGCTGTGCTTTTTCCTTTTGAGTGGTGCTCAAAGGATCAGAAAGAAAGGCC
AGTTACAAAGGTGCATTCCAGGAGTCCTTTCCTTTGTTCTCCCTCTCTGGTCCCAACTGG
CACAGTGGCCAACCCTCAGCCAGGAGGAAGTGTATATGCTGAGTGCACTGGCCAAAGCAG
TTGTGTGCACCAGCTTAGTGATACTTGACAACTTACAAAGGGCATGAATTGGCAGCAGGG
CTGCCTGTGAAGTCTCAGCTCAACTCAAGGTTGGGCTTTTGTCACTATGGAAGAGTGCCA
CTAGATGTGCCAGTTGATGCCTCTTGGTACCTTCCGGGTGCATTGACCTTCCAATTCTGT
AAACAGATGTGCTGCAGTGGAAAATTCTCTTTCCTCATTTTCTTTGCGCTAGAGCATGAG
GCCCCATTTAGCAAAGGTAATTCAGGAAACTGGGTGAAACAGACTCAAAGGGTATATGGG
CTGTTGAACATCTCAGAGGTTGGCTGTTCTCTATAAAGGCACTGCGGGTTGTATCTACGG
AACACTTGCCTCGCTCCCCTTGATGGTCCATGAAATCTCTACAGGTTTTGTTCGAGAAGG
GCAGAGCTGTATCCTGAAGTTCACTTTGCTGACTGGCTGTGTAGAGAATGTGCCTTGCCA
CCTCTGGTCTACGTGAGGCTCAGCTCTGCTCCCTGAGTATCTGCCTGGGGGCTGGTGAGA
TTATTTTCTGAGTAAGCTTTGGAGGCTTCTCAGGAAATGATTGCGGGCTCCAATACTTCT
TTCCTGTTTAGAGGCAGATCAGACAAGCGCCTTTATGTAAGGCACACAAAACAAAAGCCT
GTCAAAATGAGCACTCAAACCGGCTAAGGAATACCATATAACTTATTCTGGTGTATTCCA
AAATGTTATGTTGTCCTGAAGTTTTGTTTTGCCAAATATTGCTTGAGGATAAAATTTCCT
TTAGCTAGAGTCTAGCAACCCCTTCTGTTCTGGGTATATATTGGTCTGTATCCTTATAGG
GTGGCTTTTTGGGAGGGACGGGTGAAGGGCAATAGAATCTAGAAGGATTTTAGTCTGCAC
ATATAAATGTCTCTTCTTGAAAACTATTTTAAAAACATTTATGAAGTAGTAATTAATATA
TGCAAAAAGGTATATAGAAACATGGAATAAATGCCCTTGCATCCAACACCTAGCTTAAGA
GATGAAACATCCCAATTTAGTTAAAGTACCCCTATTGGATTCCAGCCTGCTCCATTCCAG
CCACTTCTGGCCACTATTCTGAACTGGTATCTATTATTCTCACATATTTTTCCTTATGCT
AGTATTATCTTATGTATGTATCTCTAAGTGACATAGAGTATTTTTCATGTTTTTTTTAAT
TTCATATAGCTGAAATCTCTTGTATATTCTTGTATGACTTTTTTCTTCCCCATATCAAGT
AGATCTGTGTTGACCTAAGTGGTTCTAATTAACACATATTTACTTTCCTATATTATTTCA
TTGTATGAATAGATCAAAGACAGAGAGCATTTACTGGTACAGAATATTTCATTCATGCTG
TCTTGATAGAGAATGGAAATCTATTGCCATATCATTTTGACATGCTGTCCCCCATAATTG
GATCATTGCTTTGTATTGGTGTATCATTGCCTTTCTGATATATTGTAAGATTTGGAAAAT
TTAAACAGGGGAAATTTATTATAAGAATTATTAAAGGGAAGTGATTTGGCTCAATGGACA
GAGTGTCTGCCTACCACATGGAAGATCCAGGGTTCAAACCCAGGGCCTCCTGACCATGTG
GTGAGCTGGCCCATGCACAGTGCTGATGCATGCAAGGAGTGCCGTGCCATGCAGGGGTGT
CCCCCATCTAGGGGAGTCCCACGTGCAAGGAGTGCACCCTCTAAGGAGAGCTGCCCCACA
CACAAAAAGTGCAGCCTGCCCAGGAGTGGTGCCACACACACAGAGAGCTGATAACACACA
AAAGATAACACAACAAAAGATAACACAACAAGATAACAAGATAACACAACAAAAAGAGAC
ACAGATTCCAGGTGCCACTGACAAGAATACAAGTGGACACAGAAGAACACACAGAGAATG
GACACAGAGAGCAGACAGCTGGGAGGGGGGGAGGGTAGGGAAGGGGAGAGAAATAAATAA
AAAATCTTTAAAAAAGAAAAAAAAGAATCATTAAGTTATATAAAAAATAACTATCAGATG
TAAGAGAGTTCTACATGGCACCCTGCAGCCATAGGAGAGACCCAAGGAAGAAAACACTAG
GAAGGAGAAGGTATGATTTCACCTCTGGACAGCAGAGCAGTTTGTTGGTTTGCCTGGTGA
ATCAGAGCTGGTGCACAGTTGGGCAAGCAGGCAGCAACCTTCTAGGTGGTAGGTGAGCTA
AATCCATGGCACACAGGTTTCCAGAATTGGGACACCAATGGGCTGGAGGCCTAGAGCAGC
AGCAGCAGCAGCATTTGGCATCAGGGCAGCCCAAGGGAACAAACCACTGGGACTGGAGGA
CTGGGAGTGAAGAAGTTACTAGTGCAAGTGGAGACCTGGATTCATGGTGAATGTGCTGAC
AGCGCTACAGGAAGTTAGGACTGAGCAGTTGCCAAGGACCACATGTTCTCGGTGTGTGGC
TGGAGCAGGGCACCGCTGATGTCCCAACTGTGATACTGCTGACCAACCACGCTAGTGGCC
AGGCAAAACAGGAGAGCCCCATCCTTCTGCATTGTTGCTCCAGTAATCCCTACTGAGAAT
GTCACATCGTGGTTACCATAGAGTAAAATGCTTCAAGGAGTTCCATCCGTTATCACCAAG
CTGGTATTGAAGGGTGAATGTGAAGCCAAGAGGCAATAAATTAATAACTGGCGCAGATGT
TACTAGAAAGTAGTCTCATTGTCAATTAAGTATAACTTTGCAATTACATGCATACATAGA
CACCAGGAGGGTCTGGAAGGTTTGCGTGAGGTGGTGGCACTAGAAATGAGTCTTATGTGC
TCAGAAATTGGGCAAGAGAAAGGAGAGGAAAAGGGCATTCCAGGAAGTGTACACAAAGGC
ACAGGAATCAGAGAATAAAGAAATTCAGGGATGTGTGAGTAATTCAGAGTATGCCAAATG
AGGATGAGTGGTAAGAGATAATTTTGGAGAGGAGGAAGTTAGGAAACATTTCAGAAAAGT
TTGGGTAATGAAGCAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACCAGTAGGCTCCTAAATAGCCATGAGATA
ATATGAGTGGGTATGTAACATCATCACTTATAAACTGAAAGCCAAACAGAATATAAACAG
TCAGAAAAGTAAAAATGTAGAAAGAAGGAAATAAGCAGCAGCATTCTCTCCCAAGAAAAC
TTGGAAAATGAGGCTGGGAAAGAGGACGTGGCCATGTGGCAGACAGGTTGGAAGCGAGTC
CACGAGAGCAGGAGCCGCCACCCAGGCTCAGCTGAGCAAAGCCAGCGTCCTCAGTGCCAC
CAGCTTGTTTCTCCCCACTCGTGACTGAGCTTTCCCAGCCATGGACTCTTGGACTTTCTG
AGGCAGGTTTATGGCTAATTGTCCCCTGGAGCCACATGTTTCAAAGTTTGATCAGTGGAT
TGCTCAGAAACATTCAGAGAATTTGCCTTTTTAAAAATAGCAAATCATAGCTCTGAGGCC
AAGTTCAAAAACCAGTGCTCTAGGGGTTCATTTGCATAGTGAAGCTGGAAGATGAACTGA
GTAGACTGACAAATGGCCCATTTGTGAAATAAACCTGGGACATGAACTAGCTGTGATTAG
CAGCTCCTCCCTCTGCTCAGCAAGGGCTCCAGAGAGCACCATTTAAGAATAGTTTGAGCC
ATGAGTCCCCAAGCTTCTCCCCGTATCACCTCGGATGACCCCGTACTGGGAAAGAATGGC
ACAGAGACCACCAAGTGAAGGTGGTGGGAGACCTCCCACAGGGTCCCAGGCCAAAGGGCT
GTTGTTTCCGTTTGCAGAATCAGTAGAACTTGCATCCTACTGAGTTCCATCTATTTCCAT
CTGTCATTTCAACCTCTTCCACCTCTGCACAGTTCAGCAGTATCACACTTAGGGTTTAGC
TTGATGACACCTGAGAAAGGCAGCCAGCCACCTGGGAAACTGCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACACTGCCTGAGTAT
TTTCAACATTTGACTCCAACCAGATATCGACGAGTGTGCGACCAGCAACGAAACGCTGTG
TGCACACATCTGCATCAACACCCTGGGCAGCTACCGTTGTGCATGCCGGGAGGGCTACAT
CCAGGAGGACGACGGGAGGACGTGCACCAAGGGTGACAAGCATCCCAATGACACTGGTGA
GTGGGGTAAGTACAGTCAACTCCCTGTCCCCAGTGTACCTGGGAGCCCAACAAGACCCAC
TGGAGAGCTGGGGAGAGGAGGCAGCATGGTAGGTGGGACCTGGCTAAGAGAAAGGTGGAC
TCTAAGGAGACGTGGTGAGAGCCTGGGCTGTGAGCAGTGCGGACTGGAGGGCACCGTCTC
CCAAGCTGAGGCAGCACAGGCATGGCTACCTCAGTAATGCTTAGTGATGTCCTCCAGACC
AAACTAGGATGAGGGATGAGCAGAGAAGAGGCTGGAACACTGTGTCCTCTCAAGGACACT
GAGCTGAAGGAGACCCTCCTTTCCTGAAATGTTCATGTGATGCATTTCCCTGGGAAGGCA
CAGCCTATACCAGTGCTGCCCGAGGGTCTCAGCCACAGACTGTTACAAGGGTCATGATCC
AATAAAAACAGAAATTGAGAGTGTTTAGGAAGTTTGATACCAACTTGACAAAGAGATTTT
ATCCAAACCCAAAAATGCATGTGTATATTTTATAAATTTTGAAGTTTCTAACACTTCATT
TCTATTGTATTTTGCAAGAGTATCGGTCCACATGAATTGGAAGTTGATTTTTTTTTTTTT
AACTCTTCATACAGAGAGTTTGACAAGCTGATTTACCTCTCTCAACTGGATTTAACAGGG
CTATCTGATCACTCAAGGATATGATCAACCCAAATGTTGGGTTACTTCCTTATTTCAATT
TGGGGGGCAGGGGTAGAAAACCCGCAAAATTGCCATCATACATTTAGGTTGGTACAAAAG
GAATTGCAGTTTCGGACTGTGAATTTTAAATCATTATAACTAAGTTCAGTCACATCTTTA
TTAATCAAAATAGGAACCATTACAATCAACACATTTTTGCCAACAAGAAATAAGTTTACT
TATTCCTGTAGTATAAAAATCCATTCTTTGGGATTCAACAAACTCTTGGAAAGCATTTTC
TGCATCCTGCTGGTTGTAGAAGCATTTTCTCCTGCAAAAAGTTGTCAAGATGCTTGAAGA
CATGGTAGTTGGTTGACAAGAGGTCAGGTGAATATGGCAGATGAGGCAAAACTTTGTCGC
CCAATTCGTTCAACTTTTGAAGTGTTTGTTGTACAATGTGCAGTCAGGCATTGTCTGGAG
AAGAATTGGGCCCTTTTTGTTAACCAGTGCTGACTGTAGGCATTGCAGTTTTGGTGCATC
TTATCAATTTGCTAAGCATACTTTCCAGATGTAATGGTTTTGCTGGGATTCAGAAAGCTG
TAGTGGATTAGATTGGCAGCAGACGACCAAACAGTGACCATGACGTTTTCTTGGTGCAAG
TTTGGCTTTGGGAAGTGCTTTGGAGCATCTTCTCAGTCCAGCCACTGACCTGGTCATAGC
CAGTTGTTGTATAAAATCCACTTGTCATTGCATGTCACAATCCGATCGAGAAATGGTTCG
TTGTTGTTGCATAGAATAAGAGAAGACGACATTTCAAAACAGTTTTTTGAATTTTCGGTC
AGCTCATGAAGCACCCACTTACCAAACTTTTTCACCTTTCCAATTTGCTTCAAATGTTGA
ATGACCATAGAATGATCAATGTTGAGTTCTTTGGCAACTTCTCATGTAGTTGTAAAAGGA
TCAGCTTCGATGGTTACTCTGAAACAGTTGTTGTCAACTTCCGATGGCCAACCACTACAT
TTCTCATTTCTCATCTTCAAGGCTCTTGTTTCCTCTGCAAAACTTCCTGAACCACCAATG
CATTGTACATTCATTAGCAGTTCCTGGACCAAATGTGGTGTTGATGTTGCAAGTTGTCTC
CACTGCTTTGTAACCCATTTTGAACTCAAAAAGAAAATCACTTGAATTTCCTTTTTGTCT
AACATCTTTCCATAGCCTCAAAAAAATTAGCAAGTAATAAGTCCTTAGCGAAAAAACATA
AAGAAATGCACATTAAAATGATGTATATCACATAACCACATTTACTTAAGAACGTATGCC
AGTATCAAATGGCAAATTTCAACAGTGCAAAACCACAATTGCTTTTGCACTAACCTAATA
CTTCAGGGGCTACTTTGATAAGGGAAATTCCACCAATTCCCTCGTGAAGCGCTCTCCACC
AAGTCACAGATGCCAGCCTTGTAAGACCTTGTAGGGCTTTCGGCATAGCCCAGTGCAGAG
GGAAAAGCTTTAAAGCCCAATGGACTCCACTGGCAGCCATCGGCAGACCCCCAAAGTGCA
TGGCCCCGCTGAGGAAGGGAGCCTCCAGGACCCTCAGGCCGCACAGTAGACAGGGAGGCC
CCAGGGAGAGGCCCTCAGCCAGGAGAGAGCCCCGCGCTGGGCCCTCGTGGCCCTCGTGCT
TCTGCAGCTCCTCCAGCTCCTCCAAGCCAGGAAGCAGCTGTCCGTGTGGAAGGGGAAGTG
GCGGGAGCACAGGGAGGGGAGGTTAGCCAGGTCTGGCATCCCTGGGTGGGCAGGGGCTGC
CTCCAGTGCCTTACATGTGCCGGAAAATGCAGGGGAGATGACAAGAGCCAGGCTATGTGG
GGCACTCAGGAGATGGCGGCTCTCGGATGTAGCCTGAGCTCCAGCAGGGTGGAAGGCAGC
CTCCGCCAGCTGAGCCCAGCAGACAGCTGGAGACCACCTGCCACATGTGGAGAAACTACA
AAGCGATGGCCTCAGGAGCCACGGAGTTGAGTCACGAGGAAGCTGCCACGTATTAGAAGT
CGAAGCAAAATATCCGCTTGGGGCCCGCTCAGGCTTGGGCAGTTTGGGATAATTTGAATG
AATGGGGGGCCAGGTGGCACTTTAAAGGCCTGAAGCCTGTGGGCCTGCCTGCCCGAGGTG
AGCTGAAAGCAGCAAACAGTTAATGGAGGAAAAAAATAACATTTACAGACCACTTTTTTT
TTTTTAATGCAAAATCAGTCACTTAATTTTGCCCCCTATTAGGGGAGGTAGAAGAAGGAT
GGGGCTGTATTATCTTACATCTTAGATTGTGAACTTTATTGGAAGGAAGAATCAGATTGA
AAAATGAGTGTGACCTTTTAGCCACTGATGGATTAATGTGTGGCCCATATTTGAGAATCA
GCAACAGGCAAACAGCTTTCTAAATTTCCACTCCGGAACAGGATTTCCAGTCGTGCTCAA
GCCAGGTAACTCTGGCTCTGCAGACTGTGAGCTGCTTGTCCTGGCAAGTCAGGGACTCTG
TGCCTGTCATTTCTCTCCAGGGGATATGCCGTTGACGTGCAAGGCAGCCTTGAGCAACCC
TTCTGGAAAACAGGATCAGGCACGTCCACTGCACACCTTGCTGGGCATCGGGTACAAGAT
TCGATGTGAGGGATACAGAAGTCAGGACCTGGCCCATCCCCAAGGAGCCTCCTGCTTGGT
GGGTAGAGCAGTCTGCAGGGACCTTAACTAGCAGGGAGCAGAGAAGGCTGGTGGACTTCC
CGGAGACCAGCACAAGGCTTTATATGCCCAGTGGACTTGCTGCTCTGTGGTCTCAAGGGG
CCTCCCCTCCTGCAATAATTCCTCTGCTCCCCAACGTGCCCCTCTTCGATCCCCAAGGCA
GCCAGTCTCTGACACTAACACTGCCGTGTGGTACCCTGGGATGACACACGTGTAGTAGCA
GGGTCTGCCAGTAGGAGGCACCCACCTCCTCCAGTGTCCTTCAGCCAGGGGGCCCAGGAG
GTCTCTTTGCATCCCTGCAGTTAGCAGTCCGTTGTGCAGCCTGGACTGGAACCACATTCA
GATCTTTCCTTCTCAGAGGAATGAACTGTGCTGCTTAAAAATTGCTCAAACGAAAGTTTC
AGACAAGTTCGAGAGATCAAGAACTTTATGTAGGTGATGACGAATATGATTTCTATGACT
GAGAATGAGCCAGTAAAAAATCTAGTAATCATAAAGGGTCCATATTTGAAGTTTTCTTTT
GCACCCAAAGAACTCTTTACTAATATTACTTTCACTTTAAGTCATATTTTATCTCAACCA
CTTATTACAATACTTTTGCGAAGGATGTTCTGCAGAACTCTGGGGTCCTGTGAGATGTTA
ATAAGCATTTCTTTCTTAAAGCAGGTTCTTTGTTCAAATGTTCAGGGCAGAGTACATTAC
TGCACCACTTCTTAAAAATTCATGCAAATGTATTAAAAGCTGTGAGCCATTCAAACAAAA
CCTTTAACTTTGATTAAACCTCCATTTCCCAGAAATTTCTTGAGGAACACCTATAAACAT
TTCAAACTAATGGTGTACTGAAAAATAAAGTTTGCAAAATGGTAACTTATCAGAATCACA
GATCTTATACCTGGGGCAGAACTCCCTGGGTCACGGGGTCGGCTTTCAGGCAAGGATGTT
GTCATCGGATGAGGCAGCCCAAGTCCAGGGTGAAGGATTTGCTGTCAGCTAAGAAATCCT
TCCTATGCAGCCGTATTGAGAGGCAGTTGTTCCTGCTTACAGAGACTTAAATGGGCCATC
TTCTGTGGAATGAAGTAAGAGCTGCCTGGTGATGAGACCACAGAGCCTTTTATTAAAATT
ACACCGATTACACTGGGTTGCAGATTCTCTCCTCTTCCTCCTCCTTCCCCATCGTCCTCC
TGGCAGCTGCAAGCAGTAAAACAAAAATCTGATCCGCCGCGGCTATCTACTGCATCAGGC
CCACACACACACACCAGCAGCATTATAAAAGAACTTCTCCATTTTTAATTTTCAGTAGCT
GGTCTCCACTGAATTCACCACATAGTCACAGACGACTACCATATGGTTTTAGTGTTTTAC
TACGAGAAACACTACAGCAACAGTAACCAAAGCTTTTTGGGGCTAGGGTCTGAGGGAAGT
AATTTATATGCTTAATTAAAAACAGGAGAGAGGACAGACACTTTGTATGCCATGAATGTT
CAAGCCAAAGCAATGAGAGGTGGTAAGGTTGGGCTTTGATGGGCTCTGGGCAAAAAAAAG
AAAGAAAAAAGCAAGTGCTCTGGGGGGGGTTTCTTTGATTCGACAGTGGTGATGCTGCAG
GAAGCACCTGGGCTTGGCAGTGAGGGACCTGTACCTGCAGCCTGTGTGGTGCCTACCAAT
GGGCTGGCCTTGGGCGCACCTCTGGGCTCAGCGTCCTCTTGTAGACACAAGGGTTGAACT
AGTGGAGCTCTGAAGACCATTTCACCCTCTCAAACTTTTTCAAAAGTTGGTGGAACTTAA
AAGTAAAGCTCCTGAGACCCAGCCCCTGTGAGTCCACGTGTGGTCCTTATGCCAGGCCGG
TGCCAAGGCTCAAAGACATACCCTGCATCAGCAGCTTCTGAGCGGAGGCCTTTTCTCCTG
TTACCTCAAAGATGGATAATGAGCACATCCAAGAATTCAGCCCAGGATTAGGAAACATTG
GGGCCCCATGAGCCCCACATCGGGCAACATCAGAAGCAGCTAGGCTGTTTCGACTGCTTT
GGAACTCATCAATAAGCCCAGTATTTTATCGGGTCAGGTTTTTTTTTTTATGAAAAGATT
GATTTTTTACTATAAACATATGTGATCTGAAACAACCTCTTCCTCCCCTGTTTTTACTTT
GCATTGTCCAACGTCTATAAAGTTGGAGTCAGAGGAATTTGGAAGCACAACCCCAGCTGG
TGATTAGGAAAGCGTGCGGCGGGGCGGGGGCGCGGCCTTCGGGGATTGAAAGGTTGCAGG
CCACACACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGTAGCCGGAGCCAGTTTAG
TCAGCCCAGGCGCACGCTCTGTGTAAGCACGGATGAGGAGACAAATTAAGGAAATGTTGG
CTCCATAGTCATTAGCCTGCTCCTCTCTAGTTTTCAGCTTTTGTTTATTTTCTGATAAAG
TGACCATGACCTCCTGCACCACTTATAACAGTTCAGTGTGAAAGGAGACCAGGTGTTTCA
TGTAAACTTCAAGCCCCACTAATCCACACATCAGTGGTGCTCAACCTGGGAAGCACCTGG
GAAGCTTAGGAAAGGCCGGTGTGGGGTGCAGCAGTGGCCTCGGGATCTTCAAAGCCCCCA
CCCACCCAGGTGATTGTCATGTGTGGCCAGGGTTGAGAGCCGTCATCAGATATCAAATCT
GCACAACTTTTAAACACAGACTTTTTAAAACATTATTTCATGTGTGACACTGCCAGAGTG
AAATGTGTTGGGAACGTGCTGTGGTTTATTTTGGTTGGTTAAAGTTTACAAACATGATAT
CTGAGTCTTTCCTAACCTGAGGATTCTCACAGTTCAACACTGGTAAAAATTAGAGCTACC
TGCCCCCTTATGGCTAGCCACTCATACTGCATCTTTAAAACCTGATGTTGAAGCCAAAAA
GAAGATACCTCACCAGAACTTTCTCAGCGACATGTGACCACAGTGTTAATGGAGAGAACT
GAAAACATCAGAAATGCCTACCCAAGTTTCTCAATAAATTATTAATGTCGCATTTCCAAG
ATTATTTTTAACTCCACACTTGACATCACTATAGAGACATTGCAGGACGGAAGACCCCAG
TTCAGACTAGAGTCCATGTGCTGTGTCTACACAGAAAGAAAACACGTGTCCGTTTTTATT
TTAAACCCGCTGAGAGTGAGCACTCTTTCCAAAGGGTGATATAAAGTGCTGGACTACAAC
TGAAATTTTAGAGAGAGCTTAATGATATGCAATGACATGGACATTCATTACAATGAGGTC
TATTCTTGGAGCACCTGCATATTCGGGGCGCCTACAGGTGTGATTTTATTGAATCCTGAC
AATAGCCCCATGTAATGGATGATGTCATTATCACAGAAGTTGTGGCATGGTCAGCCTAAA
AGCTTCTAAATGGCAGCATCAAGCTTCAAATCCTGACTCTCTCTCAGGCCTACGTCTTAA
CTCCTGTGTCTATGGGAGCCTCAGAAGTCTTTCAGATGAAGTTTTCTTGGTTCTGCATGC
TCTGATAATTCCACAAGGGACAGAAGACAGCTGGGGTATTTCCAGGTAGAAGGCCGCTCA
GCAGAAGCTCACTCCAAGGAAACCAGAGCAGCGGTTCTTACACTAGTTGAGTGTGCATCG
AAGACAAACAGGGGGCCTTGTTAGACCATGTGAAAGCCCTACCCCCAAAGTGTAAGCCTA
AGAATTTTTTTCTAACAGGCCCCAGGTAATGCTAGTGGTGCTGGTCTGGTGCTCACACTT
TGAGAACCGCTCCCCTAGTCCCCGCACGGTCTTCTCAACTGAACCTCCCAATTGCAGACT
CACCGTGCACCCTCCCAGCCCACCCGCACAAGGGCGCATTTGGACCTGTAAATGCCCAGT
CTCTGCATACAGCATTCTGGGAGACTTAAAGCAAGGTATTCCCTTCCTTGGTCTTATCTA
TCTGGAAGTTTGAATTAAAGATACATCAGATGGGTAGGAGAGATGGATGGATAGATGGAT
GGATGGATGGATGGATGGATGGATGGATGGATGGATGTCATGGGTTAGATGAACAGATAA
ATGAGGTTGTAAGATAGGGTAGAGGAATGGATTGGATGCATAAACTGATCAGGAGATAGA
ATGGAATGGAAGAATGACTAAGTTGGGAGAAATGGGTGGCACCCAGCTATCCTAAGGTAT
TAACAAACCTAATAAACCTAGGGCATCTATTTATGCAGGGGGTCCGCCTCTACCATCAGC
ACAACCAAAATTGGTTAAGCCTGTGGTCTTCTATTGATGTATGTTATTTCATGGGCATTC
CACTGACTCACTATTATGTTGAAGTTTGATCTAAATAACCCTAATTCCCCTCAAATGTGT
TCCAACTCATGCAAGTAAGATTTGAAAACTGGTACATTAAGTAAGGGTAAAATACACTGA
GCCCAAAGGAAATTTCCTGACTTGTGGAAAAGATATTGGATTCAGATTCAGGAACCCTCC
ATTCTAAATCCACATCAGCTCCTACCTTGCTACATGAACTTCAGGAAGTCACCAACCCTC
AGTTCTCTCGTTCTGGTGTTCTTCTGAGTACCATTATCCGAGGATTTTGCTATCATCTGA
CAGAATTAAAAGGGCTTAGTGGGCCTCGTGCCTGTGCAGGGCACACGATCCCATTTGCCT
AATGCCAGGCACAGTACCAAGAACATTATATGCATTCCCTCATTTAATTCCCACAACAGC
TGTAGGTGGTAGGAATTATTTTTCCAGTATTGAGGTTGAGGAAATTGATGCTCATGGATG
TCAAGGAATTTGCCCAAGGTCCCAGAACTTGTCAGTGCCAGAGTTGGGATTTATACCCAG
GACAGTGTGTCTCTATGGCTCCTGCTCTTAACATCCCACTCCTCCATCTCCAAGCAAAGA
GCTTCCATACTCCTCCCTGTAACAGTCAATATCATGAAGAGGTAGGAGGTAAACCATTCC
CCAAATGTGCCAATTAACATGGGACAGGGCACTGCAGGTAGGGAAGTTACTGGCCGGACA
AAATCAGTCTAGAAGGCGAGGATTAACAAGATGGCCCTGTTATAGTGCATATATGCATAA
AATGGGCTTAAACTGCCACTTTCCCAAGAATCCAAGTGCCTTTTCCAAGCAACCACTCAA
AACCTCCCCTAAGCTATAGGTCGACCTCCTATATATTCAAGAACCACTCTTTTGCTTATG
GTCCTTCAACCAGAGAGTGCTGCTTCACCCACTGCAGCCTGCTGATGTGGGAAGTGTGCC
AAGCTGGTGCACTCCTAGTTTCAGGTGCACTCCTAGTTTCAGGTGCAGGGAGTACAGGGG
GTCAGGGTGCAGTGGGAGAGCTGCAGGTGATTGGTCTGAGATATCAGCTGCGGATTAGCT
CTGGGTCCTCTGCGCTCCACAAGAGCCATTGTGGAACAGGTCATCTGAGTTGAGGAAGGT
TTCTTCTGAAACCATCTGTCTACGTGTCTATTGAGGATCCATCTGTGAGATACCAGGAAG
GGCCTCAGGTTCTCACGTGGTTCCCGCTTGGCATGTGCCCCTAAGCCACTCTCCAGGGCA
GCCGGGAATACCAAGCTTTGAAAGTGGGACAGAGTGTAAGTGCTACCTGATTTCAGAGGA
CTGCAGCCTCTGAACAGAGAGGGGCACTTCAAGGAACATTTGAACTGGGTCTTGACACTT
AGTAAGATTCAGCCAATGGAGCAAAGGGAGAGGGCTTTCCAGACAGAGGCAGAGTAAGAA
GAGCATGGGGCTCAGGAAGCACGAGGAAAGCCTTGGAGGTGACACGTTACCCGAGTGCCT
CCAGTTTCCATTCCAGGTCGCAGCCAGTTGTTACCTGTTGCATGAACAGCATGCTTGGCC
CCAAGTGAGTTAGGAGAGTTTACACATCCCCAGGTATCCAACTGCCTACCTCTAATAGAA
CAGTCAGCTCCCTCTCACACACCTGCCCATCCCACTGCCTTTTTGTACCAACAAGGTCGC
CAGGTGCAGTTAACCTTGAGGTCTAGTCTCCCTACCACACAGGCTCATCTGGCTGTTTTA
GTGCCAGTTAGATGAGAATTGTGTGTATCCTTTTCCACGTCACCATTTTCCTCACCCATT
TTTTTCTTCAGCAATATATATATAAACTCTTGGAATCCTCGATGTTCAAAGACTGCCTTG
GGACTGTATGCAGTTGATGGGCCCTACCGCCTGCCCCAGCCCCTGTCCAGTTTGCCCTGG
TGTCCAGAGCACCTGGCTTCAAATCCCCTCTGTGTAATCAGGTCAGCCCTAGTCTGTGAC
CCTACCTGACCTGGACCTGCTCCCTTCGGAGAGCTGGATCAGCCGAGGTGATAAAGGGCA
GCTTTGTGAGCCCTTCGCTGGCCTGGGCTGGCGGATAATATACAGTGTGTGGAAATGGGT
CCTTTGAGGGGCATATAAATCATGTCAGATTTTATAGACATGCCTCCTGGAAAGGCACTG
ATTAGAGGATCACATGTGAAACAGGAAGGGCCAGGGATGCCTAAGTAGGAACAGCTGAGC
CTCAAATGTATGGGGGCCTCCCTCCCCCACCTCCCCTGACCTGGGGCATGCTGCCGGTGA
CCTGGGAACTGTAAAATCGCAGCCATCTATCCCTGGCACGTTCTGCCGTCAGCCTGTCTG
CCCCCAGGACTGCCCTTCCTGCTGCTGTCTCTCTGGGCCTGGACTGCCTCCAGCCCCCCA
CGTGGTACTGAGCCATCTCCCTCTGCAGGGCATGAGGCGAAGTCTGAGAACGCCGTGAAG
GCCGGAACCTGCTGTGCCACGTGCAAGGAGTTTCACCAGATGAAGCAGACGGTGCTGCAG
CTGAAGCAAAAGGTATGTCCCCAAGCTTCGCGTATAAAGCGATGAATGGAGGAGGAGGAC
GTGGCCGAGGTAAAGTGGAGGGATGTTTGGGAACAATAAGGAAATACATGTCATCTTTTA
CCTTGCTGAGCACCCACTGTGGCTTGGTGCCTTTGTTCTCAGGATGCTTTGCCCACCTCA
CCCCACCCCCCACCTCAGAGCTGACAGTCTAAAGGGCAATAAAACACAACTAAGACAAGG
GACCGATGAAGAGATTATAGAAATAGTCTATAAGATAAGGGACATGTGGCAAAGCTGGAG
AGAGGATGAGCTGTGACAAATGCAACTTGTAAAACTTAATGTCCTAGGGCAGACTTAGAT
GACTTTATCTAAGATACTGTCCTGTCTATGAACATTCATAAACTGGCATTGGATCTCTGT
AGCAGCTCTGTTTTTCACATTAAAAACTTAACACATGCTTTGTCTGGGCTCCATGTGCAT
GTGAACCTTGTGTCACAGATGGTGGGGACTGACTCACTTTATAAAAGGCTGCCCCCCATG
CCTGACAAAATATCAGATTTCCATTAACTTTACTCTGTGACAAAGGCCCTTGCAGTGGAT
TTGTGGCCTGACTTCTTGAACAGCGGTCCTGGATCCAGACAGTATTTATTATGCCTAAGG
CCAGTCAACTTGCTGGTTTGTCAGTGACTCAGAAATTGCTCCTCTGCAGCTAAAACACAA
GCTGACCACTTTATTTATTCATTACTTCTGCTCCAGGCTCTTAGTACATCAAAGAGGTGC
AAACAATCTGTTTCGCCTTGGCATCCAGTTCTTGTAAAGGGCAGAAGGGTAAATATGAGG
CCATGTCACTTCTCCCTGTTCATCAAACATGCAGCTAGGCCCTGATGAGAACCACTACCA
GCCACACGAGACCAACAGGCGAAAAGAAAAATGGCTTTACAGGCCTTTCACGCTTCATTG
GTGAGCATGTTATCAACTTTAGCAGAGAAGTCTACATATGTGATGCAGAATCATGAGTAA
AACATGGATCCAACCCTAAATAACTTATGACCTTAAAGAGAGACCAGGCAGAAAACCTGC
ATATCAGCATGAACACAGAGATCTAAAGCGATATCCCCAAGTTGAGCTTGTACTGATGGC
AGTATTTATTGAACATTTCTGGAACGAAAAAAAAAAGCGTCCATGGAAGAAGTTTGCATT
TCACAGACCAGAAGACCAGGGCTTGGAGGAGGCAGTTGGTCAGTGTCTCGAGGCATAGAG
GTGCCCTCGATTTCTCTCCTGGGACAGTTAATAAAAAGAGCTTGGGGAAGATCTTTTCGG
CCCGGGGGGTCTTTGGGAACAGTACAGCAAAGTATCATAAGTCAACTGCTGGCTCTCCCT
TATCCTCTCTGCAATGTTTTTTGACCCATGAAAGAGGAAATAGTAAAAAGAAGTTGAAGA
ACCTCCATAGCAATACCTGTCATCCTTAAAGACCCTGCTAGAGCCACATTTTTTTTTAAA
AAATCCATGAGGTCTTCTTGGGACTCTAATAAATCACATGACATTGGGTTGGGCTGGGAT
TCGTCCACCTTATACTGAACTCTCGCATTGTGAAATGCAGTGTGATAACTTGGAGGTAAA
GCTGGCATTCGAGAAACATGATGAGGAGTAGTTCATGTTTAAAGTGCCTATTAGGATGTA
TTGCAATCAGTAGTCGATAAAGCAGTTTTCTCTCCAGGATCTTGTCTGAGTCTCACCATG
ACCCTGTAAGAAAGGTGCCGATATTCTGAGAGGTGAAGTCACTCCCCAAGAGACAGACCA
GAACTAAAACTTGAGTCTTCCACCTTCTACTACTGTGCCGCTGTTTGAATCATCAGTTGG
TATTTAACTTCATCTCACTGCTGTTAATGCCATCTGTACCATCCCCTGTGCAACAATTTA
AAAAAAAAAAAGTGGGATATCTGCCCAAATAACCAGTGGCCGAGAAGCAGGTTTTGGGTT
TCCTGGACTGGCCAACCCCACCGTATAAAATTGTTTGCCATCATGTCCGACTGTACCATG
AATGTGCAGTCAGCAAAGTCCAGACTGTGGGAAACTCTACAGGTCCAATGCCCTGGAATC
TCCAATAGAAAAGTTGTAAGGAAAAGAAAGAGATGGTGCAGTGACCCGCACATTAGAAGG
AACCTAAAAGATATACCTTTTTTTTTTAATGAGCAAGACTAAACTCTAGTGTTTAAGGCT
GCACAGTTGGGTTGTAAATTATTTGTAAGTCACACAAGGAAGTGGTTAATATAAAAGTCA
GGATATTTTGAGGGGAGGGGGAGGGAGGAGACTGATGGGGACAGAGCATATTGACAGACT
TCTGGGGGAACCAGCAGTGTTTGGTTTTGTAAAACATGGGTGTTGGTTAAGTAGGTGCTT
GCCTTATAATAATTCACCAAGATATATATTTGTTTTGTGGGGTTTCCAGATTCTGTGTTG
TATTTTCCTATACAAAATTTTAAAAGTGGGAAACGGACTTTGGCCCAGTGGTTAGGGCGT
CCGTCTACCACATGGGAGGTCTGCGGTTCAAACCCCGGGCCTCCTTGACCCGTGTGGAGC
TGGCCCATGCACAGTGCTGATGCGCACAAGGAGTGTCCTGCCACGCAGGGGTGTCCCCCG
CGTAGGGGAGCCCCACGCACAAGGAGTGCACCCATAAGGAGAGCCGCCCAGCGCGAAGGA
GGGAGCAGCCTGCCGAGGAATGGCGCCGCCCACACTTCCCGTGCCGCTGACGACAACAGA
AGCGGACAAAGAAACAAGATGCAGCAAAAAGACACAGAAAACAGACAACCGGGGGAGGGG
AATTAAATAAATAAAAAAATAAATCTTTAAAAAAAAAATTTTTTTAAGTTAGTGTGCGGA
CCAATGCTTCCACCTCCCATTTCTTCTGCAGTATGGGTAAAAGCCAAATGATTCATGAGA
TAGGGAGAGTTTGGAGATAGATAAAATACCACTCATTGAACTTTTAGAGAGGGGTCTTGG
TCCAGTCAGAGCCCTGAATAAAAATCAGAGCCGAGGAGTCCGTGGATGTTTTCAAAGCCA
CTTGTTTTCCTGGCACACCAGCTGTTTGGAGTCCCAGTGAGGGGCGAGACTCCAGGGAGA
GCCCCGGGCACACTGTCAGCAGGTTCGGCCTGAGCAGAGGATTCACTATGTTTGTTCTCC
TTGGGGAGCTACCTGGGGTAGATTGGACAGAGCAAACTCTCCTCCCCGGGGGGCAACTGA
AGGAAGCGTAAGTAATGATTCTGCCTTTTCTGAGCACCTACTGTACCTGCAATGGGCTGG
GAGATGAGGAAATGCAGAATTGTTTGGAACTGAGTCCTGCCGACAATAAACTTAGTCGCA
TTGGGAAACAGAACCAACAGTGTAAGTCAGCAAATGATTGCCAAGTGGAGTGAAAGCTTC
AGAAGGTGGAGGCTGAGGTTTCAGAAGAGTGAGCATATTTGCACCTTGACGGCTGCGCTT
CCTCTCGCTAGTGCTTCCTTAAACATCTGGCAAATACATGGCTTCACCATAGCCTGTGGC
TTCCTCTGCTACCTTGATCCACTTACTCTGTAAAACGGGTCTTCCCAGGATTGTTGGGAA
GACTGATCTGTACTAAAGTGACTGTGTATTGCTTTGCTAAGTATCATTGTAATATTAAAA
GGTACTGCTTGTTGCAGAGGTCAATAGCACAGATTCTGGAGTCAGACTGGGGAAGTTTAA
GTCCCAGCTCCACCACTTGCTAGCTTTGTAGCCCTGGGAAATTTACTTAGCATCTCTGGG
CCTCAGTTCCATAAAACAGGGATATCAATAATACCTACTCCAGGAAGCAGACTTTGGCCC
AATGAGTAGGGCATCCGCCTACCTCATCGGAGGTGCGGTGGTTGCAATCCCCGGGTCTGC
TTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
AGGGTTTTCCTAATCAAGAGTTAATATTTGCAAAGGACTTAGAACAATGCCTGCCACCTA
GAAAGATCTGTGTAAATGTTTATGAAATTTAAAAAAAATCATTAATCATGTCCAATATGA
AGATCTTTGCAGGCAGCACCTCACTGATTTGTCCCAGTTCTGTAAGGTAGATGTTCTGTT
ATGAAAACTAATATGGAATAATATTCATAATTTCATTGATTAAAAGCCAGGTGTATGAGT
TAGGGTTTTCCAGAAAACCAGAACCAATAGGGTATATGTATATATGTATGTGTGTGTATG
TACATGCATATGTGTATATTTGTGAATGTGTGTGTAAATATTAGATTTATTATAAGGAGT
TGGTTCATGCCGTCTTGAGGGCTAAGTCCGAATTCTGTAGGTCATGCCACCGCAAGCTGG
AAACTGCTAAACATGATGTTGACAGGCTAGTCTGAATTCTCCAGGGACTGCTGACTGGCT
GGAAATTCTAGCAAGAACCAACTCTAAAGTTAAGGCAGAAATTCTTCTGACCTCTGAAAT
CCTCAGTTCTGGCTTTTACAACCTCCAACTGATTGGATTAAGTGTCTACCCACGTTGCTA
AAGGCCTCTTCTTTGTTAATTATAAATGCAGTCAGCTGATCTTAGGTGCAGTAAACTAAA
TATAGATGCAAATCTCATCTACAAAATACCCTCACAGTAACAAGCAGGTTAGGAATTGAC
CAAACAATTGAAAGCCATAACCCAGCCAAGATGACACATGATATTAACCAACACACCAGG
CAAAATATAGACTCTTCTTAGTGAACACAGCCTTCTTCCCAAACACCGGCCTCCCACAAT
CCCAACTCCTACTGTGTTCTTGCAGAAAATCAAGCCAGGGATTCTGGGTGGCTGCCTCTG
CAATGCCAGTCCCTTAACTTTCCTCTCCTTCTGCTGATGCACAGAAGAACTGAAGGTAGC
CAGACTAATTACCCAAAAGGAGGTCTGCCTGGAGACCGAGGTTCACATTTACTGGGTCAA
CTAATGACTTTTACAAGGGAGCAAGCAGAATAATAAGGTGCGAACAGAATATGGGAGTAG
TGTCTCTAAAACACATCCACATGCAGGACTCTTCTTTGGTCCTCAATTTCAAAATGCTAA
AGCCAAAGATGTACCCTCCTACAAAGGCGTGTGTGTGGTTGCCTGTCCTTGGACACATAA
GAATTGGAAGCAAAAGAGATGTAGACTTTGAGAAGTCTGAAGCCAGCTTTCTCCCCACAA
GATCAAGGTCTCCCTTTCCCACACAGAAAATAAACATGAAAAATAAATAAAAAACCAAAG
ATGTGATCATCTAATCCAAACCTCACATTTTGTAGATGTGAACTTGAAAACCTGGAAGGG
TAAGGGACCTATCCAAAGGCGCACAGCTTAGCAACAGCCTGGAACAACCTCCAGCCAGAG
CATTTCCATGTGTCAGTGGTCATAGCTGCTGCCCACGGTTAGTCAGCTGGGCACTGTGGC
CGGCACTTTAAAGACATCATCTCAGGGGAAACGGACTTGGCCCAGTGGTTAGGGCGTCCG
TCTACCACATGGGAGGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCCATGTGGAGCTGG
CCCATGTGCAGTGCTGATGCACACAAGGAGTGCCCTGCCACGCAGGGGTGTCCCCCGCGT
AGGGGAGCCCCACGCACAAGGAGTGTGCCCTGTAAGGAGAGCTACCCAGCGTGAAAAAAT
TGCAGCCTGCCCACGAGTGGCGCCGCACACACGGAGAGCTGACACAGCAAGATGACACAA
CAGAAACACAGATTCCCAATGCCGCTGATAAGGATAGAAGTGGTCACAGAAGAACACACA
GTGAATGGACACAGAGAGCAGACAACTGAGGGGGGGAGGGATAAATTAAAAATCTTAAAA
AAAATTTTTAAATACATCATCTCGTCTCACCCTCTCAGGAGCCCCTGTAGGGGAGTAATT
CGGAGCCCCAGCTGATAGAGAAGAAATCCAGGTTATGTAGCTTACCCTAGATCTCACAGA
TAGACAGTGGATGGGCTAAAGATTTACCCATAACTCTGTCTAATGCCAAAGCCCATGTGT
GGGATCCACTTATCAGTTCCCCAGTTGGAAGCAGATAATAAAATTGGACCAGCATTCAGC
TGCCAGTGTTGACCTTTACCACTGTTTGATAGCGGGAGTCGATCCGGGTATAAGTTTCCC
TCATTCAATGGATCTTTCCCCTTCTACCCCAAGACCACAGGCACAAGTGTGCAGGTGGGA
GTATTTTGTTGCTGTGAGCCTGGGACTCAGGGCCATTTTAAATAAACCCTGGAGTGCAGC
CGTGTCCTAATGCTGACTCCAGACCATCAACTCTGATCCGAAATTGTGCAAAGCTGACTT
TCAAATTGCTCAAGAGTATAATTCTACAGGTTCCACGTCATGATCATAGGGGACTCACAC
CCTCTGTCCCCAGAAAATGGCTTTTTTTTTTTTTTTTTTCATCTTTCAGGGAATGCTAAG
TCTTCACAAAAGATGAAGGAAAACCGTATGTCAGAAAGGCAGTGGGTGGTCAGGAATTTC
TGAGGTCGTGGACCTGCAAGGCTGTCCTGAGCCTTAAAGGGCTCCTAAGCTTTCCAGGAG
TGTATTTTCAGATGTGCTAAGGATGCTGAGGGGACCTTTTGGAAGAAAGTGTTGAGTGTC
TTTGCACTTCCTGTCCTTCTGAGCATCCTTTGCTGTCCTGGGCTGAATAGATGGGCTTCA
GGGCAATAGAAGACCCTCTGGGGACACTCCAGACCAGGGACCTTCCCAGACTCCAAAAGG
ACACCTAGGATTCCTGAAGTGGGGAGAGGATCTCTTGCCCCTAGAAGGCCTAGACACATC
CCCCACCACCCAGGCACTTGAGGAAGACCGAACAGTAGCAACACCATTGGCCTCATGGCT
CGGCTCATTCTTCATGCCAGGTCGCAGGGAGCCAGCCACAACCCTCTGCTGGCTCTTTGT
ATAAAATGGATACAGGCCTGGGCAGTCAATTCTCCAAGAAGCTGGAAGAATTTGTTCCCC
ATGAGGTGTATCAGGTAAAACTTGTTTGCCGAAGTACAAACCACATGTTATCGTAATATT
CACTTCTCATTAACATCAGATTTCTTCCATTGGCAAGAATCTCTCTCTTCATGACTAAGC
AAAATCATCAGTGTGTTAGGCTGTATCCAGAGAGCCCCAAACCCAGAAGCTGCCTGGCAG
AACAGGATCTGCCTAGCAGAATCAGGCTCCTGTTTCATAAGGGGAGTACCAAATGTCGTT
GTGCCAAACCTCCATGCTCAGACATAGACACTAGTGAAGGAGCGCAGGGACTTTCAGATG
CCAGAGAAAGTCATCTTGAACAGCAGAACTTTCCTTGGCCTACCTGGAGTCACTCACAGC
CTGGAACCTTGGCTGAAATGCAATAAATACATTTTGTAGTCCCCCATGTGCTGTTCTCAG
GCTGCATACTAGTGACCCTCATGAAGTAATTTCTGTTGCATATTTAAATTTTAACAAATC
TAGGTTAGCATATTAGAAACAACTGCTAAGCAATAATCTAGGAGAAATCCATTATCCCAT
CAGGCACTGAGCATCGCAGTTTATCTCTTATAGGTAGCAGGAATAATGTATATATCTTCT
ATGTAAGAAGTTTTGATTTGCCTTTAAATATCAAATATGAAATCTATTCTTAAATCTATG
TTCTTAAAGTTTGAGTGTTACAAGTTATAAAACTGTTGAAGACCCTCAATATATCTGTAT
ATCTGGGAGGGCCTGTCTCAATGATCCAGGAAAATGTCTAGGTTGGGTTGTAAGAGAGAC
AGGAAGGGGGTTCTTGAAAATAGACTGGGCCCTATATTGGTTCTCTATTGCTCATTTTAA
AAAATCACCCCAAGTCTTAGCAACTTAAAACAATGACCATTTATTATCTCACAGTTTCTG
TGGCTCAATCTAGGAGACGTTGAGCTGGGTGATTCCAGCTTATCATCTTTTATGCACTTG
CAGGCAAGATGTCAGTCAGGGCTGCAGTTGTCTGAAGGCTCAAGGATCTGCTTCCAAGAT
GGCTGACTTGCATGGCTGTTGGCAGGAGGCCTCAGTCCCTCAATATTTGGTCCTCTGTAG
AGGATGGCTTAAAGGTGCCCATGGCTTCCCCTAGAATGAGTGATCAAGGAGAACAAGGAG
GAAGCCACAATACTTTTATGACCTCGTCTCAGAAGTCATGCACCGTCCCCTCTGTCATAT
CCTATTGGTTAGAATCAAATCACTTAGTAATGCCCACATTCAGTGGGTGGGAAATTAACC
TCCACCTTTTTAAGGGAGGAGTGTCAAAGAATTTGTGAACATCGTCACTATTTCCCAGTT
GTACTAAAGGTCAGCCCTGGGTGCACAGGCGAGCTGTAAGTCACATTTGAGCCTGGCCCC
CAAGACTGAGAGTTCTTTAAGGACAGGAATCTTGTCTTGGTCATTGTAGCCTTAGAACCA
AGCACCAGGCCTGGCACATAATAGGTACAAACATTTGAGGCACAAAGTCATTAATGAGCA
AATGGGGAGTGAACAAGGTAGATTCTGCTAATTATGGTAATGATGATTCTGTGTTGATGT
CCAGGTGATCTGGAACCTACTTGGTCAAGGCTTACCCACTGACTAGCTGAGTGACCTCAA
CAAGCCATCTTCACTAGAAAGCCCCTGGGTTCAGAAAGAGGATCTCCACAGTCCGGGGAG
CTCTACTGGCTCTCATAAAAGGAAGTGATCAAGAAAAGCCCTTGCAGCCTCCTCCAACAA
CAGGAATGTAAAGAAACTCCCTTGCAGGGGAGCCATTCTTTCCTGACTGAGGTCTCCTCT
TCTCTTTTCAGATTTCCCTGCTCCCCAACAATGCTGCCGACCTGGGAAAGTACATCACTG
GCGACAAGGTGCTGGCCTCCAACGCATTCCCTGCCGGACCCCCTGGCCTGCCTGGGGGCC
AGGGCCCTCCCGGTGAGTGTGGAGAAGGACCCAGGAAGGTGGTGGAGTCCCAGCAGAGGC
CTGCCCAGAGCGTACTTGTACTGGGGGCTGGCCCGCATTCTCTGGCCTCATCGATGGGAA
CAGAAGTCAGAGTTCCAGGGAGCTCCAGCACCATTGAGATGGTCTTGGAAATTGGGCCCA
TAAACCTGTGAAACTCTCATAACAATGGTAATTTCAGGAAAAAAGGTCACTGTCCTGAGA
TTGAATAAGAGTCCTAAAGATAATTGGAAATTACAGACCAAAAAATGAAAACTGTTTTTT
TATTTTATCCTGAAAAAAATTCAAACACCTACAAAAATAGAATAATATAACAAATTCTTA
CGGGCCCATCTCCCAGCTCTTAACCGCTCACGGCCAGTGTCATTTCCACTATCCCTCCTC
CCTACTTCCTTATTGTTAGCACACATTTACATCTGTATTTGTTTTCATACCTATCTATCT
ATATGTTTTAGTCAACCTTATTGAGATATAATTACATTCCAAAAAATATACCCATTTAGG
GTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATAATTACAAAGTGCTTTCTGTTATTATGAGGGCTGTTCCATAGATGGATATAAAT
CAGTAGTTTTTTATGCCACTAAAGGAAATGGAGGCATTAGCGTAAGTCAATGGTTCTAAA
ATGTGGAGTGTCTTACCCCTGACTATCACTGCTTAGCAGTATACTAGGTGATGTGAGTGC
CATCCTGACACTCTAGTTGGGCAGACCAGACATAGAAAGCAAAAGCAAATAGAAAAAATA
ATGTATTCAAGTGCCACCAAGTAAGTACACTGGTGAGTCCAGGAGTGGATGATTAAAGAA
GGGAGAAGTAGGAAGCTGATATGGCTCAATTGATAGAGCGTCCACCTACCACATTGGAGG
TCCAGGGTTCAAACCCAGGGCCTCCTGACCCATGTGGTGAGTTGGCCCAAGTGCAGTGCT
GATGTGCTCAAGGAGTGCCATGCCATGTGCAAGGAGTGCATCCCATAAGGAGAGCCACCC
CACGCAAAAACATGTGCAGCCCACCCAGGAGTGGCACTGCACGCACAGAGAGCTGACACA
GCAAGATGATGCAACAAAAAAAGAGACACAGATTCCCAGTGCCACTGACAAATATGCAAG
CGGACATAGGAGAAAACACAGAGAGCAGACAACTGGGGGGGGGGGGGGTGGGAAGGGAAG
AGGAATAAATAAAAATCTTCATTAAAAAAAAAAGAAAGAAGGGAGAAGCCACTGTGGCCT
GCAGTGATTGTGGGAACTCGGGGTTTGGAGAGCATGTACATGGAAGACCAGAAGGACTTG
TCCAAGCAAAGAGGACTTGGCCCAGGTTTTCCTTTGAAAGATCAGCAAGAACAAAGGCTC
AGAGTTCTTTCGAAAGTATTTGTATTTCCTTTTTCACATTTGCGTAATCCCCTGGCTTCC
CTCAAACATAGGTGGCCTGGGTCTCCGTCTGTACAGAGAGTAGGAACTGGTCCAGGACTT
TGGTTTATCTTCCTGGCCAGTCCCCTGGGCTGAGGTTCTCTGGCTCATGCCCGAGGTGTC
CCAGCAGATGTGTCACACAGGCAGTCTCTGCTGCTCTTAAACAGATGGGGGTCTTTTCTT
ACAGGTCAGTTCCTAACACAGTGCTTTCCCGTCTCTCAGAGAATGTTCTCGTTTTGCATC
CCTGGAGGAAGTTCATCTCCAGGCTGGTCTACGTATCAAAAGAACAAGAACAAACTGTAG
GAACAGGGGAGCCACTTGCTGTCTTTCTTCTTAATGAATGATTTGTTGGCTTTCCTCTCC
AATTCTGCCATCTGGTTTTTAAAGTGGTTTCAGCTGTCCAAGGTCTTTGACGGAGGTGTT
TAGTTTTTACTTGTGGTGAAATTTGCAGAGAGTGATCAAAGAGAGCTTTTTTACAATGGC
CACACCCTTGCTTTCTCCAAGTCTGTGTCTTCCTCACTCCTCACTTCCAGCATCACAGTT
TATGATCCCCTCCGTTGAGATGTATTAGGGAAACTAGAGAGCTGACAACTAAACATCTAG
TCCCAAGGCCTGTGATGAATCACGGACTAGAGCACCAATGCAGGAAACAGCACTGGGTTG
GAATCCTTGGCTTTGGGGGCAAGGGTGTAGCCACTGTCTCTTGCCATCACTCATGTAGAA
GGTGCTGCCATTTGCACATCAAAGTCCCGTATTTTAAAGGTACTTGATATATAGTGATCC
ATGAAGTTCATTGATTATGTAAATTCAGGTAAGACACTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACT
AGAGAGCTGACAACTAAACATCTAGTCCCAAGGCCTGTGATGAATCACGGACTAGAGCAC
CAATGCAGGAAACAGCACTGGGTTGGAATCCTTGGCTTTGGGGGCAAGGGTGTAGCCACT
GTCTCTTGCCATCACTCATGTAGAAGGTGCTGCCATTTGCACATCAAAGTCCCGTATTTT
AAAGGTACTTGATATATAGTGATCCATGAAGTTCATTGATTATGTAAATTCAGGTAAGAC
ACTATCTCTGCTTTGTCCCAGTGCTATGCAGGTAGAGTATTAGAGAAGGCATCTGGTACC
ATTCCCAGGTAACACTTTCAGGGTATACCTGGAACCAGTATTGAGAGTAGGGGTATGAGG
CATATATGGACAAAACATTGATTGCTTTAAATTTTGGCTTAAATACTCTGTTAACTAGAA
AAGACTTCCCCAGATGTAACAGGTCTGAAATGTTTGTTTTAATTTCTGGAGCTTGAAAGT
CATCCCACTATGTACTATGCACTATCCCACTATGCCGTGTCAATAATAGAGGCCAGGGAA
GTGGATGTGGTTCAAGTGATTGGGCTTCCGTCTACCATATGGGAGGACCCAGGTTCAATC
CTCAGGGCCTCTCTGGTAAAGGCATGCCCTACACAACAAAAGAGACATCTGGAGAGTTAA
GGCAAGACACAACAGAAACTCAAGAACTGAAGTGGCACAAGTGACAGGGAATCTCTCTCC
CACATTGAAGGTCCCTGGGATCAAATTCCTGGTGACGCCTAGAGGAGAAAACAAAAAGAG
AAACAAAAAGAAAGAGACACAGAAGATCACACAGCAATGGACACAGACAGCAAAACAGTG
GTGGGGGGGGCAGTAATAATAGTAATAGAGGCTAGATATGACCAAAACTTAATTCCCTTA
TGCACTTGAAAGAGACGTCTCTGAGGAATAAGTATAGCACAGCAATCAACCAAGTATCTT
CAACCGTTTGGCAAGAAACATTGATTAAGCAGCCTATTATGTACCTTAGACTCTTTGGGA
AGATGCTGATAAATCAGATATGACCAATGCCCTAAAGGAGTTAACTGTCTAAAAGAGGGG
TTGAAGCTCAATGTCTACAGGAACCAGGAAGCTAACATATTTGAATGAAATGATCTGAAA
GTGAGCAGAAAGGAGTTAGAGAAACTGAGCTGAACCAGAGAGCACATACCCCATCTACAG
AAAGCTCTAGTTGACTATCCCCATGGGGCAAGAGTGGTCTAGGTTTTAGTTTTCCTGTTT
TAAAACAGAAGCCAGAAATCCACATTTTTATATGAAATTTCCCATTTTTAAATGTTAGGA
ATATTCAGACAGTAATGGTATAAATAAAGAGAGTACCTATACATGTTTAGAGTAAGGTAC
ACAATGAGTAAGCAGTTAATTCTCTTACAGGGAAGAGGCTGTGAGGAAAGACATTTTTGG
AGAATTGTGATCTGAGGTGATCAAATGGTGGTGGAGGCAAAAGAAGGAGTAGTCATCCAG
GCTACAGAGTTCATGGTTTATCCAGAGAGGATGGGAACTGAGAGGTGATGGGAACTGAGA
GGTGATGGAGAAGGAGGCAATGGTGAAAAAATGCCCAGAGAGGAAGACAAATACCTGGTC
ATGAATGACCTTGTATAGCACGCTGAGGAGTTTGAGCTTTATTCTGTATGAAAAGGGAAG
CTACTGTAGGGTTTTCTTGGGGGACCCCAATTACACATATGTTAAAATATTTGATATTGT
CCTGAAGATCTTAGATGCTGTTTTATTTTTCACTTCCACTTTTTTTCTCTTTGTGTTTCA
TTTTGGATTATTTCTACTGACTCATCTTTATATTCACTGATTCTTTCCTCAACTATGACC
GGTATGCTAATAAGTCAATAAAGAAAATGTTCATCTCTGATATCATGCTTTTTTATTTCT
AGTATTTGTTTGACTTTTTTTTTTTAAATCTAGTTTCAAATCTCTGATGAAATACCCTAT
CTGTTCACATAAGCTGCCTATCTTTTCCATTAGATCCTTTAACATAGTAATTATTGTGAT
TTTAAAGGCCCTGTCTGATAATTCCAACATCTGAGTCATCTTTACATCTGGTTTTGTTGA
TTGCTTTATTTCTTTTTTTCTTTCTTTCTTTCTTTCCCTTTCCCCACCATTGTCTGCTCT
CTGTGTCCATTTGCTGTGTGTTCTTCTGTGTCCACTTGCATTAACCAGCGGCACTGGGAA
GCTGCATCTCTTTTATTGTTGTTTTGTTGCATCATCTTGCTGCATCAGCTCCCTGTGTGT
GTGGCGCCACTCTTGGGTGGGCTGCACTTTTTGCACATGGGGCAGCTCTCCTTGTGGGGC
GCACTCCTTGCATGTGGCTCACCCCTTCACGGAGGTGTCCCTGTGTGGCACAGCACTCCT
TGCGCACGGCAGCCCTGCACATGGGCCAGATTACCACACGGGTCAGGAGGCCCTGGGGAT
CGAACCCTGGACCCTCCATATGATAAATGGACACTATCAGTTGAACTACATCTGCTTCCC
GATTGCTTTATTTCTTGGATGTGGGTTTGGGAGTTATTTTGTTTTGTTTTGTTTTGTTTT
TTGCTTTGTTGGGTATGTCTCAAAATTTGGACTGAATCCCATCATTTGTAAAGGAACAGT
AGAGACTGAAGTACATAGTAATTAATCCTGGAGATGAGTCCACCTTTTCTTCTCTCAAGT
CCCTAGCATGAGTGTGTTAAGTCAGTCTAGCGAGTAATTGAGCTGGGTTTGGGTTTTGTC
GTTTCTATCTTTGCCTTCAGTGTTCAACAGTCTTTAAGTTTTCACATTTCTCTAGTGATA
GGATACTGTATTCAAGGAGGATGGGGTCTGAGAGCCAAACTATGCCTTGTATCTGTGGCA
AATCTTGGGCAGGATATTTTCTTATTCCTCCCACAGTTGTAGTAGACATCTGCCGTGTAT
CAAACAGGATCCTGAACTCAAGATGCTTTCTTGCCCCTCTTCCAGTGGCATGTGGCTTTT
GCTTCTACTTTCTCTAAAAGCAGTGGCTCTTTGCCTGGTTCCTGGATATAGGAGGTGGTT
TCCTACTTTTCCCACAGAGGCAGACTGGTTTGCTTTTGCTCCTTCCCCAGAGGCAGTGGA
CTTTTGCCTGCCCTTAGAGGAGAGAGGGTTTGCTGCCCCATCCCAGGGGCTTGAGCCTTT
TGCACCGAAGGGTTAAAAATGAGACAGTGACACAGTAAGATGTTTTAGAAATAATATTCA
GGTAAAGTGTGAATAATGGGTGGGGGGAAAAGAAGATGGAGAGGAGGCAGAAGGACAAGC
CATGAGACAACATTCAAGGCAAATACAAGAATGGCCTAACAAATTTTTTTTGAGTGCTTA
CATGTATGAAATACTATGCAGAGTCAGGTGTGTATGTGTATAAAATCTCATTTCATACTA
ACAACTGCTCTATAAAGTGGATTTTTATTAGTCCAGCTTTACAGATAAGAAACTGAGGTG
CAGAGAGGTTAAGCCACTTGTCCAAAAGTCAAACCTGGATCTCTCTGGTGCCAGCGTCTG
TACTCTTACCACTACCCAGCTGTAGAGTAGACAGTTACAAAAGATGTTAAAAAGCTCAAG
GTAAAGAAACTGATTGGATAAGGAAGTTGTGGAAATAGAGAAATACATAAGGAGACTCTC
AATTTTCTGGCTTGGTGACTGGTGCTATATGAAAAGAGGGGAACAGGGTTTTATCATGTT
GGGTTTTAAATCCTATGTGGCATCCTAGTGGAGGTGAGAGAAGGCAAAGGACAGAGTGGA
AGGCGAAAGTGCTGAGGAGGGCTCCTGGCCTCACTTGTCAGCCAGAGCCCCTTGTCCTTC
TCACAGGCCCTGGCACTAATGAGGTGTTCTCTGATTGCAGGCTCACCTGGACCAAAGGGA
AGCCCAGGCTTCCCGGGAACGCCAGGCCCTCCTGGGCAGCCTGGCCCACGGGGCTCCATG
GGACCCATGGGACCGTCTCCTGATCTGTCTCACATTAAGCAAGGCCGGAGGGGCCCCGTG
GTCAGTATTGTATCACAGATCCACTTAGCCCCACTGGCTAAAGTGTGTTCTTGTCCCATG
CTTTCCCTTCTGTTAACCCAGATCCCTTTGTCTTATAGGGCCCTCCAGGTGCACCAGGAA
GAGATGGTTCCAAGGTAAGTCTTACGAGTGGACTTTACAAGCCCAAGGCCTCTCTGTTTT
GACCTGCTACACAGCATCAAGTAAAGCAAGAACACTTTACTGCCTCCATTTTGCATGTGG
GAAAATCGAGGCATAGATATATTTTTTTCCCCAGAGCTTAGAAGAAACTCTAAAAGCAGT
TCCTTAAAATGTGAAACCAAGCTTAAAAACAAAAACAAAAATAATCCTAGGAAAAATTAC
CCCTATAAAGTTTTAAATAGGCCTGGGTTTGTAATAGTTAGCATGTGTTTTTCTCTTTAG
CCAGCATCCCTTTGTAGGGTTTTTGGTATTGTTTTTTGGTCCTCATCTCTTTGATGCTCT
TTTGTTGAGAACAGGAGAGGTTCCATTCTGTGGTTTTGCTTGGAGAGCCACCTCCTACTT
GTCTCATAAGGAAGGCAATGTGAGTTACCTTAGAAAGTTTCTAAATTATTCCACCCACTG
CCGGGAAGTACATGCATTCCTCTTGTGAGATCTGGTTTGAAAACATGGCCTCAGGGGAAA
TCAGAATGAGGGACATTTGACCCAAGCAATTCTATTCAAGTAAGTGATCCCACAAGTCCA
GCTGCAGCCTTACATTTGTTTCCAGTAGAAAATACTTGTTGTTTTACTTGGGTGTTTAAA
TAGGGGCAGTGGTGACAGCATCCCCAAGGTCAAGAAAGCTAACCCTGACCTTTCTCCTTC
TAGGGGGAGAGAGGAGCGCCTGGGCCCAGAGGGTCTCCAGTAAGTAGCACTACTTCCCCA
GTGGAAGGTTCTCAGGGACGCAGGTCTGATGAGCCTGTAAGTCGTTCTTTATTAACAAAC
GCCGGCCCCTTCCAGCTATCCCCCAACCTGCTTGGTTAGAAAAGGAGTCAAGGAAGCCTT
TAGCAGCTGGTCTGAATTTATTTGTTTAATTTACTTTCTGTTGTCCTGTTGTCTTTTATC
GTGGCTAATCTCTTATTTGGAATGTATTCTCCTAAGATTTAAAACCGCAGTACACCATGA
GTGCATTTCTAGGTGGGTCATAAGATATTTGAAAGGATCAGTGGGGAAATCTATGGGATC
AAATCACGACCATCTCCTCTAAAAAGTGCAAAGGCATGCAGACCTGCGTGGGATCTTGGG
AAAATTGACTGGATCCAAAAGCACCGAAAGTTCAAGCAACTCCAAAATTCAAACAACCTC
AGTGCTTTTGAAGTCATTGTCATTTCTAACAAAAGGAGAAAGAACCATGTCTTCAGAGGT
CGAAGGTCTGGATTCCCATCTTGATTTGTCCACATTATCACTTCAGTCATGGCCACGTCA
CCTAGCATCTTTGGGTGCCCGTTTCCCCACCAGTAATGGAATCCGATCTGCCACAATTCA
GTGGTTACAGTTAGGGCCAAATGATGTCAAAACATTATACATCTCCAAGTGCTTTACAGA
TGCAAGCTGCTGCTTCTTAGGTGATGGCAGCCACAGCAGCGACTGGAGAGCAGGGCTGGG
AGCACAGCAGTATAATAAAGCTTTTTCTGCACGCTTCTAAAGGGCCTAAACATGCATGCT
TAAACAATTTTTTTTACCATGCCCCACAAAACACTGCATAGAAATTAAAGCTTACTAAGG
ATGATATTACAATAAAGGATGTCAATAAATGAAAAAATGAGGAAGGCTTTCTAGAATCAT
TTGTAGCCATGGAGGAATTGATGTCTTTACAACATACTTTCATTTAGGTTACAGTTATAG
TCAGCTGTCCTTATAAACATTTTAATTTCATTTCTAAAAAATAATGGATAGCATTTTTGA
GCATTTATTATGCTCTCAGCCCTTGACCTGTATTAACTCATTTAAATCCTCACCAATGAA
ATTCCATGAAGTTGGGTTATTATTATCCCCATTTCACAGAGAGGGAAACTGAAGTCCAAA
GAAGTGAAGTCAATAGGCCTGTATCACACAGCTAGTAAGTTACGATGCTGAGAGTCAAAC
CACAGAACCCCAAACTCTTAATCACTGCTCTGTTGCCTTCTGGGTCTCTTTGGGAAGTAA
TCTGGGATGGTTATTCTCATATTCTCTCATTCTACCAGATTCGAGGTAGCCTAGAGCTAG
GAGGGGTACGAGGCGAGGTTGGCACCAAAGCTCAAGGCACAAGTTATGGACTAAATAGTT
GTCAGCAAGCAGGGGTCTAAGAAATCATGGAGGCCAAGGAGGTGGGGCTGTGGCAAAGGG
CTGCGTCTGCTGTGTTGACTCTGATTCCTTCCACGTGCACAGGGTCCTCCCGGCTCCTTC
GATTTCCTGCTGCTCATTCTGGCTGATATCCGCAATGACATCGCCGAGCTGCAGGACAAG
GTGTTCGGTCACAGGACTCATTCTTCAGCAGAGGAGTTCCCTTTACCTCAGAAATTTTCC
AGCTACCCAGAAACCATGGACTTCGGCTCTGGAGATGACTACCCGAAAAGAACAGAGACA
GGAGACTTTTATCCTTAGCACAACCCAGCATCTTCATGCCAAAGGAAGAAAAAGGAGGCG
AGTTCTCACCGACAGTTAAATCATCTGAAGAAAAGGAAGAAAACACTGGGGACACAGAAA
AAAATTTATTTTTAATTTCCCTTTTTCCTATCTTCTACCTACTTCTCGTCTTCCAAATAC
CTTTTTCAGAGTTGCTCACTAGCGGCTAAGGAGTAATGAATGATTTGCATGACTACACTG
GGAGCCAGTTTGGGTGCTCTACATTGATACTTTTCCTTCACTTCCCATTTCTTCAGAAAC
TTCTGGAGCTCTGAACTCAATGCTCCCATACTGTCTTAAAACTTGGCAGAATATCAAAAG
GGAAAAAATGGCAAGGTGAGCGCCAAGAAAATCTGAAGATATTTATAAAAAATTAGATGT
GTCCAAAATAGACTATTACTCCTCAAAATTAGGCCTTTTTGATTAAAAGTCAGGGGAAGG
GGAGGGTAGGACAACCATGACTGTGTCGGTCGAATAGATTTTAAATATTCCATTCTATTT
TCTAACCATGCTTCCCAATTTGGTTAAGAAAAGGAGAGAATTAAAGGGGAGTGAAGATAA
GGAAAGATGGGGGGAAACTATGATCATATAGTTACTGTCATATAGGTTGCCTCATTTTAA
AATTCAAATATGACTGTTAAGGGTTCATGCCACGCGTATCTATAAGTATCCTATTTGGAG
GAGAAAATTACTCTAGCTGCGAGAATAAATCCCTTTTCAAAGCACAGTACGTAAATGGAA
TGCCTGATTCCCATTAGCCCAATGGGTTCCCAGCTTGCCAGGACATTTCAAGTGTACTGT
GAGGCTCAAGGCTGGAACACAGTGGCTGGCCTGGATTCTGGGAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1050, 1551..1631, 95579..95631, 95732..95866, 97883..98035, 108268..108371, 117431..117551, 137680..137819, 137918..137953, 138663..138698, 140202..140417
1001..1050, 1551..1631, 95579..95631, 95732..95866, 97883..98035, 108268..108371, 117431..117551, 137680..137819, 137918..137953, 138663..138698, 140202..140414
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved